Oryza Sativa Genome Research Articles

Genome‐wide study of OsWRKY gene in Oryza sativa subsp. japonica

AbstractWRKY transcription factor (TF) family is well known to govern essential physiological functioning as well as regulate plant response to biotic and abiotic stress. In this study, we have identified 108 OsWRKY genes in the genome of Oryza sativa subsp. japonica, using the updated genomic data from the Rice Annotation Project Database and Oryzabase, which were further used to conduct the phylogenetic study, motif analysis, gene structure analysis, chromosomal mapping, and prediction of sub‐cellular localization. The multiple sequence alignment OsWRKY proteins revealed the presence of nine different types of alterations in the conserved heptapeptide sequence WRKYGQK associated with 19 OsWRKY genes. Physiochemical analysis discloses the hydrophobic amino acid‐rich, thermally stable, and polar nature of OsWRKY proteins. These genes were noted as highly conserved between the two cultivated sub‐species of Oryza sativa, that is Indica and japonica type. Additionally, from motif analysis, we have found a new motif, which was categorized as hAT family C‐terminal dimerization region associated with four members of group IIc. We have identified 21 stress‐responsive OsWRKY genes, and their significance to the different biotic and abiotic stress‐mediated cascades was further evaluated by analysing 1500 kb upstream sequences and this disclosed the presence of important phytohormone‐responsive cis‐elements in the OsWRKY gene, suggesting its direct involvement in defence against a wide range of external stressors and these 21 OsWRKY genes are tentatively listed as possible candidates for more study.

Differences in transcription initiation directionality underlie distinctions between plants and animals in chromatin modification patterns at genes and cis-regulatory elements.

Transcriptional initiation is among the first regulated steps controlling eukaryotic gene expression. High-throughput profiling of fungal and animal genomes has revealed that RNA Polymerase II often initiates transcription in both directions at the promoter transcription start site, but generally only elongates productively into the gene body. Additionally, Pol II can initiate transcription in both directions at cis-regulatory elements such as enhancers. These bidirectional RNA Polymerase II initiation events can be observed directly with methods that capture nascent transcripts, and they are also revealed indirectly by the presence of transcription-associated histone modifications on both sides of the transcription start site or cis-regulatory elements. Previous studies have shown that nascent RNAs and transcription-associated histone modifications in the model plant Arabidopsis thaliana accumulate mainly in the gene body, suggesting that transcription does not initiate widely in the upstream direction from genes in this plant. We compared transcription-associated histone modifications and nascent transcripts at both transcription start sites and cis-regulatory elements in A. thaliana, Drosophila melanogaster, and Homo sapiens. Our results provide evidence for mostly unidirectional RNA Polymerase II initiation at both promoters and gene-proximal cis-regulatory elements of A. thaliana, whereas bidirectional transcription initiation is observed widely at promoters in both D. melanogaster and H. sapiens, as well as cis-regulatory elements in Drosophila. Furthermore, the distribution of transcription-associated histone modifications around transcription start sites in the Oryza sativa (rice) and Glycine max (soybean) genomes suggests that unidirectional transcription initiation is the norm in these genomes as well. These results suggest that there are fundamental differences in transcriptional initiation directionality between flowering plant and metazoan genomes, which are manifested as distinct patterns of chromatin modifications around RNA polymerase initiation sites.

Genome-wide expansion and reorganization during grass evolution: from 30 Mb chromosomes in rice and Brachypodium to 550 Mb in Avena

