Genus Crinivirus Research Articles

First report of cucurbit yellow stunting disorder virus causing yellowing disease on major gourds in India

Cucurbitaceous crops are a key group of vegetables widely cultivated in India. Characterized yellowing symptoms along with interveinal chlorosis, mottling and downward curling were observed in ridge gourd, snake gourd, and bottle gourd along with the presence of whiteflies (Bemisia tabaci). To investigate the infecting virus, RT-PCR assays followed by sequencing and Transmission Electron Microscopy (TEM) analysis were performed. Sanger sequencing, nucleotide sequence analysis, and TEM imaging confirmed the association of cucurbit yellow stunting disorder virus (CYSDV), genus Crinivirus within the family Closteroviridae. This study reports the natural occurrence of CYSDV in ridge gourd, snake gourd, and bottle gourd for the first time in India.

Viromics reveals two novel viruses of the family Closteroviridae in Codiaeum variegatum plant with leaf variegation symptoms.

Codiaeum variegatum is a valuable ornamental plant with distinct bright yellowing and golden spots on dark green leaves, which resemble virus symptoms. To investigate the factors, especially viral agents, associated with the variegated leaf color of Codiaeum variegatum, we performed virome profiling of a single C. variegatum 'Gold Dust' leaf sample collected from Hainan, China using ribosomal RNA-depleted total RNA sequencing on an Illumina NovaSeq 6000 platform. Two novel viruses, with two variants each, belonging to the family Closteroviridae were detected and characterized: Croton golden spot-associated virus C variants 1 and 2 (CGSaVC-v1, and CGSaVC-v2) of the genus Crinivirus and Croton golden spot-associated virus A variants 1 and 2 (CGSaVA-v1 and CGSaVA-v2) of the genus Ampelovirus. Transmission electron microscopy showed long, flexuous, filamentous virus particles approximately 15 nm in diameter and 760-770 nm in length. Molecular screening of ninety-seven variegated individual plant leaves showed a high prevalence of CGSaVA-v1 (90.7%), CGSaVA-v2 (75.3 %), CGSaVC-v1 (70.1%), and CGSaVC-v2 (47.4%), while asymptomatic leaves near the meristem tip were mostly free of the target viruses. To our knowledge, this is the first study to demonstrate the significant association between closterovirids and the golden spots. The findings provide novel insights into the genetic diversity of the family Closteroviridae and inform future germplasm conservation and new cultivar development of Codiaeum Variegatum.

Viral complexity of tomatoes yellow mosaic and leaf curl diseases in lowland and highland areas

AbstractYellow mosaic and leaf curl diseases caused by whitefly‐transmitted begomo virus genera are important problems in tomato (Solanum lycopersicon L.) production in Indonesia, particularly on Java Island. The aims of this survey are to assess the percentages of disease incidence (DI) and disease severity index (DSI), evaluate the spread and complexity of begomovirus and crinivirus infections responsible for yellow mosaic and leaf curl diseases in tomato plants, and identify the species of whitefly insect vectors and their cryptic biotypes in tomato production centers located on Java Island, Indonesia. A total of 43 locations in East, Central, and West Java were surveyed during the dry season from July 2022 to September 2022. Disease incidence and severity were determined by observing 200 samples of tomato plants from five points at each location, with 40 plants per point of land. A total of 116 whitefly samples in microtubes and 215 symptomatic leaf samples were collected. The genus begomovirus and crinivirus infecting tomato were identified by PCR and RT‐PCR using genus‐specific primers. Similarly, whitefly species and their cryptic biotypes were identified by PCR using MCoI gene‐specific primers. Results showed that DI and DSI remarkably differed between the lowlands (66%–89%) and highlands (33%–62%) in the provinces of Central Java and West Java. Furthermore, PCR analysis of 215 infected tomato showing the symptoms of yellow mosaic and curly leaf revealed that three begomoviruses, one crinivirus and their mixed combination both begomoviruses, one crinivirus has been detected in all the samples. Similarly, the whitefly insect vector Bemisia tabaci biotype Q was identified in all areas, whereas Trialeurodes vaporariorum was found only in the East Java and Java highlands, respectively.

Leucine 127 of Cucurbit Chlorotic Yellows Virus P22 Is Crucial for Its RNA Silencing Suppression Activity and Pathogenicity.

