GG Sequences Research Articles

Oxidative stress accelerates intestinal tumorigenesis by enhancing 8-oxoguanine-mediated mutagenesis in MUTYH-deficient mice.

Oxidative stress-induced DNA damage and its repair systems are related to cancer etiology; however, the molecular basis triggering tumorigenesis is not well understood. Here, we aimed to explore the causal relationship between oxidative stress, somatic mutations in pre-tumor-initiated normal tissues, and tumor incidence in the small intestines of MUTYH-proficient and MUTYH-deficient mice. MUTYH is a base excision repair enzyme associated with human colorectal cancer. Mice were administered different concentrations of potassium bromate (KBrO3; an oxidizing agent)-containing water for 4 wk for mutagenesis studies or 16 wk for tumorigenesis studies. All Mutyh -/- mice treated with >0.1% KBrO3 developed multiple tumors, and the average tumor number increased dose dependently. Somatic mutation analysis of Mutyh -/-/rpsL transgenic mice revealed that G:C > T:A transversion was the only mutation type correlated positively with KBrO3 dose and tumor incidence. These mutations preferentially occurred at 5'G in GG and GAA sequences in rpsL This characteristic mutation pattern was also observed in the genomic region of Mutyh -/- tumors using whole-exome sequencing. It closely corresponded to signature 18 and SBS36, typically caused by 8-oxo-guanine (8-oxoG). 8-oxoG-induced mutations were sequence context dependent, yielding a biased amino acid change leading to missense and stop-gain mutations. These mutations frequently occurred in critical amino acid codons of known cancer drivers, Apc or Ctnnb1, known for activating Wnt signal pathway. Our results indicate that oxidative stress contributes to increased tumor incidence by elevating the likelihood of gaining driver mutations by increasing 8-oxoG-mediated mutagenesis, particularly under MUTYH-deficient conditions.

Leveraging a High-Throughput Screening Method to Identify Mechanisms of Individual Susceptibility Differences in a Genetically Diverse Zebrafish Model.

Understanding the mechanisms behind chemical susceptibility differences is key to protecting sensitive populations. However, elucidating gene-environment interactions (GxE) presents a daunting challenge. While mammalian models have proven useful, problems with scalability to an enormous chemical exposome and clinical translation faced by all models remain; therefore, alternatives are needed. Zebrafish (Danio rerio) have emerged as an excellent model for investigating GxE. This study used a combined bioinformatic and experimental approach to probe the mechanisms underlying chemical susceptibility differences in a genetically diverse zebrafish population. Starting from high-throughput screening (HTS) data, a genome-wide association study (GWAS) using embryonic fish exposed to 0.6 μM Abamectin revealed significantly different effects between individuals. A hypervariable region with two distinct alleles–one with G at the SNP locus (GG) and one with a T and the 16 bp deletion (TT)–associated with differential susceptibility was found. Sensitive fish had significantly lower sox7 expression. Due to their location and the observed expression differences, we hypothesized that these sequences differentially regulate sox7. A luciferase reporter gene assay was used to test if these sequences, alone, could lead to expression differences. The TT allele showed significantly lower expression than the GG allele in MCF-7 cells. To better understand the mechanism behind these expression differences, predicted transcription factor binding differences between individuals were compared in silico, and several putative binding differences were identified. EMSA was used to test for binding differences in whole embryo protein lysate to investigate these TF binding predictions. We confirmed that the GG sequence is bound to protein in zebrafish. Through a competition EMSA using an untagged oligo titration, we confirmed that the GG oligo had a higher binding affinity than the TT oligo, explaining the observed expression differences. This study identified differential susceptibility to chemical exposure in a genetically diverse population, then identified a plausible mechanism behind those differences from a genetic to molecular level. Thus, an HTS-compatible zebrafish model is valuable and adaptable in identifying GxE mechanisms behind susceptibility differences to chemical exposure.