BackgroundThe BOP (Bambusoideae, Oryzoideae, and Pooideae) clade of the Poaceae has a common ancestor, with similarities to the genomes of rice, Oryza sativa (2n = 24; genome size 389 Mb) and Brachypodium, Brachypodium distachyon (2n = 10; 271 Mb). We exploit chromosome-scale genome assemblies to show the nature of genomic expansion, structural variation, and chromosomal rearrangements from rice and Brachypodium, to diploids in the tribe Aveneae (e.g., Avena longiglumis, 2n = 2x = 14; 3,961 Mb assembled to 3,850 Mb in chromosomes).ResultsMost of the Avena chromosome arms show relatively uniform expansion over the 10-fold to 15-fold genome-size increase. Apart from non-coding sequence diversification and accumulation around the centromeres, blocks of genes are not interspersed with blocks of repeats, even in subterminal regions. As in the tribe Triticeae, blocks of conserved synteny are seen between the analyzed species with chromosome fusion, fission, and nesting (insertion) events showing deep evolutionary conservation of chromosome structure during genomic expansion. Unexpectedly, the terminal gene-rich chromosomal segments (representing about 50 Mb) show translocations between chromosomes during speciation, with homogenization of genome-specific repetitive elements within the tribe Aveneae. Newly-formed intergenomic translocations of similar extent are found in the hexaploid A. sativa.ConclusionsThe study provides insight into evolutionary mechanisms and speciation in the BOP clade, which is valuable for measurement of biodiversity, development of a clade-wide pangenome, and exploitation of genomic diversity through breeding programs in Poaceae.

The seven rice vacuolar sorting receptors localize to prevacuolar compartments

Vacuolar sorting is critically important in plants as it regulates the mobilization of proteins and plays a major role in important agricultural traits like yield and seed protein content. Vacuolar sorting receptors (VSRs) are integral membrane proteins that mediate protein trafficking from the Golgi apparatus to the vacuole via the intermediate membrane-bound prevacuolar compartment (PVC)/multivesicular body (MVB). VSR proteins, such as an 80 kD (BP-80) from pea, also serve as markers for PVC/MVB. Dissecting VSR-mediated protein trafficking pathways may provide ways to enhance agronomic traits and crop yield. Green fluorescence protein (GFP) fusions with the seven Arabidopsis (Arabidopsis thaliana) VSRs were previously shown to localize to PVCs in transgenic tobacco BY-2 cells. The Rice (Oryza sativa) genome contains seven VSRs (OsVSR1-7), but little is known about their subcellular localizations. Here we studied the subcellular localization of OsVSR1-7 b y using a reporter approach, in which GFP-OsVSR1-7 fusions containing the transmembrane domain (TMD) and cytoplasmic tail (CT) of individual OsVSR were expressed in the protoplasts of rice, transgenic tobacco BY-2 cells and transgenic rice plants. Immunofluorescent labelling studies and confocal laser scanning microscope observation demonstrated that the seven OsVSRs are localized to PVCs and form ring-like structures upon wortmannin treatment. Therefore, we have verified the subcellular localization of OsVSR1-7 in this study. The OsVSRs tagged with GFP can serve as PVCs/MVBs markers in rice for the future studies.

Linking New Alleles at the Oscillator Loci to Flowering and Expansion of Asian Rice.

The central oscillator is believed to be the key mechanism by which plants adapt to new environments. However, impacts from hybridization, the natural environment, and human selection have rarely been assessed on the oscillator of a crop. Here, from clearly identified alleles at oscillator loci (OsCCA1/LHY, OsPRR95, OsPRR37, OsPRR59, and OsPRR1) in ten diverse genomes of Oryza sativa, additional accessions, and functional analysis, we show that rice's oscillator was rebuilt primarily by new alleles from recombining parental sequences and subsequent 5' or/and coding mutations. New alleles may exhibit altered transcript levels from that of a parental allele and are transcribed variably among genetic backgrounds and natural environments in RIL lines. Plants carrying more expressed OsCCA1_a and less transcribed OsPRR1_e flower early in the paddy field. 5' mutations are instrumental in varied transcription, as shown by EMSA tests on one deletion at the 5' region of highly transcribed OsPRR1_a. Compared to relatively balanced mutations at oscillator loci of Arabidopsis thaliana, 5' mutations of OsPRR37 (and OsCCA1 to a less degree) were under negative selection while those of OsPRR1 alleles were under strong positive selection. Together, range expansion of Asian rice can be elucidated by human selection on OsPRR1 alleles via local flowering time-yield relationships.