Plant viruses produce particular suppressors to antagonize the host defense response of RNA silencing to establish infection. Cucurbit chlorotic yellows virus (CCYV), a member of the genus Crinivirus of the family Closteroviridae, severely damages the production of economically essential cucurbits worldwide. Here, we used the attenuated zucchini yellow mosaic virus (ZYMV) vector ZAC to express individual coding sequences, including CP, CPm, P25, and P22, of a Taiwan CCYV isolate (CCYV-TW) to identify their possible roles as pathogenicity determinants. ZAC is an HC-Pro function mutant that lacks the ability of local lesion induction on Chenopodium quinoa leaves and induces mild mottling followed by recovery on its natural host zucchini squash plants. Only the recombinant expressing CCYV-TW P22 complemented the effect of ZAC HC-Pro dysfunction, causing more severe symptoms on zucchini squash plants and restoring lesion formation on C. quinoa leaves, with lesions forming faster than those generated by the wild-type ZYMV. This suggests that CCYV-TW P22 is a virulence enhancer. Sequence analysis of criniviral P22s revealed the presence of four conserved leucine residues (L10, L17, L84, and L127) and one conserved lysine residue (K185). The five P22 residues conserved among the CCYV isolates and the P22 orthologs of two other criniviruses were each substituted with alanine in CCYV-TW P22 to investigate its ability to suppress RNA silencing and pathogenicity. The results provide new insights into CCYV-P22, showing that the L127 residue of P22 is indispensable for maintaining its stability in RNA silencing suppression and essential for virulence enhancement.

Virome Profiling, New Virus Identification and the Prevalence and Distribution of Viruses Infecting Chieh-Qua (Benincasa hispida Cogn. var. chieh-qua How) in China.

The cucurbit vegetable chieh-qua (Benincasa hispida var. chieh-qua How) is an important crop in South China and southeast Asian countries. Viral diseases cause substantial loss of chieh-qua yield. To identify the viruses that affect chieh-qua in China, ribosomal RNA-depleted total RNA sequencing was performed using chieh-qua leaf samples with typical viral symptoms. The virome of chieh-qua comprises four known viruses (melon yellow spot virus (MYSV), cucurbit chlorotic yellows virus (CCYV), papaya ringspot virus (PRSV) and watermelon silver mottle virus (WSMoV) and two novel viruses: cucurbit chlorotic virus (CuCV) in the genus Crinivirus and chieh-qua endornavirus (CqEV) in the genus Alphaendornavirus. The complete genomes of the two novel viruses in chieh-qua and three other isolates of CuCV in pumpkin, watermelon and cucumber were determined and the recombination signals of pumpkin and watermelon isolates of CuCV were detected. A reverse transcriptase PCR indicated that the dominant viruses of chieh-qua in Hainan are MYSV (66.67%) and CCYV (55.56%), followed by CuCV (27.41%), WSMoV (7.41%), cucumber mosaic virus (8.15%), zucchini yellow mosaic virus (6.67%), PRSV (6.67%) and CqEV (35.56%). Our findings support diagnostic and prevalence studies of viruses infecting chieh-qua in China, enabling sustainable control strategies for cucurbit viruses worldwide.

Tomato chlorosis virus CPm protein is a pathogenicity determinant and suppresses host local RNA silencing induced by single-stranded RNA.

Tomato chlorosis virus (ToCV) is a typical member of the genus Crinivirus, which severely threatens Solanaceae crops worldwide. The CPm protein encoded by ToCV has been reported to be associated with virus transmission by vectors and is involved in RNA silencing suppression, while the mechanisms remain ambiguous. Here, ToCV CPm was ectopically expressed by a Potato virus X (PVX) vector and infiltrated into Nicotiana benthamiana wild-type and GFP-transgenic16c plants. The phylogenetic analysis showed that the CPm proteins encoded by criniviruses were distinctly divergent in amino acid sequences and predicted conserved domains, and the ToCV CPm protein possesses a conserved domain homologous to the TIGR02569 family protein, which does not occur in other criniviruses. Ectopic expression of ToCV CPm using a PVX vector resulted in severe mosaic symptoms followed by a hypersensitive-like response in N. benthamiana. Furthermore, agroinfiltration assays in N. benthamiana wilt type or GFP-transgenic 16c indicated that ToCV CPm protein effectively suppressed local RNA silencing induced by single-stranded but not double-stranded RNA, which probably resulted from the activity of binding double-stranded but not single-stranded RNA by ToCV CPm protein. Taken together, the results of this study suggest that the ToCV CPm protein possesses the dual activities of pathogenicity and RNA silencing, which might inhibit host post-transcriptional gene silencing (PTGS)-mediated resistance and is pivotal in the primary process of ToCV infecting hosts.

