Effect of single base bulges on oxidative DNA‐protein crosslinking

Abstract

Oxidative DNA damage contributes to aging and diseases such as Alzheimer's. Guanine is the most easily oxidized DNA base and therefore is most susceptible to oxidative damage. Bulges in DNA arise from replication and recombination errors and if left unrepaired, cause disease. Here, we are studying the effects of bulges on DNA‐ protein crosslinks. A DNA duplex was assembled using the strand 5’‐TATAGATATGGATATGATAT‐3’, which was fluorescently labeled with Alexafluor 546, and a complementary strand containing a single base bulge, 3’‐ TATACTATACYCTATACTATA‐ 5’, where Y = C, G, A or T. A control strand with no bulge was also synthesized. The GG sequence across from the single DNA base bulge localized the guanine radical at that bulge location. The flash quench technique was used to generate guanine radicals and DNA samples were analyzed by the gel shift assay. DNA bulges containing purines lead to an increase in DNA‐ protein crosslinking when compared to the well‐matched DNA. Thus, structural perturbations such as bulges, when near a guanine base, can influence the amount of oxidative DNA‐protein crosslinking.