IL-10 Genotypes Research Articles

Interleukin 10 Polymorphisms as Risk Factors for Progression to Chagas Disease Cardiomyopathy: A Case-Control Study and Meta-Analysis.

BackgroundChagas disease is a lifelong infection caused by the protozoa Trypanosoma cruzi endemic in Latin-America and emergent worldwide. Decades after primary infection, 20-30% of infected people develop chronic Chagas cardiomyopathy (CCC) while the others remain asymptomatic. CCC pathogenesis is complex but associated with sustained pro-inflammatory response leading to tissue damage. Hence, levels of IL-10 could have a determinant role in CCC etiology. Studies with Latin-American populations have addressed the association of genetic variants of IL-10 and the risk of developing CCC with inconsistent results. We carried out a case control study to explore the association between IL-10-1082G>A (rs18008969), -819C>T (rs1800871), -592A>C (rs1800872) polymorphisms and CCC in a population attending a hospital in Buenos Aires Argentina. Next, a systematic review of the literature and a meta-analysis were conducted combining present and previous studies to further study this association.MethodsOur case control study included 122 individuals with chronic T. cruzi infection including 64 patients with any degree of CCC and 58 asymptomatic individuals. Genotyping of IL-10 -1082G>A, -819C>T, -592A>C polymorphisms was performed by capillary sequencing of the region spanning the three polymorphic sites and univariate and multivariate statistical analysis was undertaken. Databases in English, Spanish and Portuguese language were searched for papers related to these polymorphisms and Chagas disease up to December 2021. A metanalysis of the selected literature and our study was performed based on the random effect model.ResultsIn our cohort, we found a significant association between TT genotype of -819 rs1800871 and AA genotype of -592 rs1800872 with CCC under the codominant (OR=5.00; 95%CI=1.12-23.87 P=0,04) and the recessive models (OR=5.37; 95%CI=1.12-25.68; P=0,03). Of the genotypes conformed by the three polymorphic positions, the homozygous genotype ATA was significantly associated with increased risk of CCC. The results of the meta-analysis of 754 cases and 385 controls showed that the TT genotype of -819C>T was associated with increased CCC risk according to the dominant model (OR=1.13; 95% CI=1.02–1.25; P=0,03).ConclusionThe genotype TT at -819 rs1800871 contributes to the genetic susceptibility to CCC making this polymorphism a suitable candidate to be included in a panel of predictive biomarkers of disease progression.

IL-6 and HSPA1A Gene Polymorphisms May Influence the Levels of the Inflammatory and Oxidative Stress Parameters and Their Response to a Chronic Swimming Training.

The aim of the study was to evaluate whether the most common polymorphisms in the IL-6 and HSP70 genes affect the circulating heat shock protein 70 (HSP70), as well as inflammatory and prooxidant-antioxidant parameters in healthy men undergoing chronic endurance training. The subjects were randomly assigned to a 12-week swimming training (ST group) or control group (CON). Fasting blood samples were collected pre- and post-study period to assessment: superoxide dismutase (SOD) and glutathione peroxidase (GPx) activities, serum levels of lipid hydroperoxides (LHs), tumor necrosis factor α (TNFα), and HSP70. Subjects were genotyped for IL-6-174G/C, HSPA1A + 190 G/C and HSPA1B + 1538 A/G single nucleotide polymorphisms (SNPs) by real-time PCR. After a 12-week study period, a decrease in TNFα, HSP70, and GPx was observed in the ST group, but not the CON group. IL-6 SNP affected serum TNFα levels (main effect of genotype). Higher TNFα levels (pre- and post-study period) was observed in CC CON than in other IL-6 genotypes of CON and ST groups. However, a post-training decrease in TNFα was observed in both GG and CC IL-6 genotypes of ST group. In turn, only GG IL-6 genotype of the ST group was related to a post-training decrease in HSP70 (main time and genotype interaction). Moreover, pre- and post-training LHs were lower in GG than GC/CC HSPA1A genotypes of the ST group (main genotype effect). In conclusion, polymorphisms within the IL-6 and HSPA1A genes seem to affect baseline levels of some inflammatory parameters and prooxidant-antioxidant status and/or their changes after chronic swimming training. However, the results should be confirmed in a study with a larger sample size, one that includes individuals with sedentary lifestyles.

Cytokine gene polymorphism frequencies in Turkish population living in Marmara region

Abstract Objectives Sequence variants in cytokine genes are related to affect cytokine gene levels. In this study, it was aimed to examine eight single nucleotide polymorphisms (SNPs) in five cytokine genes (TNF-α, INF-γ, IL-6, IL10, TGF-β) for the Turkish population living in Marmara region and to reveal the genetic distance between the study group and other populations. Methods In this study, three-hundred unrelated healthy individuals were involved and all genotyping were performed by using sequence-specific primers PCR (PCR-SSP) method. The SNP data were analyzed for Hardy Weinberg equilibrium fit by calculating expected genotype frequencies and comparing them to the observed values using Arlequin software version 3.1. The genetic distances between the study group and other populations were calculated and a neighbor-joining tree was constructed by PHYLIP. Results The observed genotypes of TNF-α (−308), IFN-γ (+874), TGF-β (codon 10), and TGF-β (codon 25) of the subjects were found to be similar with other populations investigated in this study. However, there is a significant frequency difference for IL-6 and IL-10 genotypes between populations. Conclusions The current population study provided more reference values for these polymorphisms and generated a control group to be used in further association studies especially for transplantation, GVHD, autoimmune and malign disease.