Occurrence of bean-associated cytorhabdovirus and cowpea mild mottle virus infecting cultivated and wild Passiflora spp. in Brazil

Bean-associated cytorhabdovirus (BaCV) is a strain of Cytorhabdovirus caricae (genus Cytorhabdovirus, family Rhabdoviridae) identified in Brazil, in bean and soybean plants, in mixed infection with cowpea mild mottle virus (CPMMV, genus Carlavirus, family Betaflexiviridae). Ensuing the report of citrus-associated rhabdovirus (CiaRV — a citrus strain of Cytorhabdovirus caricae) infecting passion fruit in China, we speculated that BaCV, and possibly CPMMV, could be present in passion fruit crops in Brazil. This was tested by screening cultivated and wild Passiflora spp., and hybrid by RT-PCR and amplicon sequencing, which confirmed the presence of BaCV and CPMMV in several Passiflora spp. A total of 114 surveyed plants were collected in multiple locations from 2016 to 2021 and BaCV was identified in 4 of 19 cultivated P. edulis plants from a commercial field in Distrito Federal, Central Brazil. Moreover, while BaCV was detected in 4 of the 55 Passiflora accessions sampled at the Germplasm Bank “Flor da Paixão” (BAG-FP), CPMMV was identified in 14 of these 55 Passiflora spp. and hybrid accessions. This is the first record of BaCV in P. edulis in Brazil, and CPMMV and BaCV in other wild Passiflora species in the world. To investigate the potential mixed infection of BaCV and CPMMV-infected plants and other viruses previously identified infecting Passiflora spp. in Brazil, RT-PCR was conducted with specific primers for lettuce chlorosis virus (LCV, genus Crinivirus, family Closteroviridae) and cowpea aphid-borne mosaic virus (CABMV, genus Potyvirus, family Potyviridae). Most of the inspected plants had a mixed infection with these viruses. Our results warrant further studies to evaluate these viruses’ epidemiology, impacts, and interactions in the passion fruit crop.

Tomato chlorosis virus p22 interacts with NbBAG5 to inhibit autophagy and regulate virus infection.

Tomato chlorosis virus (ToCV) is a member of the genus Crinivirus in the family Closteroviridae. It has a wide host range and wide distribution, causing serious harm to the vegetable industry. The autophagy pathway plays an important role in plant resistance to virus infection. Viruses and plant hosts coevolve in defence and antidefence processes around autophagy. In this study, the interaction between ToCV p22 and Nicotiana benthamiana B-cell lymphoma2-associated athanogenes5 Nicotiana benthamiana (NbBAG5) was examined. Through overexpression and down-regulation of NbBAG5, results showed that NbBAG5 could negatively regulate ToCV infection. NbBAG5 was found to be localized in mitochondria and can change the original localization of ToCV p22, which is colocalized in mitochondria. NbBAG5 inhibited the expression of mitophagy-related genes and the number of autophagosomes, thereby regulating viral infection by affecting mitophagy. In summary, this study demonstrated that ToCV p22 affects autophagy by interacting with NbBAG5, established the association between viral infection, BAG proteins family, and the autophagy pathway, and explained the molecular mechanism by which ToCV p22 interacts with NbBAG5 to inhibit autophagy to regulate viral infection.

Crinivirus Tomato Chlorosis Virus Compromises the Control of Tomato Yellow Leaf Curl Virus in Tomato Plants by the Ty-1 Gene.

