Genomic Fragments Research Articles

Molecular-based characterization and bioengineering of Sorghum bicolor to enhance iron deficiency tolerance in iron-limiting calcareous soils.

Plant biomass can significantly contribute to alternative energy sources. Sorghum bicolor is a promising plant for producing energy, but is susceptible to iron deficiency, which inhibits its cultivation in iron-limiting calcareous soils. The molecular basis for the susceptibility of sorghum to iron deficiency remains unclear. Here, we explored the sorghum genome to identify genes involved in iron uptake and translocation. Iron deficiency-responsive gene expression was comparable to that in other graminaceous plants. A nicotianamine synthase gene, SbNAS1, was induced in response to iron deficiency, and SbNAS1 showed enzyme activity. Sorghum secreted 2'-deoxymugineic acid and other phytosiderophores under iron deficiency, but their levels were relatively low. Intercropping of sorghum with barley or rice rescued iron deficiency symptoms of sorghum. To produce bioengineered sorghum with enhanced tolerance to iron deficiency, we introduced four cassettes into sorghum: 35S promoter-OsIRO2 for activation of iron acquisition-related gene expression, SbIRT1 promoter-Refre1/372 for enhanced ferric-chelate reductase activity, and barley IDS3, and HvNAS1 genomic fragments for enhanced production of phytosiderophores and nicotianamine. The resultant single sorghum line exhibited enhanced secretion of phytosiderophores, increased ferric-chelate reductase activity, and improved iron uptake and leaf greenness compared with non-transformants under iron-limiting conditions. Similar traits were also conferred to rice by introducing the four cassettes. Moreover, these rice lines showed similar or better tolerance in calcareous soils and increased grain iron accumulation compared with previous rice lines carrying two or three comparable cassettes. These results provide a molecular basis for the bioengineering of sorghum tolerant of low iron availability in calcareous soils.

Interpreting the complexities of the plastid genome in dinoflagellates: a mini-review of recent advances.

Photosynthetic dinoflagellates play crucial roles in global primary production and carbon fixation. Despite their success in filling various ecological niches, numerous mysteries about their plastid evolution and plastid genomes remain unsolved. The plastid genome of dinoflagellates presents one of the most complex lineages in the biological realm, mainly due to multiple endosymbiotic plastid events in their evolutionary history. Peridinin-containing dinoflagellates possess the most reduced and fragmented genome, with only a few genes located on multiple "minicircles", whereas replacement plastids in dinoflagellate lineages have undergone different degrees of endosymbiotic gene transfer. Recent advancements in high-throughput sequencing have improved our understanding of plastid genomes and plastid-encoded gene expression in many dinoflagellate species. Plastid transcripts of dinoflagellates exhibit two unconventional processing pathways: the addition of a 3' poly(U) tail and substitutional RNA editing. These pathways are widely employed across dinoflagellate lineages, which are possibly retained from the ancestral peridinin plastid. This mini-review summarizes the developments in the plastid genomes of dinoflagellates and pinpoints the research areas that necessitate further exploration, aiming to provide valuable insights into plastid evolution in these fascinating and important organisms.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

CRISPR-Cas9/Cas12a systems for efficient genome editing and large genomic fragment deletions in Aspergillus niger.

CRISPR technology has revolutionized fungal genetic engineering by accelerating the pace and expanding the feasible scope of experiments in this field. Among various CRISPR-Cas systems, Cas9 and Cas12a are widely used in genetic and metabolic engineering. In filamentous fungi, both Cas9 and Cas12a have been utilized as CRISPR nucleases. In this work we first compared efficacies and types of genetic edits for CRISPR-Cas9 and -Cas12a systems at the polyketide synthase (albA) gene locus in Aspergillus niger. By employing a tRNA-based gRNA polycistronic cassette, both Cas9 and Cas12a have demonstrated equally remarkable editing efficacy. Cas12a showed potential superiority over Cas9 protein when one gRNA was used for targeting, achieving an editing efficiency of 86.5% compared to 31.7% for Cas9. Moreover, when employing two gRNAs for targeting, both systems achieved up to 100% editing efficiency for single gene editing. In addition, the CRISPR-Cas9 system has been reported to induce large genomic deletions in various species. However, its use for engineering large chromosomal segments deletions in filamentous fungi still requires optimization. Here, we engineered Cas9 and -Cas12a-induced large genomic fragment deletions by targeting various genomic regions of A. niger ranging from 3.5kb to 40kb. Our findings demonstrate that targeted engineering of large chromosomal segments can be achieved, with deletions of up to 69.1% efficiency. Furthermore, by targeting a secondary metabolite gene cluster, we show that fragments over 100kb can be efficiently and specifically deleted using the CRISPR-Cas9 or -Cas12a system. Overall, in this paper, we present an efficient multi-gRNA genome editing system utilizing Cas9 or Cas12a that enables highly efficient targeted editing of genes and large chromosomal regions in A. niger.

First Report of Rhizopus arrhizusi causing rot of Dictyophora rubrovolvata in China.