Correlations of IL-18 and IL-6 gene polymorphisms and expression levels with onset of glioma.

The aim of this study was to explore the correlations of interleukin (IL)-18 and IL-6 gene polymorphisms and expression levels with the onset of glioma. The differences in the expression levels of IL-18 and IL-6 between glioma patients and normal people in the Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) databases were analyzed. A total of 200 glioma patients and 200 healthy people were taken as the research subjects. Peripheral blood was collected to extract deoxyribonucleic acids (DNAs). IL-18 and IL-6 gene polymorphisms were detected and analyzed combined with haplotype analysis and gene expression levels of IL-18 and IL-6, as well as their levels in serum. Both IL-18 and IL-6 were highly expressed in tumor tissues of glioma patients, whereas they were lowly expressed in normal cerebral tissues, with statistically significant differences (p<0.05). Statistically significant differences in the allele distributions of IL-18 gene polymorphisms rs371411440 (p=0.041) and rs371828055 (p=0.002) and IL-6 gene polymorphisms rs201211345 (p=0.000) and rs201439472 (p=0.003) were observed between disease group and control group (p<0.05). Genotype distributions of IL-18 gene polymorphism rs371828055 (p=0.005) and IL-6 gene polymorphisms rs201211345 (p=0.000) and rs201439472 (p=0.019) in disease group were significantly different from those in control group (p<0.05). Disease group exhibited significantly higher frequencies of genotype GG of IL-18 gene polymorphism rs371828055, genotype AA of IL-6 gene polymorphism rs201211345 and genotype TT of IL-6 gene polymorphism rs201439472 than control group (p<0.05). There were statistically significant differences in the distributions of the dominant model AA+AC of IL-6 gene polymorphism rs201211345 (p=0.016) and the recessive model GT+TT of IL-18 gene polymorphism rs371828055 (p=0.010) between the two groups (p<0.05). Differences in the distributions of haplotypes CC (p=0.001) and GT (p=0.027) of IL-18 gene polymorphisms rs371411440 and rs371828055 and haplotypes AC (p=0.009), AT (p=0.000) and CT (p=0.000) of IL-6 gene polymorphisms rs201211345 and rs201439472 were observed between disease group and control group (p<0.05). In addition, a high degree of linkage disequilibrium was detected between IL-6 gene polymorphisms rs201211345 and rs201439472 (D'=0.583). The genotypes of IL-18 gene polymorphism rs371828055 were evidently correlated with the gene expression of IL-18 (p=0.000). Meanwhile, patients with genotype GT had a distinctly lower expression level of IL-18 (p<0.05). The genotypes of IL-6 gene polymorphism rs201211345 were obviously associated with the expression of IL-6 (p=0.002). The expression of IL-6 was markedly down-regulated in patients carrying genotype AA (p<0.05). Consistent with the expression levels of IL-18 and IL-6, the genotypes of IL-18 gene polymorphism rs371828055 were associated with the content of serum IL-18 (p<0.05). Moreover, patients carrying genotype GT had distinctly lower content of serum IL-18 (p<0.05). Additionally, the genotypes of IL-6 gene polymorphism rs201211345 were evidently correlated with the content of serum IL-6 (p<0.05), and the content of serum IL-6 declined distinctly in patients with genotype AA (p<0.05). IL-18 and IL-6 gene polymorphisms and expression levels are significantly correlated with the onset of glioma.

Genetic Variants in Interleukin-10 Gene Association with Susceptibility and Cervical Cancer Development: A Case Control Study.

Objectives Cervical cancer (CC) is one of the most destructive disease caused by persistent HPV infection which affects women worldwide, especially in developing countries. The genetic basis of host immune response especially cytokine function has been shown to influence CC susceptibility. Studies have demonstrated that IL-10 gene polymorphism have been associated with numerous malignancies, but in context to CC results were inconclusive. Though, aim of our study to investigate the association between IL-10 -1082A/G and -819C/T promoter polymorphism and CC susceptibility. Material and Methods This study comprised 192 women with CC and 200 controls. HPV detection was done by RT-PCR and genotyping was assessed through PCR-RFLP method. Serum concentration of IL-10 measured by ELISA. Results Women with AG and AG+GG genotypes of IL-10 -1082A/G had two-fold increased risk of CC [OR, 2.35 (95% CI, 1.54–3.58), p = 0.005], [OR, 2.03 (95% CI, 1.36–3.04), p = 0.0005] compared to controls. Women with G allele of -1082A/G polymorphism had linked with CC susceptibility [OR, 1.39 (95% CI, 1.02–1.88), p = 0.036] compared to controls. No significant difference was found between patients and controls in the genotype or allele frequencies of IL–10 -819C/T polymorphism [OR, 1.00 (95% CI, 0.63–1.58), p = 0.99]. The level of serum concentration of IL-10 was significantly higher in cases compared to controls. Conclusion These findings help to understand that polymorphism of IL-10 -1082A/G gene is associated with increased risk of CC development and can serve as a marker of genetic susceptibility to CC.