Tomato yellow leaf curl disease (TYLCD) causes severe damage to tomato crops in warm regions of the world, and is associated with infections of several whitefly (Bemisia tabaci)-transmitted single-stranded (ss)DNA begomoviruses (genus Begomovirus, family Geminiviridae). The most widespread begomovirus isolates associated with TYLCD are those of the type strain of the Tomato yellow leaf curl virus species, known as Israel (TYLCV-IL). The Ty-1 gene is widely used in commercial tomato cultivars to control TYLCV-IL damage, providing resistance to the virus by restricting viral accumulation and tolerance to TYLCD by inhibiting disease symptoms. However, several reports suggest that TYLCV-IL-like isolates are adapting to the Ty-1 gene and are causes of concern for possibly overcoming the provided control. This is the case with TYLCV-IL IS76-like recombinants that have a small genome fragment acquired by genetic exchange from an isolate of Tomato yellow leaf curl Sardinia virus, another begomovirus species associated with TYLCD. Here we show that TYLCV-IL IS76-like isolates partially break down the TYLCD-tolerance provided by the Ty-1 gene and that virulence differences might exist between isolates. Interestingly, we demonstrate that mixed infections with an isolate of the crinivirus (genus Crinivirus, family Closteroviridae) species Tomato chlorosis virus (ToCV), an ssRNA virus also transmitted by B. tabaci and emerging worldwide in tomato crops, boosts the breakdown of the TYLCD-tolerance provided by the Ty-1 gene either with TYLCV-IL IS76-like or canonical TYLCV-IL isolates. Moreover, we demonstrate the incorporation of the Ty-2 gene in Ty-1-commercial tomatoes to restrict (no virus or virus traces, no symptoms) systemic infections of recombinant TYLCV-IL IS76-like and canonical TYLCV-IL isolates, even in the presence of ToCV infections, which provides more robust and durable control of TYLCD.

Whole genome sequence of mulberry crinivirus, a new member of the genus Crinivirus

The whole genome sequence of mulberry crinivirus (MuCV), a novel member of the genus Crinivirus (family Closteroviridae) identified in mulberry (Morus alba L), was determined. The virus possesses a bipartite genome. RNA1 contains 8571 nucleotides (nt) with four open reading frames (ORFs). ORF1a encodes a putative polyprotein with papain-like protease, methyltransferase, and RNA helicase domains. ORF1b putatively encodes an RNA-dependent RNA polymerase (RdRp), which is probably expressed via a + 1 ribosomal frameshift. RNA2 consists of 8082 nt, containing eight ORFs that are similar in size and position to orthologous genes of other criniviruses. Phylogenetic analysis based on RdRp amino acid sequences of criniviruses placed MuCV in group 1.

Development of a RT-LAMP assay for real-time detection of criniviruses infecting tomato

Yellowing symptoms caused by tomato chlorosis virus (ToCV) and tomato infectious chlorosis virus (TICV), both assigned to the genus Crinivirus, resemble nutrient deficiencies. Therefore, early diagnosis of infections will prevent crop damage and the spread of the viruses. In this study, we established a rapid detection method for ToCV and TICV by reverse transcription-loop-mediated isothermal amplification (RT-LAMP). We first designed primer sets for RT-LAMP specific for ToCV and TICV. Next, by selecting the optimum primer set and determining the optimum conditions for the RT-LAMP reaction, each virus was detected within 50 min by piercing the diseased area of a tomato leaf with a toothpick, immersing the toothpick in the reaction solution, and conducting the RT-LAMP reaction. To verify the accuracy of the procedure, 61 tomato leaf samples showing disease symptoms were collected from five regions of Indonesia, and the RT-LAMP results for the samples were identical to those obtained with the commonly used reverse transcription-polymerase chain reaction.

Tomato chlorosis virus, a promiscuous virus with multiple host plants and whitefly vectors

AbstractTomato chlorosis virus (ToCV, genus Crinivirus, family Closteroviridae) is an emerging plant virus first identified in the mid‐1990s affecting tomato in Florida. Today, the virus is present in at least 39 countries and territories around the world, and this number has not stopped growing. ToCV prevalence in tomato has been reported to frequently reach 100%, with a consequent loss in production. Although ToCV infects mainly tomato, it has been reported to infect a wide range of plants, both cultivated and wild, including many economically important crops, such as pepper and potato. To date, 119 species of host plants belonging to 28 families have been recorded. ToCV is transmitted in nature by whiteflies belonging to two genera, namely members of the Bemisia tabaci complex and Trialeurodes vaporariorum and Trialeurodes abutiloneus. This review summarises what is known about ToCV, an example of an emerging plant pathogen, and is the basis of the Association of Applied Biologists' Description of Plant Viruses for ToCV.

Tomato chlorosis virus infecting Luffa cylindrica and Citrullus lanatus in China.