Comparison of COVID-19 characteristics in Egyptian patients according to their Toll-Like Receptor-4 (Asp299Gly) polymorphism

Toll-like receptor (TLR)-4 plays a vital role in recognizing viral particles, activating the innate immune system, and producing pro-inflammatory cytokines.This cross-sectional study aimed to compare COVID-19 severity, progression, and fate according to TLR-4 (Asp299Gly) polymorphism in Egyptian patients.A total of 145 COVID-19 patients were included in this study. TLR-4 (Asp299Gly) genotyping was done using the PCR restriction fragment length polymorphism (PCR-RFLP) approach.The most commonly encountered TLR-4 genotype in relation to the amino acid at position 299 was the wild-type AA (73.1%); meanwhile, the homozygous mutant GG genotype (8.3%) was the least encountered. At hospital admission, 85.8% of the AA group had free (with no ground glass opacities) chest computed tomography (CT) examination, and 16.0% were asymptomatic. On the other hand, of the AG and GG groups, 81.5% and 83.3%, respectively showed bilateral ground-glass opacities in chest CT, as well as 25.9% and 75.0%, respectively were dyspneic. Values of the total leucocytic count, C-reactive protein (CRP), ferritin, and D dimer increased in the AA<AG<GG sequence. In contrast, hemoglobin values and the absolute lymphocyte counts decreased in the AA>AG>GG sequence. ICU admission (83.3%) and in-hospital death (33.3%) rates were significantly higher in the GG group.In COVID-19 patients, the TLR-4 mutant G allele may be associated with a more aggressive disease course and in-hospital death. New therapeutic alternatives could be aimed at this area.

Non-canonical splice junction processing increases the diversity of RBFOX2 splicing isoforms.

The underlying mechanisms of splicing regulation through non-canonical splice junction processing remain largely unknown. Here, we identified two RBFOX2 splicing isoforms by alternative 3' splice site selection of exon 9; the non-canonical splice junction processed RBFOX2 transcript (RBFOX2-N.C.) was expressed by the selection of the 3' splice GG acceptor sequence. The cytoplasmic localization of RBFOX2-C., a canonical splice junction-processed RBFOX2 transcript, was different from that of RBFOX2-N.C., which showed nuclear localization. In addition, we confirmed that RBFOX2-C. showed a significantly stronger localization into stress granules than RBFOX2-N.C. upon sodium arsenite treatment. Next, we investigated the importance of non-canonical 3' splice GG sequence selection of specific cis-regulatory elements using minigene constructs of the RBFOX2 gene. We found that the non-canonical 3' splice GG sequence and suboptimal branch point site adjacent region were critical for RBFOX2-N.C. expression through a non-canonical 3' splice selection. Our results suggest a regulatory mechanism for the non-canonical 3' splice selection in the RBFOX2 gene, providing a basis for studies related to the regulation of alternative pre-mRNA splicing through non-canonical splice junction processing.

Effects of acetaldehyde-induced DNA lesions on DNA metabolism

BackgroundAcetaldehyde, produced upon exposure to alcohol, cigarette smoke, polluted air and sugar, is a highly reactive compound that is carcinogenic to humans and causes a variety of DNA lesions in living human cells. Previously, we reported that acetaldehyde reacts with adjacent deoxyguanosine residues on oligonucleotides, but not with single deoxyguanosine residues or other deoxyadenosine, deoxycytosine, or thymidine residues, and revealed that it forms reversible intrastrand crosslinks with the dGpdG sequence (GG dimer).ResultsHere, we show that restriction enzymes that recognize a GG sequence digested acetaldehyde-treated plasmid DNA with low but significant efficiencies, whereas restriction enzymes that recognize other sequences were able to digest such DNA. This suggested that acetaldehyde produced GG dimers in plasmid DNA. Additionally, acetaldehyde-treated oligonucleotides were efficient in preventing digestion by the exonuclease function of T4 DNA polymerase compared to non-treated oligonucleotides, suggesting structural distortions of DNA caused by acetaldehyde-treatment. Neither in vitro DNA synthesis reactions of phi29 DNA polymerase nor in vitro RNA synthesis reactions of T7 RNA polymerase were observed when acetaldehyde-treated plasmid DNA was used, compared to when non-treated plasmid DNA was used, suggesting that acetaldehyde-induced DNA lesions inhibited replication and transcription in DNA metabolism.ConclusionsAcetaldehyde-induced DNA lesions could affect the relative resistance to endo- and exo-nucleolytic activity and also inhibit in vitro replication and in vitro transcription. Thus, investigating the effects of acetaldehyde-induced DNA lesions may enable a better understanding of the toxicity and carcinogenicity of acetaldehyde.