Abstract P2-07-04: Analysis of host inflammatory and estrogen biomarkers in JAKEE: A phase II trial of the JAK inhibitor ruxolitinib in combination with exemestane for estrogen receptor-positive metastatic breast cancer

Abstract Background: Circulating IL-6, an activator of JAK/STAT signaling, is associated with poor outcomes and aromatase inhibitor (AI) resistance in hormone-receptor positive (HR+) metastatic breast cancer (MBC). We previously presented clinical outcomes of JAKEE, a single arm, phase II, Simon two-stage clinical trial that tested Ruxolitinib (Rux), an oral selective inhibitor of JAK1/2, and exemestane (EXE) in 25 participants (pts) with HR+ MBC that relapsed/progressed on non-steroidal AI (NSAI); specifically, the primary endpoint of safety was met, but there were no complete or partial responses and 6/25 (24%) achieved stable disease (SD) for ≥6 cycles. We investigated whether host circulating inflammatory markers, IL-6 genotypes, and estrogen levels were associated with differential response to therapy.Methods: Responders (R) were defined as having achieved SD≥6 cycles. Flow cytometry was performed on baseline and on-treatment peripheral blood samples to assess downstream CD3+ T-cell phosphoSTAT3 inhibition by Rux. Serum concentrations of C-reactive protein (CRP), IL-6, serum amyloid A (SAA), Estrone (E1) and Estradiol (E2) were measured at baseline and serially on treatment. Sanger sequencing was performed to assess for three functional variants of the IL-6 promoter: −572G&amp;gt;C (rs1800796), −597G&amp;gt;A (rs1800797), and −174G&amp;gt;C (rs1800795), with high-risk polymorphisms being -597G/G and/or -174G/G. Non-parametric median testing was employed to test for differences in circulating markers by response groups given non-normal distribution, with a two-sided alpha of 0.05.Results: The cohort was heavily pre-treated: 28% received ≥2 lines of chemotherapy for MBC and 20% had CNS disease at enrollment. Among 17/25 pts with samples for pharmacodynamic assessment, Rux exhibited a 25% median inhibition (range 0-77%) of phosphoSTAT3. There was no differential effect in R vs non-responders (NR) (median inhibition 20% vs 29%, p=0.15). Frequency of high-risk IL-6 genotypes and distribution of baseline serum CRP, IL-6, SAA, E1 and E2 are depicted in the table. 15/25 (60%) harbored a high-risk IL-6 promoter polymorphism, with no significant difference in frequency between R and NR (50% vs 63%, p=0.65). 19 pts had samples for inflammatory biomarker analysis. 16/19 had baseline CRP≥10mg/L. While median levels of baseline CRP, SAA, and IL-6 were above upper limit of normal, there was no difference between R and NR (table). The proportion of pts with baseline undetectable E1 and E2 were similar between R and NR (E1: 36.9% vs 33.3%, p=1.0, E2: 52.6% vs 50%, p=1.0); notably, a significantly lower proportion with high-risk IL-6 genotype had undetectable baseline E1 (20% vs 60%, p=0.041), while no difference was noted for baseline E2, nor in the % change in E1 or E2 levels from baseline to cycle 4 by responder status.Conclusions: The JAKEE cohort represents an inflamed population with elevated circulating inflammatory markers and a high proportion with high-risk IL-6 genotypes. Examination of host inflammatory markers, IL-6 genotypes and estrogen levels did not reveal a differential response to the combination of Rux and EXE in patients with HR+ MBC that had progressed on prior NSAI. At tolerable dosing, Rux exhibited only a modest inhibition of phosphoSTAT3. Further work is needed to optimize strategies for targeting inflammation and JAK/STAT signaling in HR+ MBC. IL-6 GenotypeFrequencyFrequency by ResponderSignificanceHigh-Risk -174G/G and/or -597G/G15/25 (60%)Non-responder12/19 (63.2%)Responder3/6 (50%)p-value0.56Pretreatment Inflammatory Biomarkers [Upper limit of normal]Median (Range)Median Level by Responder GroupSignificanceCRP [8mg/L]SAA [10mg/L]IL-6 [2pg/mL]24.0 (0.2-146.8)12.8 (2.8-162.5)4.2 (1.8-11.5)Non-responder23.219.84.5Responder24.7 12.42.7p-value0.510.150.15Baseline Estrogen BiomarkersMedian (Range)Non-responderResponderp-valueEstrone (E1) (pg/mL)Estradiol (E2) (pg/mL)79.5.0 (0.2-1039.0)0.2 (0.2-44.1)79.8 0.247.8 4.20.410.91 Citation Format: Igor Makhlin, Nicholas McAndrew, E. Paul Wileyto, Amy Clark, Robin Holmes, Lisa N Bottalico, Grace R Jeschke, Kevin R Fox, Susan M Domcheck, Jennifer M Matro, Angela R Bradbury, Natalie Shih, Michael D Feldman, Elizabeth O Hexner, Jacqueline F Bromberg, Angela DeMichele. Analysis of host inflammatory and estrogen biomarkers in JAKEE: A phase II trial of the JAK inhibitor ruxolitinib in combination with exemestane for estrogen receptor-positive metastatic breast cancer [abstract]. In: Proceedings of the 2021 San Antonio Breast Cancer Symposium; 2021 Dec 7-10; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2022;82(4 Suppl):Abstract nr P2-07-04.