Sponge gourd (Luffa cylindrica) and watermelon (Citrullus lanatus) are important cash crops in China. In September 2015, interveinal yellow spots and chlorosis, suspected to be caused by the tomato chlorosis virus (ToCV; genus Crinivirus), were observed on sponge gourd and watermelon plants in six greenhouses in the cities of Shouguang, Dezhou, and Taian (2 greenhouses in each city) of Shandong Province. The incidences of the disease in sponge gourd and watermelon greenhouses were 10% to 20%. To identify causative pathogens, 20 sponge gourd and 15 watermelon samples were collected from cucurbit plant facilities in Shandong Province, China. Total RNA was extracted from the samples using RNA simple Total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction (RT-PCR) of ToCV was performed using To-CP-forward (ATGGAGAACAGTGCTGTTGC)/To-CP-reverse (TTAGCAACCAGTTATCGATGC) primer pair (Hirota et al. 2010). DNA fragments of approximately 780 bp were detected in all sponge gourd and watermelon samples. The fragments were inserted into pMD18-T vector (Takara, Shiga, Japan), which was subsequently transformed into Escherichia coli DH5α. Sponge gourd (n=1; ToCV-sponge gourd) and watermelon (n=1; ToCV-watermelon)-positive samples were selected for Sanger sequencing. BLASTN comparison of the sequencing results confirmed the presence of ToCV. The sequencing results were processed using DNAMAN version 6.0 (Lynnon Biosoft, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). The phylogenetic tree based on ToCV coat protein (CP) was constructed using amplified ToCV-sponge gourd, ToCV-watermelon, and ToCV representative sequences in GenBank database. According to the results, the ToCV sponge gourd and watermelon sequences belonged to an independent branch with the Chinese ToCV isolate (KC812619). Sequence analysis based on nucleotide sequences of ToCV CP demonstrated that ToCV-sponge gourd and ToCV-watermelon isolates shared the highest nucleotide sequence identity of 99.7% with the Chinese isolate (KC812619). To assess the transmissibility of ToCV, virus-free whiteflies (Bemisia tabaci) (n = 30) were placed for one day on ToCV-infected sponge gourd and watermelon plants for virus acquisition. Thereafter, whiteflies were transferred onto the virus-free sponge gourd (cv. 'Changlv', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) and watermelon (cv. 'ZaoJia 8424', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) seedlings for one day. Three weeks later, all plants from tested group showed same symptoms as those observed in the greenhouses, whereas plants in the control group were symptom-free. RT-PCR analysis confirmed the ToCV infection in sponge gourd and watermelon plants, whereas control plants were found uninfected. ToCV infection in sponge gourds and watermelons has not been reported previously. To the best of our knowledge, this is the first report of sponge gourd and watermelon being natural hosts of ToCV worldwide. We believe that spread of ToCV in cucurbits needs attention.

Mixed infection of an emaravirus, a crinivirus, and a begomovirus in Pueraria lobata (Willd) Ohwi.

Pueraria lobata (Willd) (Pueraria montana var. lobata (Willd.) Maesen & S. M. Almeida ex Sanjappa & Predeep) is an important herbal medicine used in many countries. In P. lobata plants showing symptoms of mosaic, yellow spots, and mottling, mixed infection of new viruses provisionally named Pueraria lobata-associated emaravirus (PloAEV, genus Emaravirus), Pueraria lobata-associated crinivirus (PloACV, genus Crinivirus), and isolate CQ of the previously reported kudzu mosaic virus (KuMV-CQ, genus Begomovirus) was confirmed through high-throughput sequencing. PloAEV has five RNA segments, encoding a putative RNA-dependent RNA polymerase, glycoprotein precursor, nucleocapsid protein, movement protein, and P5, respectively. PloACV has two RNA segments, encoding 11 putative proteins. Only PloAEV could be mechanically transmitted from mixed infected symptomatic kudzu to Nicotiana benthamiana plants. All three viruses were detected in 35 symptomatic samples collected from five different growing areas, whereas no viruses were detected in 21 non-symptomatic plants, suggesting a high association between these three viruses. Thus, this study provides new knowledge on the diversity and molecular characteristics of viruses in P. lobata plants affected by the viral disease.

Calystegia hederacea: a new natural host of Sweet potato latent virus in China.