Populations and Dynamics of Guanine Radicals in DNA strands-Direct versus Indirect Generation.

Guanine radicals, known to be involved in the damage of the genetic code and aging, are studied by nanosecond transient absorption spectroscopy. They are generated in single, double and four-stranded structures (G-quadruplexes) by one and two-photon ionization at 266 nm, corresponding to a photon energy lower than the ionization potential of nucleobases. The quantum yield of the one-photon process determined for telomeric G-quadruplexes (TEL25/Na+) is (5.2 ± 0.3) × 10−3, significantly higher than that found for duplexes containing in their structure GGG and GG sequences, (2.1 ± 0.4) × 10−3. The radical population is quantified in respect of the ejected electrons. Deprotonation of radical cations gives rise to (G-H1)• and (G-H2)• radicals for duplexes and G-quadruplexes, respectively. The lifetimes of deprotonated radicals determined for a given secondary structure strongly depend on the base sequence. The multiscale non-exponential dynamics of these radicals are discussed in terms of inhomogeneity of the reaction space and continuous conformational motions. The deviation from classical kinetic models developed for homogeneous reaction conditions could also be one reason for discrepancies between the results obtained by photoionization and indirect oxidation, involving a bi-molecular reaction between an oxidant and the nucleic acid.

Study of intragastric structuring ability of sodium alginate based o/w emulsions under in vitro physiological pre-absorptive digestion conditions

In the present work, the intragastric structuring ability of o/w emulsions either stabilised (1–4%, w/w of sodium alginate (SA)) or structured with sheared ionic gel (1–3%, w/w of SA crosslinked with Ca2+) in the absence (saliva and gastric phases constituted of deionised water) or presence of in vitro pre-absorptive conditions (physiological simulated saliva and gastric fluids) was investigated. Visualisation of the morphological aspects of the gastric chymes, in the absence of multivalent counterions, demonstrated that SA stabilised systems underwent a remarkable swelling in the pH range of 2–3, whilst at the same pH range, ionic SA gel structured systems maintained their major structure configuration. When the aforementioned systems were exposed to physiological intragastric fluids, a reduction of the length and the hydrodynamic volume of the alginate fibres was detected regardless the structuring approach. On their exposure to physiological intragastric conditions (pH=2), SA stabilised emulsions underwent sol–gel transition achieving a ca. 3- to 4-order increase of storage modulus (at 1Hz). In the case of ionic sheared gel structured emulsions, exposure to physiological intragastric fluids resulted in a 10-fold reduction ability of their acid structuring ability, most likely due to the dialysis of egg-box dimer conformations by monovalent cations and protons and the sterical hindering of hydrogen bonding of MM and GG sequences under acidic conditions. Using of non-physiological simulated intragastric fluids was associated with overestimated structuring performance of SA regardless its physical state.

The impact of klotho gene polymorphisms on urinary tract stone disease.