A study on the association of IL-10 promoter polymorphisms with rheumatic heart disease in Turkish female patients.

Rheumatic heart disease (RHD) is an inflammatory disease that develops after streptococcal infections. The pleiotropic effect of IL-10 plays a role in the regulation of immune system responses. However, impaired IL-10 expression or signaling can impair antigen clearance during acute bacterial infections, creating a favorable environment for persistent inflammation. More than 30 single nucleotide polymorphisms (SNPs) in the promoter region of the gene encoding IL-10, which has a highly polymorphic structure, and the relationship of these SNPs with increased and decreased cytokine expression have been reported. Therefore, it is assumed that these polymorphisms may be predictors of an individual's susceptibility to RHD. In this study, we aimed to evaluate the relationship between sensitivity of IL-10 variants (-1082, -819, -592) and severity of RHD in the Turkish population. In this case-control study, IL-10 promoter gene variants of the study group consisting of 390 women were examined using the TaqMan 5' allelic discrimination test method. There was no statistically significant difference between study groups in terms of IL-10 (-1082, -819, -592) genotypes. In patients with mild and severe valve damage, there was no statistically significant difference in terms of IL-10 (-1082, -819, -592) genotype distributions and allele frequencies (p>0.05). Our findings suggest that IL-10 (-1082, -819, -592) variants are not associated with the pathogenesis and severity of the disease in women in the Turkish population. In the Turkish population, IL-10 (-1082, -819, -592) variants cannot be recommended as a suitable genetic marker for RHD.

Pro-inflammatory and anti-inflamatory cytokine genes polymorphisms and susceptibility to Japanese encephalitis disease in the North Indian population.

Japanese encephalitis virus (JEV) is the major cause of viral encephalitis in many regions of Asia. Cytokines, including pro-inflammatory and anti-inflammatory are key regulators playing a detrimental role in the host response to JE infection, pathogenesis and disease outcome. Evidently, the host's cytokine response is genetically determined, representing the complexity of interindividual differences regarding immune response to viral infection. The current study assesses the association of single nucleotide polymorphisms of classical interleukin IL-1β and IL-10 with JEV susceptibility and disease severity in north Indian population. We performed a case-control study using 85 JE patients and 85 healthy controls. Polymorphisms in the IL-1β (-511 C/T) and IL-10 (-1082 A/G) genes were genotyped using PCR-RFLP. All continuous variables were expressed as mean±standard deviation, and categorical variables were expressed in percentage. The mRNA level of IL-1β and IL-10 were found significantly increased in JE patients. In severe JE patients, IL-1β mRNA level was significantly higher with heterozygous (C/T) and homozygous (C/C) genotype compared to wild (T/T) genotype and mRNA level of IL-10 was higher in heterozygous genotype (A/G) compared to wild genotype (A/A). The C/T and C/C genotypes of IL-1β were significantly associated with higher risk of JE infection (p<0.05, OR=7.25 and 4.40) whereas, the A/G genotype of IL-10 was associated with a reduced risk of JEV infection (p<0.05, OR=0.30). The C allele of IL-1β was associated with fever and neck stiffness (p<0.05) and CT genotype was associated with disease severity and worse outcomes in JE patients. Along with this, IL-10 polymorphism was found associated with fever, and AG genotype was found to be associated with worse disease outcomes such as neurological sequelae (p<0.05). Mutant allele and genotype at IL-1β (-511 C/T) and IL-10 (-1082 A/G) gene polymorphism show increased expression of IL-1β and IL-10 in JE patients which contribute to disease severity as well as adverse outcomes of disease. Overall this is the first report from northern India, which shows the association of IL-1β and IL-10 polymorphisms with JEV infection.

Association of Interleukin-10 Genotypes and Anticyclic Citrullinated Peptide Antibodies with Rheumatoid Arthritis.

Background: According to recent evidence, there is an association between some genetic factors and rheumatoid arthritis (RA). The aim of this study was to determine whether genetic variations in the interleukin 10 (IL10) and anti-cyclic citrullinated peptide (Anti-CCP) antibody loci were linked to RA. Methods: In this hospital-based case-control study with 224 cases and 194 healthy individuals, we investigated the association of IL-10 genotypes and anti-CCP antibodies with RA. Independent sample t, chi-square, and Fisher exact tests were used to assess the association between study variables. Results: Frequency of IL-10 -1082 A/G genotype in RA patients is significantly higher than the control group (odds ratio [OR], 1.67 [95% CI, 1.11-2.51]) (p=0.009), while the frequency of IL-10-1082 A/A and G/G polymorphisms in RA patients was lower than controls and this finding for G/G polymorphism was statistically significant (p=0.01). No significant difference was observed between the 2 studied groups regarding IL-10-592 C/C, C/A, and A/A polymorphisms (p>0.05). The chance of RA occurrence among persons with positive anti-CCP was significantly (63.3 times [22.7-176.5]) higher than individuals with negative anti-CCP (p<0.001). Conclusion: According to our data, the chance of anti-CCP positivity in persons who have IL-10 genotype 1082 A/G is higher. Further studies are recommended to determine the relationship between IL-10 genotype 1082 G/A and RA. If such a relationship is proven, this finding as a diagnostic clue can help rheumatologists in the early detection of RA.