Sweet potato is a global root crop, with a worldwide production of 91.5 million tons in 2019 (FAOSTAT, 2019). However, virus diseases cause significant yield losses and quality decline in sweet potato. Up to now, over 30 different viruses have been identified in sweet potato (Clark et al. 2012). Expanding knowledge of the host range of sweet potato viruses will provide a benefit for the understanding of virus occurrence and designing appropriate virus control measures. In August 2019, ten Calystegia hederacea and two Convolvulus arvensis (Convolvulaceae) weed plants with or without symptoms of leaf yellowing symptoms were collected from various virus disease-affected sweet potato fields in four cities (Jiaozuo, Xinxiang, Zhengzhou and Kaifeng) of Henan Province for virus detection. The leaves of these plants were harvested and pooled for total RNA extraction using a Plant Total RNA Purification Kit (GMbiolab, Taichung, Taiwan). A library for high-throughput sequencing (HTS) was constructed and sequenced using the Illumina HiSeq 2000 platform by BGI Tech (Shenzhen, China). Clean reads (n = 100,570,346), each 150 bp in length, were de novo assembled using CLC Genomics Workbench 9.5 (Qiagen, USA). The assembled contigs were analyzed against the viral reference genome database in GenBank using the BLASTN and BLASTX searches. Three contigs related to sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus, family Closteroviridae) were identified (Liu et al. 2021). In addition, a total of 20 contigs, ranging from 1,019 to 9,859 bp in length with an average depth of coverage of 1439.26, showed 74.80-87.59% nucleotide (nt) sequence identities with corresponding sequences of sweet potato latent virus (SPLV, genus Potyvirus, family Potyviridae). The sequence of the 9,859-bp contig covering nearly complete genome sequence for SPLV, was deposited in GenBank (accession no.OL625609). These results demonstrated the presence of genetically diverse isolates of SPLV in the pooled samples. To further confirm the HTS result, each of the 12 samples were tested by RT-PCR using SPLV primers (SPLV-F1: 5'-AATGCCAAGGCTACAAGGAGT-3' and SPLV-R1: 5'-CAAGTAGTGTGTGTATGTTCC-3') that targets a partial conserved region of the coat protein gene in SPLV and SPCSV primers designed based on three contigs (ctg1-F1/R1, ctg2-F1/R1, and ctg3-F1/R1) (Liu et al. 2021), respectively. As a result, four symptomless C. hederacea samples tested positive for SPLV, yielding the expected approximately 500 bp PCR fragment, and one leaf yellowing C. hederacea sample tested positive for SPCSV (Liu et al. 2021). The sequences obtained from two of the four amplicons of SPLV (MZ089700 and OM056706) showed 90.2 and 89.8% nt (100 and 99.4% amino acid) identities with the corresponding sequences of the SPLV isolate Shaanxi1 from sweet potato (HQ844148). In 2021, a further 45 C. hederacea plants collected from Shangqiu (n = 6), Xinxiang (n =30) and Pingdingshan (n = 9) cities in Henan Province, were screened by RT-PCR with SPLV-F1/R1 primers, giving an incidence of 33.33%. SPLV is an important potyvirus infecting sweet potato. SPLV is asymptomatic in most sweet potato cultivars in single infection but is able to mediate synergistic viral disease in co-infection with SPCSV (Untiveros et al. 2007). To the best of our knowledge, this is the first report of SPLV in C. hederacea. The finding reported here indicated that C. hederacea may act as a reservoir of SPLV and possible infection source for the sweet potato crop.

First Report of Cucurbit Chlorotic Yellows Virus Infecting Watermelon and Zucchini in the Canary Islands, Spain.

