Glutamine-rich Domain Research Articles

LMW-GS genes in Agropyron elongatum and their potential value in wheat breeding

To study the usefulness of low-molecular-weight glutenin subunits (LMW-GS) of Agropyron elongatum (Host) Nevski to wheat (Triticum aestivum L.) quality improvement, we characterized LMW-GS genes of A. elongatum. Nine LMW-GS genes of A. elongatum, which were named AeL1 to AeL9, were cloned by genomic PCR. After sequencing, we obtained complete open reading frames from AeL2 to AeL8 and partial genes of AeL1 and AeL9. All nine sequences are homoeologous to those of wheat and related grasses. Comparison of the deduced amino acid sequences with those of published LMW-GS suggests that the basic structures of all the subunits are very similar. However, except for AeL4 and AeL5, which contain the identical N-terminal sequence with LMW-m, other LMW-GS sequences separated from A. elongatum cannot be classified according to previous criteria for the three types: LMW-m (methionine), LMW-s (serine), and LMW-i (isoleucine), and then 12 groups. In addition, there are some characters in the LMW-GS sequences of A. elongatum: AeL2, AeL3, and AeL6 involve a Cys residue in the signal peptide respectively, which is absent in most of LMW-GS; AeL3, AeL6, AeL8, and AeL9 start their first Cys residues in the N-terminal repetitive domains, respectively; both AeL2 and AeL5 have nine Cys residues, with an extra Cys residue in the N-terminal repetitive domain and the repetitive and glutamine-rich domain; AeL2, AeL3, AeL6, and AeL9 comprise long repetitive domains. Phylogenetic analysis indicates that there is a relatively weak sequence identity between the LMW-GS genes from A. elongatum cloned in this study and those reported from other plants. Three LMW-GS sequences, AeL2, AeL3, and AeL6, are clustered to Glu-A3 from wheat than to those from other plants. The possible use of these genes in relation to the high quality of hybrid wheat is discussed.

Impaired maturation of myeloid progenitors in mice lacking novel Polycomb group protein MBT-1

Polycomb group (PcG) proteins participate in DNA-binding complexes with gene-repressing activity, many of which have been highlighted for their involvement in hematopoiesis. We have identified a putative PcG protein, termed MBT-1, that is associated with Rnf2, an in vivo interactor of PcG proteins. MBT-1 structurally resembles the H-L(3)MBT protein, whose deletion is predicted to be responsible for myeloid hematopoietic malignancies. The human MBT-1 gene is located on chromosome 6q23, a region frequently deleted in leukemia cells, and shows a transient expression spike in response to maturation-inducing stimuli in myeloid leukemia cells. MBT-1(-/-) myeloid progenitor cells exhibit a maturational deficiency but maintain normal proliferative activities. This results in the accumulation of immature myeloid progenitors and hence, a marked decrease of mature myeloid blood cells, causing the MBT-1(-/-) mice to die of anemia during a late embryonic stage. Together, we conclude that MBT-1 specifically regulates the maturational advancement of myeloid progenitor cells during transitions between two developmental stages. We also show that MBT-1 appears to influence myelopoiesis by transiently enhancing p57(KIP2) expression levels.

Mammalian transcription activation domains of VP16, AP2 and CTF activate transcription in a whole cell extract from Schizosaccharomyces pombe through the SRB/mediator

The acidic-rich activation domain of VP16 and the proline-rich activation domains of human AP2 and human CTF are able to activate transcription in a whole cell extract from Schizosaccharomyces pombe, whereas the glutamine-rich domains of Sp1 and Oct2 are unable to activate transcription in this system. Immunodepletion experiments of the whole cell extracts using specific antibodies against pombe TAF110, pombe TAF 72, pombe TBP and Srb4 shows that the activation of transcription by VP16, AP2 and CTF is through the mediator, since depletion of Srb4 inhibits activated transcription but does not inhibit basal transcription. Immunodepletion of TBP causes inhibition of both activated and basal transcription. On the other hand, immunodepletion of TAFs does not have an effect on either activated or basal transcription. Purified RNA polymerase holoenzyme is able to rescue the transcriptional activation activity of the anti-Srb4 immunodepleted extract. Moreover, we demonstrate that the mediator is needed for basal transcription of a TATA-less promoter.