In Silico Verification of Predicted Potential Promoter Sequences in the Rice (Oryza sativa) Genome.

The exact identification of promoter sequences remains a serious problem in computational biology, as the promoter prediction algorithms under development continue to produce false-positive results. Therefore, to fully assess the validity of predicted sequences, it is necessary to perform a comprehensive test of their properties, such as the presence of downstream transcribed DNA regions behind them, or chromatin accessibility for transcription factor binding. In this paper, we examined the promoter sequences of chromosome 1 of the rice Oryza sativa genome from the Database of Potential Promoter Sequences predicted using a mathematical algorithm based on the derivation and calculation of statistically significant promoter classes. In this paper TATA motifs and cis-regulatory elements were identified in the predicted promoter sequences. We also verified the presence of potential transcription start sites near the predicted promoters by analyzing CAGE-seq data. We searched for unannotated transcripts behind the predicted sequences by de novo assembling transcripts from RNA-seq data. We also examined chromatin accessibility in the region of the predicted promoters by analyzing ATAC-seq data. As a result of this work, we identified the predicted sequences that are most likely to be promoters for further experimental validation in an in vivo or in vitro system.

First report of Mal de Rio Cuarto Virus and a picorna-like virus naturally infecting rice (Oryza sativa) in Argentina.

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

QuarTeT: a telomere-to-telomere toolkit for gap-free genome assembly and centromeric repeat identification.

A high-quality genome is the basis for studies on functional, evolutionary, and comparative genomics. The majority of attention has been paid to the solution of complex chromosome structures and highly repetitive sequences, along with the emergence of a new 'telomere-to-telomere (T2T) assembly' era. However, the bioinformatic tools for the automatic construction and/or characterization of T2T genome are limited. Here, we developed a user-friendly web toolkit, quarTeT, which currently includes four modules: AssemblyMapper, GapFiller, TeloExplorer, and CentroMiner. First, AssemblyMapper is designed to assemble phased contigs into the chromosome-level genome by referring to a closely related genome. Then, GapFiller would endeavor to fill all unclosed gaps in a given genome with the aid of additional ultra-long sequences. Finally, TeloExplorer and CentroMiner are applied to identify candidate telomere and centromere as well as their localizations on each chromosome. These four modules can be used alone or in combination with each other for T2T genome assembly and characterization. As a case study, by adopting the entire modular functions of quarTeT, we have achieved the Actinidia chinensis genome assembly that is of a quality comparable to the reported genome Hongyang v4.0, which was assembled with the addition of manual handling. Further evaluation of CentroMiner by searching centromeres in Arabidopsis thaliana and Oryza sativa genomes showed that quarTeT is capable of identifying all the centromeric regions that have been previously detected by experimental methods. Collectively, quarTeT is an efficient toolkit for studies of large-scale T2T genomes and can be accessed at http://www.atcgn.com:8080/quarTeT/home.html without registration.

Functional characterization of the three Oryza sativa SPX-MFS proteins in maintaining phosphate homoeostasis.

Plant vacuoles serve as the primary intracellular compartments for phosphorus (P) storage. The Oryza sativa genome contains three genes that encode SPX ( SYG1/ PHO81/ XPR1)-MFS ( Major Facility Superfamily) proteins (OsSPX-MFS1-3). The physiological roles of the three transporters under varying P conditions in laboratory and field are not known. To address this knowledge gap, we generated single, doubleand triple mutants for three OsSPX-MFS genes. All the mutants except Osspx-mfs2 display lower vacuolar Pi concentrations and OsSPX-MFSs overexpression plant display higher Pi accumulation, demonstrating that all OsSPX-MFSs are vacuolar Pi influx transporters. OsSPX-MFS3 plays the dominant role based on the phenotypes of single mutants in terms of growth, vacuolar and tissue Pi concentrations. OsSPX-MFS2 is the weakest and only functions as vacuole Pi sequestration in an Osspx-mfs1/3 background. The vacuolar Pi sequestration capacity was severely impaired in Osspx-mfs1/3 and Osspx-mfs1/2/3, which resulted in increased Pi allocation to aerial organs. High P in the panicle impaired panicle and fertility in Osspx-mfs1/3 and Osspx-mfs1/2/3. Osspx-mfs2 resulted in a more stable yield compared to the wild type under low P in field grown plants. The results suggest that alteration of vacuolar Pi sequestration may be a novel effective strategy to improve rice tolerance to low phosphorus in cropping systems.