In July 2019, eleven watermelon (Citrullus lanatus) plants, six 'Augusta negra' and five 'Kasmira', and seven zucchini (Cucurbita pepo) 'Marcado' plants showing yellowing and vein clearing on the leaves were collected in Arico, in Tenerife Island of the Canary Islands. Analysis with enzyme-linked immunosorbent assay (ELISA) with polyclonal antibodies using kits from (LOEWE® Biochemica GmbH, Sauerlach, Germany) detected cucurbit chlorotic yellows virus (CCYV) in four watermelon (two 'Augusta negra' and two 'Kasmira') plants and one zucchini plant. Reverse transcription-polymerase chain reaction (RT-PCR) with primers CCYV-CPs (5'-ATGGAGAAGACTGACAATAAACAA-3') and CCYV-CPas (5'-TTTACTACAACCTCCCGGTG-3') (Hamed et al. 2011) yielded 750 bp DNA fragments, which were purified, and directly sequenced by Sanger sequencing. The four CCYV sequences obtained from watermelon plants were identical and showed a 99.6% nucleotide identity with the CCYV isolate from Zucchini. The nucleotide sequences of CCYV isolates 351/19 from watermelon and 361/19 from zucchini were deposited in GenBank under accessions OK562588 and OK562589, respectively. BLASTn analysis showed high nucleotide identity, greater than 99 % with most worldwide CCYV isolates (AB523789, HM581658, JF502222, JF807053, JN126045-6, JQ904629, JX014262, KC990503-5, KC990507, KJ735450, KJ149806, KT946809, KT946816, KU507602, KX118632, KY400632-4, KY618799, LT716000, LT716003-4, MH477612, MH806868, MH819191, MN529560, MN815012-3, MT396249 MT048669, MW033301, MW584337, MW251342, MW521380, MW521381, MW584335-6, MW629380, MZ325848-9 and MZ405664), about 98% with two Saudi Arabian isolates (KT946810 and KT946815) and about 95 % with three Iranian isolates (KC577201-3). These genetic relationships were confirmed with a phylogenetic tree (Supplementary Fig. 1) inferred with the maximum likelihood method with 500 bootstrap replicates and the nucleotide substitution model HKY+G implemented in the program MEGA-X (Kumar et al., 2018). There is no correlation between geographic distance and genetic distance. CCYV is related to viruses in the genus Crinivirus, family Closteroviridae (Okuda et al., 2010). It is widespread and causes high economic losses (yield reduction and unmarketable fruits) in cucurbit crops from East Asia: Japan, China, Taiwan and South Korea; North America (the USA states of California, Texas, Georgia and Alabama); Middle East: Sudan, Saudi Arabia and Iran; and the Mediterranean basin: Egypt, Israel, Lebanon, Turkey, Greece, Algeria and peninsular Spain (Kheireddine et al., 2020; Chynoweth et al., 2021; Jailani, et al., 2021; Kwak et al., 2021). This is the first report of CCYV infecting cucurbits in the Canary Islands. The emergence of this virus poses a threat to the cucurbit crops in the Canary Islands and requires control measures to prevent its spread in Tenerife and the other Canary Islands.

Diverse Novel Viruses Coinfecting the Tropical Ornamental Plant Polyscias balfouriana in China.

The viromic profile of Polyscias balfouriana cv. Marginata, a perennial woody and ornamental plant, was determined using ribosomal RNA-depleted total RNA (rRNA-depleted totRNA) sequencing. Five viruses (i.e., polyscias mosaic virus, PoMV; one potential novel rhabdovirus; and three novel viruses of Betaflexiviridae and Closteroviridae) were detected and prevalence-surveyed in Hainan province, China. The genomes of polyscias capillovirus 1 (PCaV-1) and polyscias citrivirus 1 (PCiV-1) of family Betaflexiviridae were completed, and the genomes of polyscias crinivirus 1 (PCrV-1) of Closteroviridae were nearly completed lacking the 5′ and 3′ termini. PCaV-1 shares 68% genome nucleotide (nt) identity and 66% replicase (Rep) amino acid (aa) identity with homologues in apple stem grooving virus (ASGV). PCiV-1 shares 65% genome nt identity and 64% Rep aa identity with homologs in citrus leaf blotch virus (CLBV). Meeting the species demarcation criteria, PCaV-1 and PCiV-1 were considered to be new species in genera Capillovirus and Citrivirus, respectively. PCrV-1 shares high genome nt identity (62%), heat shock protein 70-like protein (HSP70h) and RNA-dependent RNA polymerase (RdRp) aa identity (78–80%) with homologues in tomato chlorosis virus (ToCV). We tentatively consider PCrV-1 to be an unclassified member of the Crinivirus genus. PoMV, PCaV-1, PCiV-1, and PCrV-1 are the prevalent viruses with >73% occurrence in the Xinglong Tropical Botanical Garden, Hainan, China.

First Report of Natural Infection of Zucchini by Tomato Chlorosis Virus and Cucurbit Chlorotic Yellows Virus in China.

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20-30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. 'Zaoqingyidai', 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.

Wild Radish (Raphanus raphanistrum L.) Is a Potential Reservoir Host of Cucurbit Chlorotic Yellows Virus.