Identification, Characterization, and Functional Analysis of Sp1 Transcript Variants Expressed in Germ Cells During Mouse Spermatogenesis1

The SP family of zinc-finger transcription factors are important mediators of selective gene activation during embryonic development and cellular differentiation. SP-binding GC-box domains are common cis-regulatory elements present in the promoters of several genes expressed in a developmentally specific manner in differentiating mouse germ cells. Four Sp1 cDNAs were isolated from a mouse pachytene spermatocyte cDNA library and characterized by DNA sequence analysis. Northern blot studies revealed that these cDNAs corresponded to 3 full-length Sp1 transcripts (4.1, 3.7, and 3.2 kilobases [kb]) and an additional 1.4-kb 5'-truncated Sp1 transcript that are temporally expressed during spermatogenesis. Quantitative real-time polymerase chain reaction studies verified that the highest levels of Sp1 transcript expression of 4.1, 3.7, and 3.2 kb occur in the primary spermatocytes. The spatial and temporal expression patterns of these Sp1 transcripts and their encoded 60-kDa and 90-kDa SP1 proteins were demonstrated using in situ hybridization and immunohistochemical analyses. To assess the transcriptional properties of these SP1 transcription factors, SP-deficient Drosophila SL2 cells were stably transfected with the respective Sp1 cDNA expression vectors and cotransfected with either Ldh2, Ldh3, or Creb promoter/luciferase reporter constructs. The levels of SP-mediated luciferase expression observed depended on the structure of the glutamine-rich transactivation domains and the number of GC-box elements present in the respective promoters. The alterations observed in germ cells in the patterns of expression of the Sp1 transcripts encoding the 60-kDa and 90-kDa SP1 isoforms suggest that these SP1 factors may be involved in mediating stage-specific and cell type-specific gene expression during mouse spermatogenesis.

Complexity of Translationally Controlled Transcription Factor Sp3 Isoform Expression

Sp3 is a ubiquitous transcription factor closely related to Sp1. Both proteins contain a highly conserved DNA-binding domain close to the C terminus and two glutamine-rich domains in the N-terminal moiety. Immunoblot analyses of Sp3 reveal a striking complex protein pattern of up to eight distinct species. This pattern is not observed in Sp3-deficient cell lines showing that all signals reflect Sp3 antigen. In this study, we have unraveled the complexity of Sp3 expression. We show that four isoforms of Sp3 that retain different parts of the N terminus are expressed in vivo. The four isoforms derive from alternative translational start sites at positions 1, 37, 856, and 907. An upstream open reading frame located at position -47 to -18 regulates expression of the two long isoforms. Unlike Sp1, none of the Sp3 isoforms is glycosylated. However, all four isoforms become SUMO-modified in vivo and in vitro specifically and exclusively at lysine residue 551. The transcriptional activity of the two long isoforms strongly depends on the promoter settings, whereas the small isoforms appear to be inactive. The transcriptional activity of all the Sp3 isoforms is regulated by SUMO modification. Our results demonstrate that Sp3 has many unique features and is not simply a functional equivalent of Sp1.

Interplay between HIV-1 Vpr and Sp1 Modulates p21WAF1 Gene Expression in Human Astrocytes