The complete chloroplast genome of japonica type weedy rice (Oryza sativa f. spontanea)

As a noxious weed, weedy rice (Oryza sativa f. spontanea Roshev. 1931) has threatened global food security and sustainable crop production. On the other hand, weedy rice has a strong tolerance for abiotic stresses and the potential to provide rich resources for rice genetic improvement. Thus, for a more comprehensive understanding of its speciation, we sequenced and assembled the first complete chloroplast genome of Oryza sativa f. spontanea (japonica type). The complete chloroplast genome was 134,555 bp in length and encoded 133 genes, including 83 protein-coding genes, 42 tRNA genes and 8 rRNA genes. Phylogenetic analysis revealed that the indica-japonica differentiation of weedy rice was closely related to cultivated rice, and Oryza sativa f. spontanea (japonica type) was genetically more closely clustered with cultivated rice O. sativa (japonica type) than O. nivara or other wild rice.

From design to validation of CRISPR/gRNA primers towards genome editing.

CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 (CRISPR-associated system) is used to edit specific genomic sequences with precision and efficacy. There are many online platforms/software for the design of gRNAs and related primers. However, there are concerns in design regarding off-site deletions besides knocking out sequences in the target genes. Nonetheless, a well known robust platform for CRISPR/gRNA primers design is CRISPRdirect. We demonstrate the use of this tool in the design of CRISPR/gRNA primers for soluble starch synthases (SSS) II-1, 2, and 3 genes in the Oryza sativa genome followed by the PCR-mediated amplification of SSS genes with corresponding confirmation towards genome editing having improved phenotype features.

Whole-Genome Sequencing of KMR3 and Oryza rufipogon-Derived Introgression Line IL50-13 (Chinsurah Nona 2/Gosaba 6) Identifies Candidate Genes for High Yield and Salinity Tolerance in Rice.

The genomes of an elite rice restorer line KMR3 (salinity-sensitive) and its salinity-tolerant introgression line IL50-13, a popular variety of coastal West Bengal, India, were sequenced. High-quality paired-end reads were obtained for KMR3 (147.6 million) and IL50-13 (131.4 million) with a sequencing coverage of 30X-39X. Scaffolds generated from the pre-assembled contigs of each sequenced genome were mapped separately onto the reference genome of Oryza sativa ssp. japonica cultivar Nipponbare to identify genomic variants in terms of SNPs and InDels. The SNPs and InDels identified for KMR3 and IL50-13 were then compared with each other to identify polymorphic SNPs and InDels unique and common to both the genomes. Functional enrichment analysis of the protein-coding genes with unique InDels identified GO terms involved in protein modification, ubiquitination, deubiquitination, peroxidase activity, and antioxidant activity in IL50-13. Linoleic acid metabolism, circadian rhythm, and alpha-linolenic acid metabolism pathways were enriched in IL50-13. These GO terms and pathways are involved in reducing oxidative damage, thus suggesting their role in stress responses. Sequence analysis of QTL markers or genes known to be associated with grain yield and salinity tolerance showed polymorphism in 20 genes, out of which nine were not previously reported. These candidate genes encoded Nucleotide-binding adaptor shared by APAF-1, R proteins, and CED-4 (NB-ARC) domain-containing protein, cyclase, receptor-like kinase, topoisomerase II-associated protein PAT1 domain-containing protein, ion channel regulatory protein, UNC-93 domain-containing protein, subunit A of the heteromeric ATP-citrate lyase, and three conserved hypothetical genes. Polymorphism was observed in the coding, intron, and untranslated regions of the genes on chromosomes 1, 2, 4, 7, 11, and 12. Genes showing polymorphism between the two genomes were considered as sequence-based new candidates derived from Oryza rufipogon for conferring high yield and salinity tolerance in IL50-13 for further functional studies.