To investigate the effect of klotho gene and β-glucuronidase activity on stone formation in patients with urinary tract stone disease (UTSD). A total of 103 patients with UTSD and 102 controls with no specific urolithiasis history were enrolled into the study. G395A and C1818T polymorphisms of klotho gene were analyzed with PCR method. Serum levels of calcium and phosphorus and 24-h urine levels of β-glucuronidase activity, calcium and phosphorus levels were measured biochemically. A total of 103 of patients were male (50.2%) and 102 were female (49.8%) (p 0.945). Twenty-four-hour urine levels of calcium were significantly higher in UTSD group, whereas no difference was observed in phosphorus levels (p<0.001, p 0.074, respectively). As for the G395A polymorphism, type of GG was significantly higher in the patient group compared to the controls (p=0.02), while GA genotype was significantly higher in the controls (p=0.001). There was no significant difference in F352V and C1818T polymorphism between the patient and control groups. β-glucuronidase activity was slightly lower in the patient group without significance (p 0.932).When patients with GG genotype and the rest were compared, there were no significant difference in all parameters. Any polymorphism altering the function of klotho gene may result with stone formation. We found that there are more GG sequences of G395A gene in patients with UTSD. That may be a polymorphism of klotho gene which results with stone formation. Further studies with more patients should be accomplished which are combining the genetic and epigenetic factors associated with urolithiasis and klotho gene to enlighten the etiology of this disease.

Aromatic residues in RNase T stack with nucleobases to guide the sequence-specific recognition and cleavage of nucleic acids.

RNase T is a classical member of the DEDDh family of exonucleases with a unique sequence preference in that its 3'-to-5' exonuclease activity is blocked by a 3'-terminal dinucleotide CC in digesting both single-stranded RNA and DNA. Our previous crystal structure analysis of RNase T-DNA complexes show that four phenylalanine residues, F29, F77, F124, and F146, stack with the two 3'-terminal nucleobases. To elucidate if the π-π stacking interactions between aromatic residues and nucleobases play a critical role in sequence-specific protein-nucleic acid recognition, here we mutated two to four of the phenylalanine residues in RNase T to tryptophan (W mutants) and tyrosine (Y mutants). The Escherichia coli strains expressing either the W mutants or the Y mutants had slow growth phenotypes, suggesting that all of these mutants could not fully substitute the function of the wild-type RNase T in vivo. DNA digestion assays revealed W mutants shared similar sequence specificity with wild-type RNase T. However, the Y mutants exhibited altered sequence-dependent activity, digesting ssDNA with both 3'-end CC and GG sequences. Moreover, the W and Y mutants had reduced DNA-binding activity and lower thermal stability as compared to wild-type RNase T. Taken together, our results suggest that the four phenylalanine residues in RNase T not only play critical roles in sequence-specific recognition, but also in overall protein stability. Our results provide the first evidence showing that the π-π stacking interactions between nucleobases and protein aromatic residues may guide the sequence-specific activity for DNA and RNA enzymes.

Structural basis for methyl-donor–dependent and sequence-specific binding to tRNA substrates by knotted methyltransferase TrmD

The deep trefoil knot architecture is unique to the SpoU and tRNA methyltransferase D (TrmD) (SPOUT) family of methyltransferases (MTases) in all three domains of life. In bacteria, TrmD catalyzes the N(1)-methylguanosine (m(1)G) modification at position 37 in transfer RNAs (tRNAs) with the (36)GG(37) sequence, using S-adenosyl-l-methionine (AdoMet) as the methyl donor. The m(1)G37-modified tRNA functions properly to prevent +1 frameshift errors on the ribosome. Here we report the crystal structure of the TrmD homodimer in complex with a substrate tRNA and an AdoMet analog. Our structural analysis revealed the mechanism by which TrmD binds the substrate tRNA in an AdoMet-dependent manner. The trefoil-knot center, which is structurally conserved among SPOUT MTases, accommodates the adenosine moiety of AdoMet by loosening/retightening of the knot. The TrmD-specific regions surrounding the trefoil knot recognize the methionine moiety of AdoMet, and thereby establish the entire TrmD structure for global interactions with tRNA and sequential and specific accommodations of G37 and G36, resulting in the synthesis of m(1)G37-tRNA.