IL-10 and TGF-β1 gene polymorphisms in Greek patients with recurrent aphthous stomatitis.

Background Recurrent aphthous stomatitis (RAS) is one of the most frequent inflammatory disorders of the oral mucosa. Cytokines, which play an important role in RAS pathogenesis, participate directly or indirectly in normal, immunological and inflammatory processes and are secreted from cells belonging to innate and adaptive immunity as a consequence of microbial and antigenic stimuli. Gene polymorphisms in specific cytokines may predispose to RAS development. The aim of this study was the investigation and association of IL-10 and TGF-β1 gene polymorphisms with RAS.Material and Methods Study’s cohort consisted of 60 Greek patients diagnosed with RAS, including 40 patients with minor, 10 patients with major and 10 with herpetiform aphthous ulcers. Forty age- and sex-matched control subjects were included in this study. DNA was extracted from whole blood samples of all patients and sequence-specific primers (SSP)-based polymerase chain reaction (PCR) was used for genotyping. Gene polymorphisms for cytokines IL-10 at loci -592 and -819 and for TGF-β1 at codon 10 were detected.Results Significant differences between patients with minor RAS and healthy controls were recorded for IL-10 genotypes distribution at position -592 (p=0.042) and -819 (p=0.045) with predominance of C/A and C/T genotypes in RAS patients, respectively. Also, in patients with minor and herpetiform aphthous ulcerations, heterozygous TGF-β1 genotype C/T at codon 10 was associated with increased risk of RAS (p=0.044 and p=0.020, respectively).Conclusions These data provide evidence that genetic predisposition for RAS and possibly its specific clinical variants is related with the presence of gene polymorphisms for specific cytokines, including IL-10 and TGF-β1, which, in turn, may vary according to geographic origin and genetic background. Key words:Recurrent aphthous stomatitis, aphthae, IL-10, TGF-β, gene polymorphisms, oral mucosa.

ITGA4, ITGB7, TNFα, IL10 genes polymorphisms in the ethnic Buryat patients with ulcerative colitis

Background: Worldwide studies of genetic material, polymorphisms and prognostic gene models for immune-associated disorders have established differences in trans-ethnic population cohorts, which determine phenotypic and other characteristics of the course of these diseases. Ulcerative colitis (UC) is a chronic immune inflammation of the colon mucosa. More than 100 gene polymorphisms associated with multiple integrated cross-talks have been discovered.Aim: To study the ITGA4, ITGB7, TNFα, IL10 genes polymorphisms in patients with ulcerative colitis belonging to the Buryat ethnic group and living in Irkutsk region, Buryat Republic and Transbaikal territory.Materials and methods: The study included a total of 49 subjects, 24 of them being UC patients and 25 healthy volunteers, compatible in gender, age and ethnic background. The molecular genetic analysis by real time polymerase chain reaction was performed with DNA samples from whole peripheral blood leucocytes.Results: The differences in the prevalence of the ITGA4(rs1143674, rs1449263), ITGB7(rs11574532), TNFα(rs1800629), and IL10(rs1800871) genotypes were non-significant (р&gt;0.05). The IL10(rs1800896) GG homozygote patients had higher odds ratio (OR) for UC compared to the carriers of other polymorphisms (OR 24; 95% confidence interval (CI) 2.783–206.969; р=0.001). The AA homozygote type was less frequent among UC patients compared to healthy volunteers (OR 0.17; 95% CI 0.049–0.589; р=0.004). The analysis of genotype frequency distribution of all studied genes including clinical characteristics of the disease showed no significant results (р&gt;0.05). The binary logistic regression analysis has shown that IL10(rs1800896)GG was an UC predictor with sensitivity of 96% and specificity of 50% (AUC 0.760; 95% CI 0.621–0.899; p=0.002; standard error 0.71).Conclusion: The GG genotype of IL10(rs1800896) is a UC predictor, whereas the AA genotype is significantly more prevalent among healthy subjects of the Buryat cohort.

Genetic studies of nephrotic syndrome in Egyptian children

Nephrotic syndrome (NS) might be caused by a kidney disorder or it can be a secondary disease. Untreated or resistant to treatment, NS stimulates glomerular damage that reduces the kidney function. This reduction leads to the end stage of renal failure. Therefore, it is very important to diagnose NS early, with the aim of inhibiting or lessening its associated morbidity and mortality. Gene polymorphism analysis for the three genes eNOS 27 bp VNTR, GSTP1 and IL-10(1082 G/A) were checked in 98 children with NS and 101 control subjects. eNOS 27 bp VNTR genotypes and alleles are significantly different in the group of 98 children with NS compared to the 101 control subjects. The frequencies of ab and bb genotypes are significantly lower in patients than in the control group (ab: 17.2% vs. 22.8%; OR: 0.19; 95% CI: 0.06-0.58; p = 0.0026 & bb: 54.7% vs. 70.3%; OR: 0.19; 95% CI: 0.07-0.5; p = 0.0004). However, neither GSTP1 nor IL-10(1082 G/A) genotypes showed any significant difference in both groups. eNOS 27 bp VNTR gene might be considered as an independent risk factor in the early prediction of nephrotic syndrome incidence, which may help prevent/reduce the occurrence of other complications associated with the late diagnosis and treatment of the disease.