The Vpr (viral protein R) of human immunodeficiency virus, type 1, which is expressed during the late stage of the viral infection, has received special attention because of its ability to control transcription of the human immunodeficiency virus, type 1, long terminal repeat and to influence cell cycle progression. Here we demonstrate that Vpr has the ability to regulate transcription of the cyclin-dependent kinase inhibitor, p21(WAF1) (p21), one of the key regulators of the cell cycle, in human astrocytic cells. The results from transcription assays demonstrated that Vpr augments promoter activity of p21 through the GC-rich region located between nucleotides -84 and -74 with respect to the +1 transcription start site. Activation of p21 by Vpr required cooperativity of Sp1, which binds to the DNA sequence spanning -84 to -74. Results from bandshift assay revealed an increased level of Sp1 DNA binding activity in the presence of Vpr. Furthermore, Vpr was able to associate with Sp1 via the zinc finger domain located in the C-terminal region of Sp1. Functional studies revealed that the cooperativity between Vpr and Sp1 requires the zinc finger domain at the C terminus and the glutamine-rich domain at the N terminus of Sp1. Expression of p53 further enhanced the level of Vpr-Sp1-mediated transcription activation of p21 through the sequence spanning -84 to -74 and increased the DNA binding activity of Sp1 in the presence of Vpr. Results from glutathione S-transferase pull-down assay showed the association of Vpr with p53 in extracts containing Sp1. Altogether, the outcome of our functional and binding studies suggested that the physical interaction of Vpr with Sp1 and p53 could modulate transcriptional activity of p21.

Characterization of pco-1, a newly identified gene which regulates purine catabolism in Neurospora.

A new gene of Neurospora crassa, designated pco-1, was characterized and shown to regulate the expression of several genes which encode enzymes required for the catabolism of purines. Unlike the wild type, a pco-1 mutant created by repeat-induced point mutation cannot utilize purines as a nitrogen source. The PCO1 protein contains a Zn(II)2Cys6 binuclear cluster motif near its N-terminus, followed by a putative coiled-coil motif. A chemical crosslinking experiment demonstrated that PCO1 forms homodimers. PCO1 binds to CGG-N6-CCG elements located in the upstream promoter region of four genes encoding purine catabolic enzymes. Northern blot analysis demonstrated that a functional PCO1 protein is required for induction of xdh, which encodes xanthine dehydrogenase. Moreover, PCO1 was required for induction of three different purine catabolic enzymes. Two glutamine-rich domains occur in the C-terminal region of PCO1 and at least one of the glutamine-rich regions is required for PCO1 function, suggesting that they might play a role in transcriptional activation. The PCO1 protein does not interact with the global-acting NIT2 protein or the negative-acting NMR protein that functions in nitrogen catabolite repression. Induction of the xdh gene and synthesis of xanthine dehydrogenase is completely dependent upon PCO1, but does not require the global-acting NIT2 protein, suggesting that it is controlled by a novel regulatory mechanism.

Stress granule assembly is mediated by prion-like aggregation of TIA-1.

TIA-1 is an RNA binding protein that promotes the assembly of stress granules (SGs), discrete cytoplasmic inclusions into which stalled translation initiation complexes are dynamically recruited in cells subjected to environmental stress. The RNA recognition motifs of TIA-1 are linked to a glutamine-rich prion-related domain (PRD). Truncation mutants lacking the PRD domain do not induce spontaneous SGs and are not recruited to arsenite-induced SGs, whereas the PRD forms aggregates that are recruited to SGs in low-level-expressing cells but prevent SG assembly in high-level-expressing cells. The PRD of TIA-1 exhibits many characteristics of prions: concentration-dependent aggregation that is inhibited by the molecular chaperone heat shock protein (HSP)70; resistance to protease digestion; sequestration of HSP27, HSP40, and HSP70; and induction of HSP70, a feedback regulator of PRD disaggregation. Substitution of the PRD with the aggregation domain of a yeast prion, SUP35-NM, reconstitutes SG assembly, confirming that a prion domain can mediate the assembly of SGs. Mouse embryomic fibroblasts (MEFs) lacking TIA-1 exhibit impaired ability to form SGs, although they exhibit normal phosphorylation of eukaryotic initiation factor (eIF)2alpha in response to arsenite. Our results reveal that prion-like aggregation of TIA-1 regulates SG formation downstream of eIF2alpha phosphorylation in response to stress.

Biophysical and mutational analysis of the putative bZIP domain of Epstein-Barr virus EBNA 3C.