Genome-wide survey of the GATA gene family in camptothecin-producing plant Ophiorrhiza pumila

BackgroundOphiorrhiza pumila (Rubiaceae) is capable of producing camptothecin (CPT), one monoterpene indole alkaloid extensively employed in the treatment of multiple cancers. Transcription factors (TFs) GATA are a group of transcription regulators involved in plant development and metabolism, and show the feature of binding to the GATA motif within the promoters of target genes. However, GATA TFs have not been characterized in O. pumila.ResultIn this study, a total of 18 GATA genes classified into four subfamilies were identified, which randomly distributed on 11 chromosomes of O. pumila. Synteny analysis of GATA genes between O. pumila and other plant species such as Arabidopsis thaliana, Oryza sativa, Glycine max, Solanum lycopersicum, Vitis vinifera, and Catharanthus roseus genomes were analyzed. Tissue expression pattern revealed that OpGATA1 and OpGATA18 were found to be correlated with ASA, MK, CPR and GPPS, which were highly expressed in leaves. OpGATA7, showed high expression in roots as most of the CPT biosynthetic pathway genes did, suggesting that these OpGATAs may be potential candidates regulating CPT biosynthesis in O. pumila.ConclusionsIn this study, we systematically analyzed the OpGATA TFs, and provided insights into the involvement of OpGATA TFs from O. pumila in CPT biosynthesis.

Characterization of Microsatellites in the Akebia trifoliata Genome and Their Transferability and Development of a Whole Set of Effective, Polymorphic, and Physically Mapped Simple Sequence Repeat Markers.

Akebia trifoliata is a perennial climbing woody liana plant with a high potential for commercial exploitation and theoretical research. Similarly, microsatellites (simple sequence repeats, SSRs) also have dual roles: as critical markers and as essential elements of the eukaryotic genome. To characterize the profile of SSRs and develop molecular markers, the high-quality assembled genome of A. trifoliata was used. Additionally, to determine the potential transferability of SSR loci, the genomes of Amborella trichopoda, Oryza sativa, Vitis vinifera, Arabidopsis thaliana, Papaver somniferum, and Aquilegia coerulea were also used. We identified 434,293 SSRs with abundant short repeats, such as 290,868 (66.98%) single-nucleotide repeats (SNRs) and 113,299 (26.09%) dinucleotide repeats (DNRs) in the A. trifoliata genome. 398,728 (91.81%) SSRs on 344,283 loci were physically mapped on the chromosomes, and a positive correlation (r = 0.98) was found between the number of SSRs and chromosomal length. Additionally, 342,916 (99.60%) potential SSR markers could be designed from the 344,283 physically mapped loci, while only 36,160 could be viewed as high-polymorphism-potential (HPP) markers, findings that were validated by PCR. Finally, SSR loci exhibited broad potential transferability, particularly DNRs such as the “AT/AT” and “AG/CT” loci, among all angiosperms, a finding that was not related to the genetic divergence distance. Practically, we developed a whole set of effective, polymorphic, and physically anchored molecular markers and found that, evolutionarily, DNRs could be responsible for microsatellite origin and protecting gene function.

