Ghost Spot Research Articles

Genetic analysis of the Asiatic cotton (Gossypium arboreum) petal spot phenotypes

AbstractThe cotton species Gossypium arboreum L. is self‐pollinated, and most accessions in the United States Department Agriculture, National Plant Germplasm System, produce flowers with red pigmented petal spots, which represents the primitive phenotype and more attractive to pollinators. Few accessions have the ghost spot phenotype, and genetic analysis of this trait was conducted for PI 615742. Two F2 populations were developed by crossing PI 615742 with G. arboreum accessions PI 452097, having red petal spots, and with PI 529708, showing the spotless phenotype. The PI 615742 × PI 529708 population data indicate a single completely dominant gene which confers the ghost spot phenotype. Petal spot phenotypes observed for the PI 615742 × PI 452097 population indicate red pigmented spots are also conferred by a single completely dominant gene. These results support a two‐gene model in which the presence of petal spots and pigment development are controlled by independent genes that co‐segregate with stem pigmentation. The accessions and population data can aid in characterizing the mechanisms controlling floral traits and pigment expression.

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Optimisation of a low cost SLM for diffraction efficiency and ghost order suppression

Spatial Light Modulators (SLMs) are a powerful tool in many optics laboratories, but due to the technology required for their fabrication, they are usually very expensive. Recently some inexpensive devices have been produced, however their phase shift range is less than 2π, leading to a loss of diffraction efficiency for the SLM. We show how to improve the first order diffraction efficiency of such an SLM by adjusting the blazing function, and obtain a 1.5 times increase in first order diffracted power. Even a perfect SLM with 2π phase throw can produce undesired effects in some situations; for example in holographic optical tweezers it is common to find unwanted “ghost spots” near to the array of first-order spots. Modulating the amplitude, by spatially modulating the blazing function, allows us to suppress the ghost spots. This increases the contrast between desired and unwanted spots by more than an order of magnitude.

A Study on Historical and Educational Travel Sites using Dark Tourism

Dark tourism, the generic term for travel associated with death, disaster and tragedy has witnessed increasing attention from tourism related academic community and media. After the 1990s, dark tourism has become a newly fascinating subject to research, nevertheless, the dark tourism literature being quantitatively limited. The purpose of this paper is to research travel sites for historical and educational impression by using dark tourism. The term ‘dark tourism’ first coined by Foley and Lennon is the act of travel and visitation to sites of death, disaster and the seemingly macabre. The types are classified with tourists’ motivations and behaviors, attractions’ locational Attributes, the differences of tourists’ demand and supply, and pull-push theory-based framework as an motivation factor. This paper examines major subjects related to dark tourism such as Battlerelated fields, Cemetery, Colonization of History, Holocaust, Site of disaster, Ghost spots, and Prisons. Futhermore, this paper is to introduce some cases in Korea and other countries. In order to strengthen the competitiveness of Dark Tourism areas in Korea, some suggestions are presented. Finally, this study was performed as a conceptual research for further exploratory and qualitative studies for Dark Tourism.

Multilayer Disk Reduced Interlayer Crosstalk with Wide Disk-Fabrication Margin

To reduce interlayer crosstalk caused by the ghost spot which appears in a multilayer optical disk with more than three information layers, a multilayer disk structure which reduces interlayer crosstalk with a wide disk-fabrication margin was proposed in which the backward reflectivity of the information layers is sufficiently low. It was confirmed that the interlayer crosstalk caused by the ghost spot was reduced to less than the crosstalk from the adjacent layer by controlling backward reflectivity. The wide disk-fabrication margin of the proposed disk structure was indicated by experimentally confirming that the tolerance of the maximum deviation of the spacer-layer thickness is four times larger than that in the previous multilayer disk.