Epstein-Barr virus nuclear antigen 3C (EBNA 3C) is essential for B-cell immortalization and functions as a regulator of viral and cellular transcription. EBNA 3C contains glutamine-rich and proline-rich domains and a region in the N terminus consisting of a stretch of basic residues followed by a run of leucine residues spaced seven amino acids apart. This N-terminal domain is widely believed to represent a leucine zipper dimerization motif (bZIP). We have performed the first structural and functional analysis of this motif and demonstrated that this domain is not capable of forming stable homodimers. Peptides encompassing the EBNA 3C zipper domain are approximately 54 to 67% alpha-helical in solution but cannot form dimers at physiologically relevant concentrations. Moreover, the EBNA 3C leucine zipper cannot functionally substitute for another homodimerizing zipper domain in domain-swapping experiments. Our data indicate, however, that the EBNA 3C zipper domain behaves as an atypical bZIP domain and is capable of self-associating to form higher-order alpha-helical oligomers. Using directed mutagenesis, we also identified a new role for the bZIP domain in maintaining the interaction between EBNA 3C and RBP-Jkappa in vivo. Disruption of the helical nature of the zipper domain by the introduction of proline residues reduces the ability of EBNA 3C to inhibit EBNA 2 activation and interact with RBP-Jkappa in vivo by 50%, and perturbation of the charge on the basic region completely abolishes this function of EBNA 3C.

Molecular mechanism for the potentiation of the transcriptional activity of human liver receptor homolog 1 by steroid receptor coactivator-1.

The liver receptor homolog 1 (LRH-1) belongs to the Fushi tarazu factor 1 nuclear receptor subfamily, and its biological functions are just being unveiled. The molecular mechanism for the transcriptional regulation by LRH-1 is not clear yet. In this report, we use mutagenesis and reporter gene assays to carry out a detailed analysis on the hinge region and the proximal ligand binding domain (LBD) of human (h) LRH-1 that possess important regulatory functions. Our results indicate that helix 1 of the LBD is essential for the activity of hLRH-1 and that the steroid receptor coactivator (SRC)-1 interacts directly with the LBD of hLRH-1 and significantly potentiates the transcriptional activity of hLRH-1. Cotransfection assays demonstrate that overexpressed SRC-1 potentiates hLRH-1 mediated activation of the cholesterol 7-alpha-hydroxylase promoter and increases the transcription of the endogenous cholesterol 7-alpha-hydroxylase in Huh7 cells. The interaction between SRC-1 and hLRH-1 assumes a unique pattern that involves primarily a region containing the glutamine-rich domain of SRC-1, and helix 1 and activation function-2 of hLRH-1 LBD. Mutagenesis and molecular modeling studies indicate that, similar to mouse LRH-1, the coactivator-binding cleft of hLRH-1 LBD is not optimized. An interaction between helix 1 of hLRH-1 LBD and a region containing the glutamine-rich domain of SRC-1 can provide an additional stabilizing force and enhances the recruitment of SRC-1. Similar interaction is observed between hLRH-1 and SRC-2/transcriptional intermediary factor 2 or SRC-3/acetyltransferase. Moreover, transcriptional intermediary factor 2 and acetyltransferase also potentiate the transcriptional activity of hLRH-1, suggesting a functional redundancy among SRC family members. These findings collectively demonstrate an important functional role of helix 1 in cofactor recruitment and reveal a novel molecular mechanism of transcriptional regulation and cofactor recruitment mediated by hLRH-1.

Synergistic activation of CREB-mediated transcription by forskolin and phorbol ester requires PKC and depends on the glutamine-rich Q2 transactivation domain

Recruitment of a RNA polymerase II complex by the glutamine-rich Q2 domain of cAMP response element-binding protein (CREB) allows basal transcriptional activity, while recruitment of CBP/p300 through signal-induced phosphorylation of the kinase-inducible domain at serine-133 enhances CREB-dependent transcription. Here we demonstrate that co-administration of forskolin and phorbol ester TPA to NIH3T3 cells provoked a dose-dependent increase in phosphoserine-133. CREB- and Q2-dependent transcription, as well as transcription by other glutamine-rich transcription factors, but not by transcription factors lacking glutamine-rich regions, augmented synergistically in the presence of both stimuli. Synergistic activation was abograted by specific inhibition of protein kinase C (PKC), but not of PKA. Co-stimulation increased the basal activity of a minimal, CREB-independent promoter. Therefore, Q2, which directly interacts with the RNA polymerase II initiation complex, may transmit the increased basal promoter activity provoked by these stimuli to CREB, thereby contributing to synergistic activation of CREB-mediated transcription. This synergism may have important implications on glutamine-rich transcription factor-target genes.