Cucurbit chlorotic yellows virus (CCYV) belongs to the genus Crinivirus and is part of a complex of whitefly-transmitted viruses that cause yellowing disease in cucurbits. In the southeastern USA, heavy incidences of CCYV have been observed on all cucurbits grown in the fall. CCYV was detected from wild radish (Raphanus raphanistrum L.), a common weed that grows in the southeastern USA by high-throughput sequencing as well as RT-PCR. CCYV sequence from wild radish was 99.90% and 99.95%, identical to RNA 1 and RNA 2 of cucurbit isolates of CCYV from the region. Transmission assays using whiteflies demonstrated that wild radish is a good host for CCYV. Whiteflies were also able to acquire CCYV from wild radish and transmit the virus to cucurbit hosts, which developed typical symptoms associated with CCYV. Using quantitative PCR, the titer of CCYV in wild radish was also estimated to be on par with that of cucurbit hosts of the virus. Whitefly bioassays revealed that wild radish is an acceptable feeding and reproductive host plant. These results indicate that wild radish could serve as a reservoir host for CCYV in the USA and other parts of the world where similar conditions exist.

First Report of Cucurbit yellow stunting disorder virus and Cucurbit chlorotic yellows virus in Cucurbit Crops in Alabama.

During the summer and fall of 2020, foliar yellowing symptoms, including leaf mottle and interveinal yellowing with green veins were observed on several melon, squash, and cucumber plants in commercial fields in Alabama, USA. These foliar symptoms were similar to those caused by the whitefly-transmitted yellowing viruses, cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) (both genus Crinivirus, Closteroviridae). A total of 231 leaf samples showing yellowing, interveinal chlorosis, and mottling (e-Xtra 1, 2) were collected from individual plants from 25 commercial fields in Alabama (70 watermelon, 52 melon, 34 pumpkin, 50 squash, and 25 cucumber) during two sampling periods, June (spring/summer season) and October (fall season) 2020. Total RNA, extracted as described in Tamang et al. (2021), was used in reverse transcription polymerase chain reaction (RT-PCR) with primer sets designed to amplify portions of the CCYV and CYSDV RNA-dependent RNA polymerase (RdRp) genes encoded on RNA1 of these viruses (Mondal et al. 2021, submitted; Kavalappara et al., 2021). Single infections of either CYSDV or CCYV were found in 53 of 57 infected cucurbit samples (of 231 total plants), whereas both viruses were detected in four samples, all squash. In June 2020 near the end of the spring season, CYSDV was identified from 20 of 114 total cucurbit plants tested (17.5%), but CCYV was not identified from any plants. During the fall season, 37 of 117 plants (32%) tested positive for the presence of one or both criniviruses. Of the 37 virus-positive samples from the fall season, 26 were singly infected with CCYV (70%), seven were singly infected with CYSDV (19%), and four were infected with both CYSDV and CCYV (11%). The RdRp amplicon was sequenced from three CCYV-infected plants (2 squash; GenBank Accession No. MZ073347, MZ073348; 1 cucumber, MZ073349) and one CYSDV-infected plant (melon, MZ073350); the 857 nt sequenced portion of the CCYV RdRp gene was found to share 99% identity with the same sequence of CCYV RNA1 isolates from Israel (MH477611.1) and California (MW680157), whereas the 494 nt CYSDV amplicon shared 100% sequence identity with the comparable sequence from RNA1 of a CYSDV isolate from Arizona (EF547827.1). In addition, all of the CYSDV and CCYV infections were confirmed using a second set of primers that amplified 394 and 372 nt sections of the coat protein gene of each virus, respectively (Wintermantel et al., 2009; 2019), encoded on RNA2 of each viral genome. Furthermore, a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted) was used to confirm four representative CYSDV and CCYV infections each. This is the first report of CYSDV and CCYV in cucurbit crops from Alabama. Surprisingly, CYSDV was only found in melon plants (20 of 52, 38%), whereas CCYV was only found in squash, pumpkin, and cucumber (26 of 109, 24%); no watermelon plants were infected with either virus, even though watermelon is a known host of both viruses. The identification of CCYV and CYSDV in Alabama, along with a recent report of both criniviruses from nearby Georgia (Kavalappara et al., 2021) illustrates the need for a more thorough sampling of cucurbit crops, further monitoring of the whitefly vector, Bemisia tabaci, and the identification of alternate hosts of these viruses to better understand the epidemiology of these viruses in Alabama and throughout the Gulf Coast region.