Genome‑wide identification of CAMTA gene family members in rice (Oryza sativa L.) and in silico study on their versatility in respect to gene expression and promoter structure

The calmodulin-binding transcription activator (CAMTA) is a family of transcriptional factors containing a cluster of calmodulin-binding proteins that can activate gene regulation in response to stresses. The presence of this family of genes has been reported earlier, though, the comprehensive analyses of rice CAMTA (OsCAMTA) genes, their promoter regions, and the proteins were not deliberated till date. The present report revealed the existence of seven CAMTA genes along with their alternate transcripts in five chromosomes of rice (Oryza sativa) genome. Phylogenetic trees classified seven CAMTA genes into three clades indicating the evolutionary conservation in gene structure and their association with other plant species. The in silico study was carried out considering 2 kilobases (kb) promoter regions of seven OsCAMTA genes regarding the distribution of transcription factor binding sites (TFbs) of major and plant-specific transcription factors whereas OsCAMTA7a was identified with highest number of TFbs, while OsCAMTA4 had the lowest. Comparative modelling, i.e., homology modelling, and molecular docking of the CAMTA proteins contributed the thoughtful comprehension of protein 3D structures and protein-protein interaction with probable partners. Gene ontology annotation identified the involvement of the proteins in biological processes, molecular functions, and localization in cellular components. Differential gene expression study gave an insight on functional multiplicity to showcase OsCAMTA3b as most upregulated stress-responsive gene. Summarization of the present findings can be interpreted that OsCAMTA gene duplication, variation in TFbs available in the promoters, and interactions of OsCAMTA proteins with their binding partners might be linked to tolerance against multiple biotic and abiotic cues.

FRAGILE CULM 18 encodes a UDP-glucuronic acid decarboxylase required for xylan biosynthesis and plant growth in rice.

Although UDP-glucuronic acid decarboxylases (UXSs) have been well studied with regard to catalysing the conversion of UDP-glucuronic acid into UDP-xylose, their biological roles in grasses remain largely unknown. The rice (Oryza sativa) genome contains six UXSs, but none of them has been genetically characterized. Here, we reported on the characterization of a novel rice fragile culm mutant, fc18, which exhibited brittleness with altered cell wall and pleiotropic defects in growth. Map-based cloning and transgenic analyses revealed that the FC18 gene encodes a cytosol-localized OsUXS3 and is widely expressed with higher expression in xylan-rich tissues. Monosaccharide analysis showed that the xylose level was decreased in fc18, and cell wall fraction determinations confirmed that the xylan content in fc18 was lower, suggesting that UDP-xylose from FC18 participates in xylan biosynthesis. Moreover, the fc18 mutant displayed defective cellulose properties, which led to an enhancement in biomass saccharification. Furthermore, expression of genes involved in sugar metabolism and phytohormone signal transduction was largely altered in fc18. Consistent with this, the fc18 mutant exhibited significantly reduced free auxin (indole-3-acetic acid) content and lower expression levels of PIN family genes compared with wild type. Our work reveals the physiological roles of FC18/UXS3 in xylan biosynthesis, cellulose deposition, and plant growth in rice.

Molecular Characterization Revealed the Role of Thaumatin-Like Proteins of Bread Wheat in Stress Response.

Thaumatin-like proteins (TLPs) are related to pathogenesis-related-5 (PR-5) family and involved in stress response. Herein, a total of 93 TLP genes were identified in the genome of Triticum aestivum. Further, we identified 26, 27, 39, and 37 TLP genes in the Brachypodium distachyon, Oryza sativa, Sorghum bicolor, and Zea mays genomes for comparative characterization, respectively. They could be grouped into small and long TLPs with conserved thaumatin signature motif. Tightly clustered genes exhibited conserved gene and protein structure. The physicochemical analyses suggested significant differences between small and long TLPs. Evolutionary analyses suggested the role of duplication events and purifying selection in the expansion of the TLP gene family. Expression analyses revealed the possible roles of TLPs in plant development and abiotic and fungal stress response. Recombinant expression of TaTLP2-B in Saccharomyces cerevisiae provided significant tolerance against cold, heat, osmotic, and salt stresses. The results depicted the importance of TLPs in cereal crops that would be highly useful in future crop improvement programs.

Rice RS2-9, which is bound by transcription factor OSH1, blocks enhancer-promoter interactions in plants.