A Low-Producing Haplotype of Interleukin-6 Disrupting CTCF Binding Is Protective against Severe COVID-19.

ABSTRACTInterleukin6 (IL-6) is a key driver of hyperinflammation in COVID-19, and its level strongly correlates with disease progression. To investigate whether variability in COVID-19 severity partially results from differential IL-6 expression, functional single-nucleotide polymorphisms (SNPs) of IL-6 were determined in Chinese COVID-19 patients with mild or severe illness. An Asian-common IL-6 haplotype defined by promoter SNP rs1800796 and intronic SNPs rs1524107 and rs2066992 correlated with COVID-19 severity. Homozygote carriers of C-T-T variant haplotype were at lower risk of developing severe symptoms (odds ratio, 0.256; 95% confidence interval, 0.088 to 0.739; P = 0.007). This protective haplotype was associated with lower levels of IL-6 and its antisense long noncoding RNA IL-6-AS1 by cis-expression quantitative trait loci analysis. The differences in expression resulted from the disturbance of stimulus-dependent bidirectional transcription of the IL-6/IL-6-AS1 locus by the polymorphisms. The protective rs2066992-T allele disrupted a conserved CTCF-binding locus at the enhancer elements of IL-6-AS1, which transcribed antisense to IL-6 and induces IL-6 expression in inflammatory responses. As a result, carriers of the protective allele had significantly reduced IL-6-AS1 expression and attenuated IL-6 induction in response to acute inflammatory stimuli and viral infection. Intriguingly, this low-producing variant that is endemic to present-day Asia was found in early humans who had inhabited mainland Asia since ∼40,000 years ago but not in other ancient humans, such as Neanderthals and Denisovans. The present study suggests that an individual's IL-6 genotype underlies COVID-19 outcome and may be used to guide IL-6 blockade therapy in Asian patients.

IL-6 597A/G (rs1800797) and 174G/C (rs1800795) Gene Polymorphisms in the Development of Cervical Cancer in Lithuanian Women.

Our study aimed to evaluate the distribution of genotypes and allele frequencies of IL-6 597A/G (rs1800797) and 174G/C (rs1800795) polymorphisms in HPV infected and uninfected healthy women and cervical cancer patients. A PCR based Multiplex HPV genotyping test kit was used for in vitro detection and differentiation of high risk HPV genotypes. Genotyping of two polymorphisms, IL-6 597A/G (rs1800797) and 174G/C (rs1800795), was performed using the KASP genotyping assay kit. Cervical cancer patients were more likely to be HPV positive than control patients. Allele C of IL-6 rs1800795 was associated with a higher risk of cervical cancer by 2.26-fold and genotype CC by 5.37-fold. Genotype CC of IL-6 rs1800795 was more frequent in the HPV positive group compared with the HPV negative group (p = 0.002). Allele G of IL-6 rs1800797 was more frequently found in women with HPV16/HPV18 compared to other HPV types (p = 0.045). Women with AA genotypes of IL-6 rs1800797 were less frequently infected with HPV16/HPV18 compared to other HPV types (p = 0.045). The major finding of the study is the significant association of C allele and CC genotype of IL-6 1800795 gene with cervical cancer in the Lithuanian population. Genotype CC of IL-6 rs1800795 has a significant association with HPV infection as well.

Analysis of propensity score matching between inflammatory factor levels and gene polymorphisms and susceptibility to obstructive sleep apnea

Objective:To explore the correlation between the levels of inflammatory factors and their gene polymorphisms and the susceptibility to obstructive sleep apnea（OSA）. Methods:Seventy-nine patients who were diagnosed with OSA in People's Hospital of Xinjiang Uygur Autonomous Region from October 2018 to December 2020 were selected as the study group, and 104 healthy adults who received physical examination during the same period were selected as the control group. After collecting the clinical data of the two groups of patients, the two groups of patients were matched by propensity scores. Then, the serum IL-6, IL-8 and TNF-α levels and the peripheral blood IL-6, IL-8 and TNF-α gene polymorphism analysis and comparison were performed on the included matched patients. Results:Before matching, the age, proportion of males, BMI, neck circumference, smoking history, SBP and DBP of the study group were higher than those of the control group, and the difference was statistically significant（P<0.05）. After the two groups of patients were matched by propensity scores, a total of 67 patients were successfully matched. The covariates between the two groups were all balanced after matching, and the balance of the PSM covariates was significantly improved（P>0.05）. After matching, the fasting blood glucose, C-reactive protein, IL-6, IL-8, TNF-α, AHI and Ts90% of the study group were significantly higher than those of the control group, and the difference was statistically significant（P<0.05）. Hardy-Weinberg balance verifies that the gene frequencies of each group are in accordance with the genetic balance rule（P>0.05）; after matching, the distribution of IL-6（rs1800795） and TNF-α（rs1800629） genotypes between the two groups is compared, and the difference is statistically significant scientific significance; the frequency of IL-6（rs1800795） allele C and the frequency of TNF-α（rs1800629） allele A in the study group were significantly higher than those in the control group, and the difference was statistically significant（P<0.05）. Conclusion:The levels of inflammatory factors TNF-α and IL-6 and their gene polymorphisms are significantly related to the susceptibility to OSA.