The role of secreted glycoprotein G of equine herpesvirus type 1 and type 4 (EHV-1 and EHV-4) in immune modulation and virulence

Equine herpesvirus type 1 and 4 (EHV-1 and EHV-4) are important pathogens of horses worldwide. Infection with EHV-4 usually remains restricted to the upper respiratory tract, whereas infection with EHV-1 can generalize after leukocyte-associated viremia. Here we examined whether differences in the immunomodulatory glycoprotein G (gG) between the two viruses determine EHV-1's ability to cause systemic infection. To this end, mutant viruses were constructed based on the neurovirulent EHV-1 strain OH-03, in which the entire gG gene or parts thereof were exchanged with EHV-4 gG sequences. In vitro chemotaxis assays showed that supernatants of cells infected with the various gG mutant viruses interfered to variable degrees with neutrophil migration. More specifically, supernatants of cells infected with the gG deletion virus (vOH-ΔgG1) or OH-03 expressing EHV-4 gG (vOH-gG4) were unable to interfere with chemotaxis. Re-insertion of the predicted chemokine-binding region of EHV-1 gG in the vOH-gG4 mutant (vOH-gG4hyp1) did not completely restore the ability to inhibit neutrophil migration, whereas insertion of the hypervariable region of EHV-4 gG into vOH-03 (vOH-gG1hyp4) did not lead to a complete loss of chemokine-binding function. Very similar results were obtained in an in vivo study where the amount of neutrophils present in bronchioalveolar lavages (BALs) of mice infected with the different mutants was analyzed by flow cytometry. Taken together, our results show that, in a virus background, the hypervariable region is not solely responsible for the immunomodulatory potential of EHV-1 gG.

Crystallographic Analysis of Rotavirus NSP2-RNA Complex Reveals Specific Recognition of 5' GG Sequence for RTPase Activity.

Rotavirus nonstructural protein NSP2, a functional octamer, is critical for the formation of viroplasms, which are exclusive sites for replication and packaging of the segmented double-stranded RNA (dsRNA) rotavirus genome. As a component of replication intermediates, NSP2 is also implicated in various replication-related activities. In addition to sequence-independent single-stranded RNA-binding and helix-destabilizing activities, NSP2 exhibits monomer-associated nucleoside and 5' RNA triphosphatase (NTPase/RTPase) activities that are mediated by a conserved H225 residue within a narrow enzymatic cleft. Lack of a 5' γ-phosphate is a common feature of the negative-strand RNA [(-)RNA] of the packaged dsRNA segments in rotavirus. Strikingly, all (-)RNAs (of group A rotaviruses) have a 5' GG dinucleotide sequence. As the only rotavirus protein with 5' RTPase activity, NSP2 is implicated in the removal of the γ-phosphate from the rotavirus (-)RNA. To understand how NSP2, despite its sequence-independent RNA-binding property, recognizes (-)RNA to hydrolyze the γ-phosphate within the catalytic cleft, we determined a crystal structure of NSP2 in complex with the 5' consensus sequence of minus-strand rotavirus RNA. Our studies show that the 5' GG of the bound oligoribonucleotide interacts extensively with highly conserved residues in the NSP2 enzymatic cleft. Although these residues provide GG-specific interactions, surface plasmon resonance studies suggest that the C-terminal helix and other basic residues outside the enzymatic cleft account for sequence-independent RNA binding of NSP2. A novel observation from our studies, which may have implications in viroplasm formation, is that the C-terminal helix of NSP2 exhibits two distinct conformations and engages in domain-swapping interactions, which result in the formation of NSP2 octamer chains.

Solvent exposure associated with single abasic sites alters the base sequence dependence of oxidation of guanine in DNA in GG sequence contexts.