All known in vivo functions of the Oct-2 transcription factor require the C-terminal protein domain.

Oct-2, a transcription factor expressed in the B lymphocyte lineage and in the developing CNS, functions through of a number of discrete protein domains. These include a DNA-binding POU homeodomain flanked by two transcriptional activation domains. In vitro studies have shown that the C-terminal activation domain, a serine-, threonine- and proline-rich sequence, possesses unique qualities, including the ability to activate transcription from a distance in a B cell-specific manner. In this study, we describe mice in which the endogenous oct-2 gene has been modified through gene targeting to create a mutated allele, oct-2DeltaC, which encodes Oct-2 protein isoforms that lack all sequence C-terminal to the DNA-binding domain. Surprisingly, despite the retention of the DNA-binding domain and the glutamine-rich N-terminal activation domain, the truncated protein(s) encoded by the oct-2DeltaC allele are unable to rescue any of the previously described defects exhibited by oct-2 null mice. Homozygous oct-2DeltaC/DeltaC mice die shortly after birth, and B cell maturation, B-1 cell self renewal, serum Ig levels, and B lymphocyte responses to in vitro stimulation are all reduced or absent, to a degree equivalent to that seen in oct-2 null mice. We conclude that the C-terminal activation domain of Oct-2 is required to mediate the unique and indispensable functions of the Oct-2 transcription factor in vivo.

Cysteine String Protein (CSP) Inhibition of N-type Calcium Channels Is Blocked by Mutant Huntingtin

Cysteine string protein (CSP), a 34-kDa molecular chaperone, is expressed on synaptic vesicles in neurons and on secretory vesicles in endocrine, neuroendocrine, and exocrine cells. CSP can be found in a complex with two other chaperones, the heat shock cognate protein Hsc70, and small glutamine-rich tetratricopeptide repeat domain protein (SGT). CSP function is vital in synaptic transmission; however, the precise nature of its role remains controversial. We have previously reported interactions of CSP with both heterotrimeric GTP-binding proteins (G proteins) and N-type calcium channels. These associations give rise to a tonic G protein inhibition of the channels. Here we have examined the effects of huntingtin fragments (exon 1) with (huntingtin(exon1/exp)) and without (huntingtin(exon1/nonexp)) expanded polyglutamine (polyQ) tracts on the CSP chaperone system. In vitro huntingtin(exon1/exp) sequestered CSP and blocked the association of CSP with G proteins. In contrast, huntingtin(exon1/nonexp) did not interact with CSP and did not alter the CSP/G protein association. Similarly, co-expression of huntingtin(exon1/exp) with CSP and N-type calcium channels eliminated CSP's tonic G protein inhibition of the channels, while coexpression of huntingtin(exon1/nonexp) did not alter the robust inhibition promoted by CSP. These results indicate that CSP's modulation of G protein inhibition of calcium channel activity is blocked in the presence of a huntingtin fragment with expanded polyglutamine tracts.

XMam1, the Xenopus homologue of mastermind, is essential to primary neurogenesis in Xenopus laevis embryos.