Investigation of the Relationship Between IL-18 (- 607 C/A), IL-18 (- 137 G/C), and MMP-2 (- 1306 C/T) Gene Variations and Serum Copper and Zinc Levels in Patients Diagnosed with Chronic Renal Failure.

The aim of this study is to investigate the relationship between IL-18 (- 607 C/A), IL-18 (- 137 G/C), and MMP-2 (- 1306 C/T) gene variations and serum trace element levels in patients diagnosed with CRF. Genotype distributions of IL-18 (- 607 C/A, - 137 G/C) gene variations were determined by polymerase chain reaction (PCR) method. PCR-restriction fragment length polymorphism (RFLP) methods were used to determine the MMP-2 (- 1306 C/T) gene variation genotype distributions. Serum trace element levels were determined by atomic absorption spectrophotometer method. A significant difference was found between the CRF patient and healthy control groups in terms of genotype distributions of IL-18 (- 607 C/A) and MMP-2 (- 1306 C/T) gene variations (p < 0.05). The significant difference was found between the patient and control groups in terms of serum copper and zinc levels and copper/zinc ratio (p < 0.05). The significant difference was detected between patient and control groups in terms of copper and zinc levels and copper/zinc ratio according to IL-18 (- 607 C/A), IL-18 (- 137 G/C), and MMP-2 (- 1306 C/T) gene variations and genotype distributions (p < 0.05). In addition, significant difference was determined in terms of serum copper and zinc levels and copper/zinc ratio according to haplotypes of IL-18 (- 607 C/A), IL-18 (- 137 G/C), and MMP-2 (- 1306 C/T) gene variations between patient and control groups (p < 0.05). In conclusion, evaluation of IL-18 (- 607 C/A, - 137 G/C) and MMP-2 (- 1306 C/T) gene variations and serum trace element levels together is extremely important in terms of obtaining important biomarkers in CRF early diagnosis and progression.

The impact of IL-10 and CYP3A5 gene polymorphisms on dose-adjusted trough blood tacrolimus concentrations in early post-renal transplant recipients.

The strong inter-individual pharmacokinetic variability and the narrow therapeutic window of tacrolimus (TAC) have hampered the clinical application. Gene polymorphisms play an important role in TAC pharmacokinetics. Here, we investigate the influence of genotypes of IL-10, CYP3A5, CYP2C8, and ABCB1 on dose-adjusted trough blood concentrations (the C0/D ratio) of TAC to reveal unclear genetic factors that may affect TAC dose requirements for renal transplant recipients. Genetic polymorphisms of IL-10, CYP3A5, CYP2C8, and ABCB1 in 188 renal transplant recipients were determined using Kompetitive Allele Specific PCR (KASP). Statistical analysis was applied to examine the effect of genetic variation on the TAC C0/D at 5, 10, 15, and 30days after transplantation. Recipients carrying the IL-10 -819C > T TT genotype showed a significantly higher TAC C0/D than those with the TC/CC genotype (p < 0.05). Additionally, the TAC C0/D values of recipients with the capacity for low IL-10 activity (-819 TT) engrafted with CYP3A5 non-expressers were higher compared to the intermediate/high activity of IL-10 -819C > T TC or CC carrying CYP3A5 expressers, and the difference was statistically significant at different time points (p < 0.05). Genetic polymorphisms of IL-10 -819C > T and CYP3A5 6986A > G influence the TAC C0/D, which may contribute to variation in TAC dose requirements during the early post-transplantation period. Detecting IL-10 -819C > T and CYP3A5 6986A > G polymorphisms may allow determination of individualized tacrolimus dosage regimens for renal transplant recipients during the early post-transplantation period.

Association of interleukin-4 polymorphism with diabetic retinopathy and neuropathy in a Sudanese population

BackgroundInterleukin-4 (IL-4) is a multifunctional cytokine; involved in the regulation of immune responses, as well as in the pathogenicity of many diseases, such as diabetes mellitus. Some researchers suggested that IL-4 protects the human pancreatic islet from cytotoxic damages, whereas others suggested some inhibitory actions of IL-4 on pancreatic islets. This study aimed to assess the role of IL-4 genotypes of intron 3 variable number of tandem repeats of the IL-4 gene in diabetic retinopathy and diabetic neuropathy in Sudanese patients with type 2 diabetes mellitus (T2DM). This case–control study was performed in a number of Khartoum state hospitals in Sudan. The study enrolled 181 Sudanese patients, 115 (57 females and 58 males) diagnosed with T2DM and 66 (29 females and 37 males) healthy persons who served as control subjects. Polymerase chain reaction was used for the analysis of IL-4, which was amplified using the following amplification sequence (forward primer: CACGACGTTGTAAAACGACTAGGCTGAAAGGGGGAAAGC; reverse primer: CTGTTCACCTCAACTGCTCC). Biochemical analyses for highly sensitive C- reactive protein (hs-CRP), glycated hemoglobin (HbA1c), fasting plasma glucose, total cholesterol, triglycerides, low-density lipoprotein, and high-density lipoprotein were performed using a chemical analyzer.ResultsThe study showed that in the diabetic group, 49(42.6%) had diabetic retinopathy, whereas 7(6.1%) had diabetic neuropathy. The B1B1 genotype was found to be a higher risk factor for developing diabetic retinopathy than B2B2 [P = 0.028; Odds ratio (OR) = 1.381; 95% confidence interval (CI) 1.344–9.062], whereas the B1B2 genotype was found to be insignificantly associated with retinopathy (P = 0.357; OR = 1.570; 95% CI 0.654–3.887). Furthermore, hs-CRP and HbA1c were significantly increased in diabetic neuropathy with IL-4 B1B1 genotype.ConclusionsIL-4 gene polymorphisms can be good markers for the early identification of risk for diabetic retinopathy and neuropathy in Sudanese people. The hs-CRP and HbA1c in diabetic patients with IL-4 B1B1 genotype may be predisposition predictors of diabetic neuropathy.