The effect of exposure of guanine in double-stranded oligonucleotides to aqueous solvent during oxidation by one-electron oxidants was investigated by introducing single synthetic tetrahydrofuran-type abasic sites (Ab) either adjacent to or opposite tandem GG sequences. The selective oxidation of guanine was initiated by photoexcitation of the aromatic sensitizers riboflavin and a pyrene derivative, and by the relatively small negatively charged carbonate radical anion. The relative rates of oxidation of the 5'- and 3' side G in runs of 5'⋅⋅⋅GG⋅⋅⋅ (evaluated by standard hot alkali treatment of the damaged DNA strand followed by high resolution gel electrophoresis of the cleavage fragments) are markedly affected by adjacent abasic sites either on the same or opposite strand. For example, in fully double-stranded DNA or one with an Ab adjacent to the 5'-G, the 5'-G/3'-G damage ratio is ≥4, but is inverted (<1.0) with the Ab adjacent to the 3'-G. These striking effects of Ab are attributed to the preferential localization of the "hole" on the most solvent-exposed guanine regardless of the size, charge, or reduction potential of the oxidizing species.

Cyclization and Rearrangement Reactions of an Fragment Ions of Protonated Peptides

a(n) ions are frequently formed in collision-induced dissociation (CID) of protonated peptides in tandem mass spectrometry (MS/MS) based sequencing experiments. These ions have generally been assumed to exist as immonium derivatives (-HN(+)═CHR). Using a quadrupole ion trap mass spectrometer, MS/MS experiments have been performed and the structure of a(n) ions formed from oligoglycines was probed by infrared spectroscopy. The structure and isomerization reactions of the same ions were studied using density functional theory. Overall, theory and infrared spectroscopy provide compelling evidence that a(n) ions undergo cyclization and/or rearrangement reactions, and the resulting structure(s) observed under our experimental conditions depends on the size (n). The a(2) ion (GG sequence) undergoes cyclization to form a 5-membered ring isomer. The a(3) ion (GGG sequence) undergoes cyclization initiated by nucleophilic attack of the carbonyl oxygen of the N-terminal glycine residue on the carbon center of the C-terminal immonium group forming a 7-membered ring isomer. The barrier to this reaction is comparatively low at 10.5 kcal mol(-1), and the resulting cyclic isomer (-5.4 kcal mol(-1)) is more energetically favorable than the linear form. The a(4) ion with the GGGG sequence undergoes head-to-tail cyclization via nucleophilic attack of the N-terminal amino group on the carbon center of the C-terminal immonium ion, forming an 11-membered macroring which contains a secondary amine and three trans amide bonds. Then an intermolecular proton transfer isomerizes the initially formed secondary amine moiety (-CH(2)-NH(2)(+)-CH(2)-NH-CO-) to form a new -CH(2)-NH-CH(2)-NH(2)(+)-CO- form. This structure is readily cleaved at the -CH(2)-NH(2)(+)- bond, leading to opening of the macrocycle and formation of a rearranged linear isomer with the H(2)C═NH(+)-CH(2)- moiety at the N terminus and the -CO-NH(2) amide bond at the C terminus. This rearranged linear structure is much more energetically favorable (-14.0 kcal mol(-1)) than the initially formed imine-protonated linear a(4) ion structure. Furthermore, the barriers to these cyclization and ring-opening reactions are low (8-11 kcal mol(-1)), allowing facile formation of the rearranged linear species in the mass spectrometer. This finding is not limited to 'simple' glycine-containing systems, as evidenced by the IRMPD spectrum of the a(4) ion generated from protonated AAAAA, which shows a stronger tendency toward formation of the energetically favorable (-12.3 kcal mol(-1)) rearranged linear structure with the MeHC═NH(+)-CHMe- moiety at the N terminus and the -CO-NH(2) amide bond at the C terminus. Our results indicate that one needs to consider a complex variety of cyclization and rearrangement reactions in order to decipher the structure and fragmentation pathways of peptide a(n) ions. The implications this potentially has for peptide sequencing are also discussed.