Interlayer Crosstalk Reduction by Controlling Backward Reflectivity in Multilayer Optical Discs

A method is proposed to reduce interlayer crosstalk in multilayer optical discs by controlling backward reflectivity of information layers, which can lead to wider tolerances of disc fabrication accuracy. Reduction of the backward reflectivity reduces the signal from the ghost spot even if thicknesses of spacer layers are equal. Experimental results showed that the ratio of the signals obtained by the readout spot and the ghost spot is less by about one order for a disc with controlled backward reflectivity than for a conventional disc. A rough estimate of the crosstalk caused by the ghost spot agrees qualitatively with the experimental results.

In vitro and In vivo Activity of Cyprodinil and Pyrimethanil on Botrytis cinerea Isolates Resistant to other Botryticides and Selection for Resistance to Pyrimethanil in a Greenhouse Population in Greece

No cross-resistance was observed between pyrimethanil or cyprodinil and the fungicides benomyl, iprodione or carbendazim + diethofencarb. In vitro, both anilinopyrimidine fungicides were effective against strains of Botrytis cinerea resistant to benzimidazoles and/or dicarboximides and against a wild type strain insensitive to diethofencarb (EC50 values ranged between 0.03–0.19 and 0.006–0.054 μg ml−1 for pyrimethanil and cyprodinil, respectively). Preventive applications of anilinopyrimidines completely protected young cucumber plants and fruits that were inoculated with all strains of B. cinerea. The effectiveness of pyrimethanil against grey mould was studied in greenhouse grown tomatoes in relation to (a) the type of infection and the progress of the disease on different plant parts and (b) the response of the naturally occurring B. cinerea population to the selection pressure caused by eight successive applications of this fungicide. Pyrimethanil effectively controlled grey mould on leaves, fruits and stems but did not significantly reduce the number of dead plants and fruits with 'ghost spot' symptoms. The selection pressure caused by the consecutive applications of pyrimethanil resulted in reduction of its effectiveness on leaves that became apparent after the sixth application. This was correlated with a shift of the B. cinerea population (not previously exposed to anilinopyrimidines) towards reduced sensitivity, probably due to the development of a low level of resistance (RL = 7.7). Pyrimethanil delayed the onset of the disease but it did not reduce the infection rate.

Epidemiology and control of Botrytis cinerea in tomato crops grown under cover in Greece

Out-of-season tomatoes grown in unheated glasshouses in Greece annually suffer considerable losses from grey mould induced by Botrytis cinerea. Characteristic soft rots of young fruit by the calyx end, flower abortions and stem lesions or cankers are the most commonly occurring symptoms of the disease. Severe ghost spots on fruit only appear when fungicides inhibiting spore germination are not applied. Conidia produced on plant debris of the previous year's crop serve as primary inoculum. Disease starts in late autumn, increases rapidly during the winter period and ceases abruptly at the end of April. Infections caused by isolates resistant to dicarboximides or to both dicarboximides and benzimidazoles are uncommon at the beginning of each new crop cycle. These increase substantially as the season progresses and decline after cessation of fungicide sprays. By contrast, infections caused by benzimidazole-resistant strains are stable throughout the growing season. Efficient disease control implies use of proper glasshouse covering material, adequate indoor air circulation, partial night heating, strict indoor and outdoor hygiene and regular fungicide sprays. When disease pressure is low, application only of conventional compounds like dichlofluanid and chlorothalonil is recommended. Under conditions favourable to Botrytis infections, mixtures of conventional compounds with reduced strength specific botryticides should preferably be applied. Such regimes efficiently minimize losses from fungicide resistance development and ghost spot.