The relation between IL-10 gene (-1082G/A) and VEGF gene 936 C/T polymorphism and diabetic polyneuropathy in a cohort of Egyptian patients with type 2 diabetes

Background: Polymorphisms have been described to correlate with T2DM and its complications including diabetic polyneuropathy (DPN). The aim of this study was to investigate the relation between interleukin (IL)-10-1082 G/A and vascular endothelial growth factor (VEGF)-936 C/T polymorphism and DPN in type 2 diabetes mellitus (T2DM) patients. Methods: This cross-sectional study included 50 T2DM patients and 40 controls. Clinical and electrophysiological assessments for DPN, fasting blood glucose level (FBS) and glycosylated haemoglobin (Hb A1C) were recorded. VEGF-936 C/T polymorphism was carried out by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. Genotyping for IL-10 promotor gene (-1082 G/A) polymorphism was performed using Real-time PCR. Results: Sixty percent of patients had confirmed DPN, while none were considered normal. IL-10 (genotype -1082G/G) was statistically higher among controls compared to patients (p=0.008). VEGF-936-CT genotype was statistically higher among patients compared to controls (p=0.033), but there was no significant relation between IL-10-1082 G/A or VEGF-936 C/T polymorphism genotypes and DPN. IL-10 (genotype -1082A/G) had higher HbA1C levels (p=0.041) and a lower albumin/creatinine ratio, while IL-10 (genotype -1082G/G) had a higher albumin/creatinine ratio (p=0.024). DPN had a significant correlation with duration of diabetes, FBS and HbA1C. Conclusion: The VEGF-936 C/T genotype may be associated with T2DM, while the IL-10 (genotype -1082G/G) may be less likely to be associated with it; however there was no association between VEGF-936 or IL-10-1082 genotypes and DPN.

Association between IL-8 (-251T/A) and IL-6 (-174G/C) Polymorphisms and Oral Cancer Susceptibility: A Systematic Review and Meta-Analysis.

Background and objective: Inflammation and cell-mediated immunity can have significant roles in different stages of carcinogenesis. The present meta-analysis aimed to evaluate the association between the polymorphisms of IL-8 (-251T/A) and IL-6 (-174G/C) and the risk of oral cancer (OC). Methods: PubMed/MEDLINE, Web of Science, Cochrane Library, and Scopus databases were searched until December 18, 2020 without any restrictions. RevMan 5.3 software was used to calculate the results of forest plots (odds ratios (ORs) and 95% confidence intervals (CIs)); CMA 2.0 software was used to calculate funnel plots (Begg’s and Egger’s tests), and SPSS 22.0 was used for the meta-regression analysis. Moreover, trial sequential analysis was conducted to estimate the robustness of the results. Results: Eleven articles including twelve studies were selected for the meta-analysis. The pooled ORs for the association between IL-8 (-251T/A) polymorphism and the risk of OC in the models of A vs. T, AA vs. TT, TA vs. TT, AA + TA vs. TT, and AA vs. TT + TA were 0.97 (p = 0.78), 0.86 (p = 0.55), 0.78 (p = 0.37), 0.83 (p = 0.45), and 1.10 (p = 0.34), respectively. The pooled ORs IL-6 (-174G/C) polymorphism and the risk of OC in the models of C vs. G, CC vs. GG, GC vs. GG, CC + GC vs. GG, and CC vs. GG + GC were 1.07 (p = 0.87), 1.17 (p = 0.82), 1.44 (p = 0.38), 1.28 (p = 0.61), and 0.96 (p = 0.93), respectively. There was no association between IL-8 (-251T/A) polymorphism and OC susceptibility, but the C allele and GC and CC genotypes of IL-6 (-174G/C) polymorphism were associated with the risk of OC based on subgroup analyses, that is to say, the source of control and the genotyping method might bias the pattern of association. Conclusions: The meta-analysis confirmed that there was no association between the polymorphisms of IL-6 (-174G/C) and IL-8 (-251T/A) and the susceptibility of OC. However, the source of control and the genotyping method could unfavorably impact on the association between the polymorphisms of IL-6 (-174G/C) and the risk OC.