Effect of single base bulges on oxidative DNA‐protein crosslinking

Oxidative DNA damage contributes to aging and diseases such as Alzheimer's. Guanine is the most easily oxidized DNA base and therefore is most susceptible to oxidative damage. Bulges in DNA arise from replication and recombination errors and if left unrepaired, cause disease. Here, we are studying the effects of bulges on DNA‐ protein crosslinks. A DNA duplex was assembled using the strand 5’‐TATAGATATGGATATGATAT‐3’, which was fluorescently labeled with Alexafluor 546, and a complementary strand containing a single base bulge, 3’‐ TATACTATACYCTATACTATA‐ 5’, where Y = C, G, A or T. A control strand with no bulge was also synthesized. The GG sequence across from the single DNA base bulge localized the guanine radical at that bulge location. The flash quench technique was used to generate guanine radicals and DNA samples were analyzed by the gel shift assay. DNA bulges containing purines lead to an increase in DNA‐ protein crosslinking when compared to the well‐matched DNA. Thus, structural perturbations such as bulges, when near a guanine base, can influence the amount of oxidative DNA‐protein crosslinking.

Differential Nucleotide Excision Repair Susceptibility of Bulky DNA Adducts in Different Sequence Contexts: Hierarchies of Recognition Signals

The structural origin underlying differential nucleotide excision repair (NER) susceptibilities of bulky DNA lesions remains a challenging problem. We investigated the 10 S (+)- trans- anti-[BP]- N 2-2′-deoxyguanosine ( G⁎) adduct in double-stranded DNA. This adduct arises from the reaction, in vitro and in vivo, of a major genotoxic metabolite of benzo[ a]pyrene (BP), (+)-(7 R,8 S,9 S,10 R)-7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[ a]pyrene, with the exocyclic amino group of guanine. Removal of this lesion by the NER apparatus in cell-free extracts has been found to depend on the base sequence context in which the lesion is embedded, providing an excellent opportunity for elucidating the properties of the damaged DNA duplexes that favor NER. While the BP ring system is in the B-DNA minor groove, 5′ directed along the modified strand, there are orientational distinctions that are sequence dependent and are governed by flanking amino groups [ Nucleic Acids Res. 35 (2007), 1555–1568]. To elucidate sequence-governed NER susceptibility, we conducted molecular dynamics simulations for the 5′-…C G⁎GC…, 5′-…CG G⁎C…, and 5′-…TC G⁎CT… adduct-containing duplexes. We also investigated the 5′-…C G⁎IC… and 5′-…CI G⁎C… sequences, which contain “I” (2′-deoxyinosine), with hydrogen replacing the amino group in 2′-deoxyguanosine, to further characterize the structural and dynamic roles of the flanking amino groups in the damaged duplexes. Our results pinpoint explicit roles for the amino groups in tandem GG sequences on the efficiency of NER and suggest a hierarchy of destabilizing structural features that differentially facilitate NER of the BP lesion in the sequence contexts investigated. Furthermore, combinations of several locally destabilizing features in the hierarchy, consistent with a multipartite model, may provide a relatively strong recognition signal.

Structural Analyses of Anaphe Silk Fibroin and Several Model Peptides Using 13C NMR and X-ray Diffraction Methods

The Thaumetopoeid silkmoth Anaphe reticulata is highly abundant in equatorial and southern Africa and a potential commercial source of silk. In this paper, we report detailed structural characteristics of the silk fibroins. Comparison of the 13C solution NMR spectra of Anaphe silk fibroin and several model peptides with Ala and Gly residues indicates that (AAG)n1 and (AG)n2 are the main sequences. In addition this analysis also indicates that the sequence contains (A)m (where m > 2) such as (AAAG)n3, (AAGAG)n4, and (AAAGAG)n5. GG sequences were absent at a level that could be detected by our NMR method. The 13C CP/MAS NMR study shows that the fiber structure is heterogeneous, but predominantly β-sheet structure and the length of (AG)n2 is too short to form the Silk I structure detected in Bombyx mori silk fibroin. X-ray diffraction analyses gave information on the higher order structure and hydrogen-bonding character of Anaphe silk fiber.