Notch signaling is involved in cell fate determination and is evolutionally highly conserved in vertebrates and invertebrates. Mastermind is a nuclear protein which participates in Notch signaling and is involved in direct transactivation of target genes. Here we analyzed the expression and the function of Xenopus mastermind1 (XMam1) in the process of primary neurogenesis. XMam1 is 3,425 bp and encodes 1,139 amino acids. Overall, Mastermind proteins consist of a basic domain, two acidic domains and a glutamine-rich domain, which are highly conserved among species. The ubiquitous expression of XMam1 was observed in both maternal and zygotic stages. Whole-mount in situ hybridization showed that XMam1 mRNA was present in the ectoderm by the gastrula stage and localized at the anterior neural region in the neurula stage. Thereafter, XMam1 expression was restricted to the eye and otic vesicle in the tailbud-stage embryo. XMaml overexpression caused the repression of primary neural formation. The truncated form of XMam1 (lacking the C-terminus of XMam1; XMam1deltaC) led to excess formation of primary neurons. Furthermore, XMam1deltaC strongly repressed XESR-1 transactivation. These results show that XMaml is involved in primary neurogenesis by way of Notch signaling and is an essential component for transactivation of XESR-1 in Xenopus laevis embryos.

Functional Analysis of RF2a, a Rice Transcription Factor

RF2a is a bZIP transcription factor that regulates expression of the promoter of rice tungro bacilliform badnavirus. RF2a is predicted to include three domains that contribute to its function. The results of transient assays with mutants of RF2a from which one or more domains were removed demonstrated that the acidic domain was essential for the activation of gene expression, although the proline-rich and glutamine-rich domains each played a role in this function. Studies using fusion proteins of different functional domains of RF2a with the 2C7 synthetic zinc finger DNA-binding domain showed that the acidic region is a relatively strong activation domain, the function of which is dependent on the context in which the domain is placed. Data from transgenic plants further supported the conclusion that the acidic domain was important for maintaining the biological function of RF2a. RF2a and TBP (TATA-binding protein) synergistically activate transcription in vitro (Zhu, Q., Ordiz, M. I., Dabi, T., Beachy, R. N., and Lamb, C. (2002) Plant Cell 14, 795-803). In vitro and in vivo assays showed that RF2a interacts with TBP through the glutamine-rich domain but not the acidic domain. Functional analysis of such interactions indicates that the acidic domain activates transcription through mechanisms other than via the direct recruitment of TBP.

A recessive mutant of Drosophila Clock reveals a role in circadian rhythm amplitude.

The transcription factor Clock (Clk) plays a critical role in animal circadian rhythms. Genetic studies defining its function have relied on two dominant negative alleles, one in Drosophila and one in mice. Here we describe a novel recessive allele of Drosophila Clock, Clk(ar). Homozygous Clk(ar) flies are viable and behaviorally arrhythmic. The Clk(ar) phenotype is caused by a splice site mutation that severely disrupts splicing and reduces Clk activity. Despite the behavioral arrhythmicity, molecular oscillations are still detectable in Clk(ar) flies. Transcription analysis indicates potent effects of Clk(ar) on levels and amplitude of transcriptional oscillations. Taken together with other data, we propose that Clk makes a major contribution to the strength and amplitude of circadian rhythms.

Phosphorylation of the Yeast Phospholipid Synthesis Regulatory Protein Opi1p by Protein Kinase A

The Opi1p transcription factor plays a negative regulatory role in the expression of UASINO-containing genes involved in phospholipid synthesis in the yeast Saccharomyces cerevisiae. The phosphorylation of Opi1p by protein kinase A (cAMP-dependent protein kinase) was examined in this work. Using a maltose-binding protein-Opi1p fusion protein as a substrate, protein kinase A activity was time- and dose-dependent and dependent on the concentrations of Opi1p and ATP. Protein kinase A phosphorylated Opi1p on multiple serine residues. The synthetic peptides SCRQKSQPSE and SQVRESLLNL containing the protein kinase A motif for Ser31 and Ser251, respectively, within Opi1p were substrates for protein kinase A. Phosphorylation of S31A and S251A mutant maltose-binding protein-Opi1p fusion proteins by protein kinase A was reduced when compared with the wild type protein, and phosphopeptides present in wild type Opi1p were absent from the S31A and S251A mutant proteins. In vivo labeling experiments showed that the extent of phosphorylation of the S31A and S251A mutant proteins was reduced when compared with the wild type protein. The physiological consequence of the phosphorylation of Opi1p at Ser31 and Ser251 was examined by measuring the effects of the S31A and S251A mutations on the expression of the UASINO-containing gene INO1. The beta-galactosidase activity driven by an INO1-CYC-lacZ reporter gene in opi1Delta mutant cells expressing the S31A and S251A mutant Opi1p proteins was elevated 42 and 35%, respectively, in the absence of inositol and 55 and 52%, respectively, in the presence of inositol when compared with cells expressing wild type Opi1p. These data supported the conclusion that phosphorylation of Opi1p at Ser31 and Ser251 mediated the stimulation of the negative regulatory function of Opi1p on the expression of the INO1 gene.