Managing Botrytis cinerea on tomatoes in greenhouses in the Mediterranean

Nine experiments were carried out from 1989 to 1992 in Israel and in northern Italy in greenhouse-produced tomatoes infected with Botrytis cinerea Pers., Fr. In Israel B. cinerea affected leaves, stems and fruits (both rot and ghost spot symptoms were apparent). In Italy, the only symptom of the disease was fruit rot. Several fungicides, fungicide mixtures and spraying programmes were applied. Some trials also included a biological preparation based on Trichoderma harzianum isolates T39 and TF. Although a dicarboximide-resistant population of the pathogen existed in all greenhouses, dicarboximide fungicides (iprodione or procymidone) applied alone suppressed the disease by 40–88%, as effectively as its mixture with thiram, dichlofluanid or tebuconazole. Similar disease suppression was achieved by mixtures of tebuconazole + dichlofluanid and carbendazim + diethofencarb. Trichoderma harzianum T39 alone reduced disease by 31–82% but in more than half of the cases the reduction was non-significant. Disease control achieved by the biocontrol preparations did not differ significantly ( p = 0.05) from that achieved by the chemical fungicides. Adequate control was achieved when the biocontrol and the chemical products were applied alternately although the quantity of chemical sprays was reduced by one half. The consistency among treatments in the various trials with respect to percent disease control was greater in the T. harzianum-fungicide alternation treatments, than that in the T. harzianum or the fungicide treatments applied alone.

Reduced Development of Grey Mould (Botrytis cinerea) in Bean and Tomato Plants by Calcium Nutrition

AbstractFertilization of bean plants grown in perlite with 1 and 3 mM CaCl2 or Ca(NO3)2 reduced severity of grey mould as compared with control plants or plants fertilized with 5 mM of the compounds. Fertilization with Ca(NO3)2 reduced severity leaf grey mould and fruit ghost spots of tomato plants grown in perlite by 70 and 45%, respectively. The rate of decrease varied with the position of the fruits on the plants. Leaves from plants treated with calcium or otherwise [KNO3, (NH4)2SO4] produced less ethylene than leaves of nontreated plants. Rate of growth of B. cinerea was lower on growth medium prepared from washings from leaves of calcium fertilized plants than from leaves from other treatments. The fertilizer combination Ca(H2PO4)2+ CaSO4 (1 and 3 g/kg soil) applied once to tomato plants grown in soil reduced severity of leaf grey mould by 80 % (significant at P = 0.05) but 1–3 g CaSO4/kg soil only tended to reduce disease severity (30–40 %, not significant) as compared with the control. The compounds CaCl2 and Ca(NO3)2 increased significantly (P = 0.05) the growth of B. cinerea on synthetic medium when applied at rates of 1 0–10.0 mM whereas reduction of growth was observed with 0.1 mM of the compounds and of CaSO4.

Deposition of Lignin, Suberin and Callose in Relation to the Restriction of Infection by Botrytis cinerea in Ghost Spots of Tomato Fruits

AbstractThe defence reaction of young tomato fruits to infection by B. cinerea appeared to consist of necrosis and collapse of epidermal cells followed by a high cambial activity of the underlying parenchymatous cells. Shortly after infection, deposits of callose and suberin were detected along the walls of cells bordering the necrotic area, possibly restricting fungal invasion. Lignification of cell walls could not be demonstrated. The majority of ghost spots tested failed to yield B. cinerea. The germ tubes may actually die after penetration, due to desiccation.ZusammenfassungDie Abwehrreaktion junger Tomatenfrüchte gegen B. cinerea besteht aus einer Nekrose und einem Zusammenbruch epidermaler Zellen, gefolgt von einer hohen Kambialaktivität der unterliegenden parenchymatischen Zellen. Kurz nach der Infektion wurden Ablagerungen von Kallose und Suberin an den an der nekrotischen Fläche grenzenden Zellwänden nachgewiesen, was wahrscheinlich die Invasion in das gesunde Gewebe vermindert. Lignifikation von Zellwänden konnte nicht festgestellt werden. B. cinerea konnte fast nicht aus „ghost spots” isoliert werden. Die Keimschläuche können nach der Infizierung aufgrund von Austrocknen tatsächlich absterben.