SUMMARYInsulators characterized in Drosophila and mammals have been shown to play a key role in the restriction of promiscuous enhancer–promoter interactions, as well as reshaping the topological landscape of chromosomes. Yet the role of insulators in plants remains poorly understood, in large part because of a lack of well‐characterized insulators and binding factor(s). In this study, we isolated a 1.2‐kb RS2‐9 insulator from the Oryza sativa (rice) genome that can, when interposed between an enhancer and promoter, efficiently block the activation function of both constitutive and floral organ‐specific enhancers in transgenic Arabidopsis and Nicotiana tabacum (tobacco). In the rice genome, the genes flanking RS2‐9 exhibit an absence of mutual transcriptional interactions, as well as a lack of histone modification spread. We further determined that O. sativa Homeobox 1 (OSH1) bound two regions of RS2‐9, as well as over 50 000 additional sites in the rice genome, the majority of which resided in intergenic regions. Mutation of one of the two OSH1‐binding sites in RS2‐9 impaired insulation activity by up to 60%, whereas the mutation of both binding sites virtually abolished insulator function. We also demonstrated that OSH1 binding sites were associated with 72% of the boundaries of topologically associated domains (TADs) identified in the rice genome, which is comparable to the 77% of TAD boundaries bound by the insulator CCCTC‐binding factor (CTCF) in mammals. Taken together, our findings indicate that OSH1‐RS2‐9 acts as a true insulator in plants, and highlight a potential role for OSH1 in gene insulation and topological organization in plant genomes.

TRAF proteins as key regulators of plant development and stress responses.

Tumor necrosis factor receptor-associated factor (TRAF) proteins are conserved in higher eukaryotes and play key roles in transducing cellular signals across different organelles. They are characterized by their C-terminal region (TRAF-C domain) containing seven to eight anti-parallel β-sheets, also known as the meprin and TRAF-C homology (MATH) domain. Over the past few decades, significant progress has been made toward understanding the diverse roles of TRAF proteins in mammals and plants. Compared to other eukaryotic species, the Arabidopsis thaliana and rice (Oryza sativa) genomes encode many more TRAF/MATH domain-containing proteins; these plant proteins cluster into five classes: TRAF/MATH-only, MATH-BPM, MATH-UBP (ubiquitin protease), Seven in absentia (SINA), and MATH-Filament and MATH-PEARLI-4 proteins, suggesting parallel evolution of TRAF proteins in plants. Increasing evidence now indicates that plant TRAF proteins form central signaling networks essential for multiple biological processes, such as vegetative and reproductive development, autophagosome formation, plant immunity, symbiosis, phytohormone signaling, and abiotic stress responses. Here, we summarize recent advances and highlight future prospects for understanding on the molecular mechanisms by which TRAF proteins act in plant development and stress responses.

Complete chloroplast genome of Oryza sativa L. (B810s) and its phylogenetic analysis

The complete chloroplast (cp) genome of Oryza sativa L.(B810S) was 134546 bp in length in the study, which contains 149 genes including 99 coding protein genes, 41 transfer RNA genes, 8 ribosomal RNA genes and 1 non-coding region by gene annotation. A total of 20879 amino acids were encoded by this cp genome, TTT (Phe) and TTG (Leu) codon were the most frequent amino acids, whereas the ACC (Thr), GCC (Ala), CTC (Leu), and AAC (Asn) codon were the least frequent ones. The content of the four bases on the cp genome were 30.6% for A, 30.4% for T, 19.4% for C and 19.6% for G, respectively. Obviously, the A+T (61.0%) content is more higher than G+C (39.0%). The gene order and content are the same as those of previously reported cp genome of Rice. Phylogenetic analysis was implemented based on concatenated amino acid sequences of 99 protein-coding genes using Neighbor-Joining method (NJ) method. Therefore, the complete B810S cp genome provides interesting insights and valuable information that can be used to identify related species and reconstruct its phylogeny. Bangladesh J. Bot. 50(3): 895-901, 2021 (September) Special