Expression of the Telomeric Repeat Binding Factor Gene NgTRF1 Is Closely Coordinated with the Cell Division Program in Tobacco BY-2 Suspension Culture Cells

Telomeres are vital for preserving chromosome integrity during cell division. Several genes encoding potential telomere-binding proteins have recently been identified in higher plants, but nothing is known about their function or regulation during cell division. In this study, we have isolated and characterized a cDNA clone, pNgTRF1, encoding a putative double-stranded telomeric repeat binding factor of Nicotiana glutinosa, a diploid tobacco plant. The predicted protein sequence of NgTRF1 (Mr = 75,000) contains a single Myb-like domain with significant homology to a corresponding motif in human TRF1/Pin2 and TRF2. Gel retardation assays revealed that bacterially expressed full-length NgTRF1 was able to form a specific complex only with probes containing three or more contiguous telomeric TTTAGGG repeats. The Myb-like domain of NgTRF1 is essential, but not sufficient, to bind the telomeric repeat sequence. The glutamine-rich extreme C-terminal region, which does not exist in animal proteins, was additionally required to form a specific telomere-protein complex. The dissociation constant (Kd) of the Myb motif plus the glutamine-rich domain of NgTRF1 to the two-telomeric repeat sequence was evaluated to be 4.5 +/- 0.2 x 10-9 m, which is comparable to that of the Myb domain of human TRF1. Expression analysis showed that NgTRF1 gene activity was inversely correlated with the cell division capacity of tobacco root cells and during the 9-day culture period of BY-2 suspension cells, while telomerase activity was positively correlated with cell division. In synchronized BY-2 cells, NgTRF1 was selectively expressed in G1 phase, whereas telomerase activity peaked in S phase. These findings suggest that telomerase activity and NgTRF1 expression are differentially regulated in an opposing fashion during growth and cell division in tobacco plants. The possible physiological functions of NgTRF1 in tobacco cells are also discussed.

Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element

Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells express the fucosyltransferase (Fuc-T) VII gene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII transcription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5'-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)-responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C-rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)-promoter. Furthermore, CREM alpha, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.

A SWI2/SNF2‐type ATPase/helicase protein, mDomino, interacts with myeloid zinc finger protein 2A (MZF‐2A) to regulate its transcriptional activity

The myeloid zinc finger protein 2A (MZF-2A) is a Krüppel-type C2H2 zinc finger transcription factor expressed in myeloid cells and involved in the growth, differentiation and tumorigenesis of myeloid progenitors. Previously we identified a 180 amino acid domain in MZF-2A which is responsible for the transcriptional activation of MZF-2A. To understand the mechanism of the MZF-2A-dependent transcriptional activation, we screened for molecules that interact with the transactivation domain (TAD) of MZF-2A. By using the yeast Ras recruitment two-hybrid screening, we identified a novel SWI2/SNF2-related protein, termed mammalian Domino (mDomino), as an MZF-2A-binding partner. The mDomino protein, which shows a marked similarity to the Drosophila Domino protein, contains a SWI2/SNF2-type ATPase/helicase domain, a SANT domain, and a glutamine-rich (Q-rich) domain. The C-terminal Q-rich domain of mDomino physically associates with the TAD of MZF-2A in mammalian cells as well as in yeast. Expression of the mDomino Q-rich domain, together with MZF-2A in myeloid LGM-1 cells, enhanced the MZF-2A-mediated activation of a reporter gene. These results strongly suggest that an ATP-dependent chromatin-remodelling complex containing mDomino interacts with MZF-2A to regulate gene expression in myeloid cells.