LEF-1 recognition of platinated GG sequences within double-stranded DNA. Influence of flanking bases

The lymphoid enhancer-binding factor 1 (LEF-1) recognizes a double-stranded 9 base-pairs (bp) long motif in DNA which is significantly bent upon binding. This bend is centered at two destacked adenines whose geometry closely resembles that of two adjacent guanines crosslinked by the antitumor drug cisplatin. It has been proposed that cisplatin–GG crosslinks could hijack high mobility group (HMG) box containing transcription factors such as LEF-1. In order to examine such a possibility, we used electrophoretic mobility shift assays to determine the affinity of the HMG box of LEF-1 for a series of 25 oligonucleotides containing a central GG sequence, free or site-specifically modified by cisplatin. The binding affinity of the GG-platinated oligonucleotides was 3–6-fold higher than that determined for the corresponding unplatinated oligonucleotides, however, the binding to all cisplatin-modified oligonucleotides was at least 1 order of magnitude weaker than that to the 25 bp oligonucleotide containing the recognition 9 bp motif. The binding affinity was dependent on the nature of bases flanking the cisplatin-crosslinked G ∗G ∗ dinucleotide, the AG ∗G ∗T sequence displaying the strongest affinity and CG ∗G ∗T showing the strongest binding enhancement upon platination. In contrast, modification of the AGGT sequence with the third-generation platinum antitumor drug oxaliplatin did not enhance the affinity significantly. These results suggest that the cisplatin-caused bending of DNA does produce a target for LEF-1 binding, however, the cisplatinated DNA does not appear to be a strong competitor for the LEF-1 recognition sequence.

Mechanisms of Oxidation of Guanine in DNA by Carbonate Radical Anion, a Decomposition Product of Nitrosoperoxycarbonate

Peroxynitrite is produced during inflammation and combines rapidly with carbon dioxide to yield the unstable nitrosoperoxycarbonate, which decomposes (in part) to CO(3) (.-) and (.)NO(2) radicals. The CO(3) (.-) radicals oxidize guanine bases in DNA through a one-electron transfer reaction process that ultimately results in the formation of stable guanine oxidation products. Here we have explored these mechanisms, starting with a spectroscopic study of the kinetics of electron transfer from 20-22mer double-stranded oligonucleotides to CO(3) (.-) radicals, together with the effects of base sequence on the formation of the end-products in runs of one, two, or three contiguous guanines. The distributions of these alkali-labile lesions were determined by gel electrophoresis methods. The cascade of events was initiated through the use of 308 nm XeCl excimer laser pulses to generate CO(3) (.-) radicals by an established method based on the photodissociation of persulfate to sulfate radicals and the oxidation of bicarbonate. Although the Saito model (Saito et al., J. Am. Chem. Soc. 1995, 117, 6406-6407) predicts relative ease of one-electron oxidations in DNA, following the trend 5'-GGG > 5'-GG > 5'-G, we found that the rate constants for CO(3) (.-)-mediated oxidation of guanines in these sequence contexts (k(5)) showed only small variation within a narrow range [(1.5-3.0)x10(7) M(-1) s(-1)]. In contrast, the distributions of the end-products are dependent on the base sequence context and are higher at the 5'-G in 5'-GG sequences and at the first two 5'-guanines in the 5'-GGG sequences. These effects are attributed to a combination of initial hole distributions among the contiguous guanines and the subsequent differences in chemical reaction yields at each guanine. The lack of dependence of k(5) on sequence context indicates that the one-electron oxidation of guanine in DNA by CO(3) (.-) radicals occurs by an inner-sphere mechanism.

Base Oxidation at 5′ Site of GG Sequence in Double-stranded DNA Induced by UVA in the Presence of Xanthone Analogues: Relationship Between the DNA-damaging Abilities of Photosensitizers and Their HOMO Energies ¶

Base Oxidation at 5′ Site of GG Sequence in Double-stranded DNA Induced by UVA in the Presence of Xanthone Analogues: Relationship Between the DNA-damaging Abilities of Photosensitizers and Their HOMO Energies ¶