Survey of diseases of glasshouse tomato crops in England and Wales in 1976

SUMMARYOne hundred and forty‐six tomato crops throughout England and Wales were assessed for diseases. The commonest fungus pathogen was Botrytis cinerea Pers. ex Fr. which caused stem lesions in 64 per cent of the crops, leaf lesions in 38 per cent and fruit ghost spot in 46 per cent. Benomyl tolerance was widespread in isolates of this pathogen and was detected in 50 of the 68 crops examined. Seventy‐seven per cent of isolates from crops sprayed with a methyl benzimidazole carbamate (MBC) fungicide were tolerant compared with 34 per cent from crops where these fungicides had not been used. Fulvia fulva (Cooke) Ciferri was found in 28 per cent of the crops but was severe in only three per cent. Didymella lycopersici Kleb. occurred in seven per cent of the crops. Tomato mosaic (TMV) symptoms were seen in 34 per cent of the crops, although 47 per cent of those surveyed were of resistant cultivars in which no virus symptoms were seen. The Dutch avirulent TMV strain MII‐16 was used for crop protection on 27 per cent of the nurseries. TMV strains collected from crops with symptoms were predominantly strain 1 (85 per cent) and 96 per cent of isolates from crops inoculated with MII‐16 were of this strain. No new strains or tobacco forms of TMV were found.Root rots were extremely common at the end of the crops, varying in intensity according to the pre‐planting soil treatment. Steam treatment was most effective (28 per cent root rot) with methyl bromide the next best (30 per cent), followed by dazomet (42 per cent). Methyl bromide was used by 45 per cent of growers, whereas 17 per cent used steam and 11 per cent dazomet. Peat‐bag culture was used on five per cent of the nurseries. In peat‐bag culture there was little root rot (11 per cent). Verticillium spp. were isolated from 25 per cent of crops in the survey and Fusarium oxysporum Schl. from eight per cent. Chimeras were found in 34 per cent of the crops, but only in 1.1 per cent of the affected plants was the chimera affecting the growing point and likely to affect yield. There was a tendency for early‐planted crops to have a greater incidence of chimera. Generally the cultural factors recorded did not appear to be connected with disease incidence, but there was a significant increase in the amount of Botrytis in the stopped plants. Benomyl, either as a spray or a drench, was the most commonly used fungicide, but more than a third of the crops did not receive any fungicidal treatments.

Surrey of Diseases of Glasshouse Tomato Crops in Yorkshire and Lancashire in 1974 and 1975

SUMMARYEighty‐one tomato crops were assessed for diseases in 1974 and 50 in 1975. The commonest fungus disease was Botrytis cinerea, which caused stem lesions in 90 and 66 per cent of the crops, leaf lesions in 84 and 98 per cent and fruit ghost spot in 94 and 94 per cent in the two years respectively. Benomyl tolerance was widespread in isolates of this pathogen, showing little decline in the two years in spite of the reduced use of benomyl and other similar fungicides in 1975. Fulvia fulva was severe in one crop in 1974 and in three in 1975; Didymella lycopersici was found in only one crop in 1974 and three in 1975. Tomato mosaic symptoms were seen in 73 and 66 per cent of crops in each year respectively. The use of an avirulent strain of tobacco mosaic virus (TMV) for the purpose of cross‐protection decreased from 53 per cent in 1974 to 34 per cent in 1975. Nurseries with at least some TMV‐resistant cultivars increased from 51 per cent in 1974 to 64 per cent in 1975. TMV tomato Strain 1 was the most commonly identified strain. No new strains or tobacco forms were recorded.Root rots were extremely common and their severity was closely connected with pre‐planting soil treatment. Steam treatment gave the best control followed by methyl bromide and dazomet. The use of methyl bromide increased and the use of steam decreased in 1975. Verticillium wilt was found in 16 and 15 crops and fusarium wilt in two and three crops respectively in 1974 and 1975.Fungicides were used on 74 and 56 per cent of crops in 1974 and 1975 respectively, the decrease in 1975 being largely attributable to the decline in the use of benomyl.

Effects of film nonlinearities on the signal-to-ghost ratio of storage holograms

A theory of film nonlinearities relating to amplitude holograms and bleached phase holograms is developed which is adapted to the problem of the holographic storage of digital data. The amplitude transmittance characteristics are for this purpose expanded in power series. The odd higher-order terms of the expansion yield expressions defining ghost spots that impair image quality.