Dictyophora rubrovolvata, as an edible fungus with high medicinal value, is widely cultivated in several provinces in China (Hang et al. 2012). However, between December 2023 and March 2024, a rot disease occurred in the main production area in Fengxian District, Shanghai, China (N30°93', E121°49'). The disease incidence was 25% in the affected 1.33-ha growing area. High temperatures (>25℃) and poor ventilation provide favorable conditions for the spread of this disease. The disease mainly occurs at the stage of fruiting bodies formation of D. rubrovolvata. When the epidermis is damaged and broken, it becomes infested with mold, which then produces a layer of moldy rot with pus. The infected D. rubrovolvata tissues at the edge of the lesions were isolated, surface sterilized and cultured on potato dextrose agar (PDA) at 30 ℃ under dark conditions. Pure cultures were obtained by single-spore isolation. After 3 days, isolates were transferred to Czapek Yeast agar (CYA) (Samson et al, 2014). On CYA, the fungal colony consisted of white flocculent hyphae. Scanning electron microscopy analysis showed that the mycelium was white, and the internodes of the stolons formed characteristic pseudoroots, from which upwardly clustered erect, unbranched sporocarp peduncles expanded apically to form rounded sporocarp sacs, within which sporocarp spores were produced. (Hariprasath P, 2019). To confirm the identity of the pathogen, the genomic fragments for the internal transcribed spacer (ITS) and intergenic spacer (IGS) gene of the isolate were amplified by PCR (White et al. 1990; Liu XY. 2008). The resulting sequence was deposited in GenBank with accession PP951880 and PQ001670, respectively. PCR results and morphological observations indicated the isolated strain was a pure culture and the strain was designated as DIC01. Comparative results showed that the sequences with accession numbers MT603964.1 and DQ990323.1 showed high homology of 99.15% and 98.96% to the ITS and IGS sequences of Rhizopus arrhizusi DIC01, respectively. Phylogenetic analysis with ITS and IGS genes of the isolated strain and 7 Rhizopus spp. strains were performed using MEGAX with Neighbor-Joining (NJ) method. Based on the results of growth habits, morphological observations, and phylogenetic analysis, the pathogen was identified as R. arrhizusi. A spore suspension of the R. arrhizusi DIC01 (1 x107 conidia/mL) was inoculated back to healthy D. rubrovolvata. Five healthy fruit bodies of D. rubrovolvata were injected, and another five healthy morels were treated with potato dextrose broth (PDB) as controls. D. rubrovolvata was incubated at 25°C and 90% relative humidity without ventilation for 5 days. The pathogen successfully infected the D. rubrovolvata, which developed white moldy lesions similar to those of natural diseases. The controls remained healthy without any symptoms. The pathogen was reisolated from the affected lesions and identified as R. arrhizusi DIC01 based on its morphological characteristics and phylogenetic marker genes. R. arrhizusi has been reported to cause endothelial cell damage and mycelial invasion into blood vessels, leading to thrombosis and tissue necrosis. (Hariprasath P, 2019). To our knowledge, this is the first report of R. arrhizusi causing rot disease of D. rubrovolvata. This study confirmed that R. arrhizusi is the pathogenic fungus responsible for rotting disease in D. rubrovolvata farms in Fengxian, Shanghai.

Strain-resolved de-novo metagenomic assembly of viral genomes and microbial 16S rRNAs

BackgroundMetagenomics is a powerful approach to study environmental and human-associated microbial communities and, in particular, the role of viruses in shaping them. Viral genomes are challenging to assemble from metagenomic samples due to their genomic diversity caused by high mutation rates. In the standard de Bruijn graph assemblers, this genomic diversity leads to complex k-mer assembly graphs with a plethora of loops and bulges that are challenging to resolve into strains or haplotypes because variants more than the k-mer size apart cannot be phased. In contrast, overlap assemblers can phase variants as long as they are covered by a single read.ResultsHere, we present PenguiN, a software for strain resolved assembly of viral DNA and RNA genomes and bacterial 16S rRNA from shotgun metagenomics. Its exhaustive detection of all read overlaps in linear time combined with a Bayesian model to select strain-resolved extensions allow it to assemble longer viral contigs, less fragmented genomes, and more strains than existing assembly tools, on both real and simulated datasets. We show a 3–40-fold increase in complete viral genomes and a 6-fold increase in bacterial 16S rRNA genes.ConclusionPenguiN is the first overlap-based assembler for viral genome and 16S rRNA assembly from large and complex metagenomic datasets, which we hope will facilitate studying the key roles of viruses in microbial communities.C22dm7AjjRZTtiuc33W1snVideo

Revisiting the functional annotation of TriTryp using sequence similarity tools

Trypanosomatids are the causative agents of deadly diseases in humans and livestock. Given the high phylogenetic distance of trypanosomatids from model organisms, these organisms have ample unannotated genes. Manual functional annotation is time-consuming, highlighting the importance of automated functional annotation tools. The development of automated functional tools is a hot research topic, and multiple tools have been developed for the task. PANNZER2 is an automated functional annotation tool that merely relies on the sequence similarity of the query to the annotated proteins. We tried PANNZER2 on Trypanosoma brucei, the most studied organism among trypanosomatids, to see if it could improve our knowledge of the functions of the genes.Even with the availability of automated annotation tools like InterPro2GO in databases such as TriTrypDB, PANNZER2 has made surprisingly confident predictions for some hypothetical proteins in T. brucei. In this study, we identify gaps in such annotations because of not employing pairwise sequence alignment tools in TriTrypDB's automated annotation process. Our findings demonstrate that even the use of stringent cutoffs can successfully annotate a significant number of proteins. Additionally, we discovered that adjusting the open reading frames in certain genes leads to sequences with increased sequence signature coverage—characterized by the length covered by at least one sequence signature—compared to the original sequences. This enhanced sequence signature coverage suggests these genomic fragments could be pseudogenes. To facilitate further exploration, we developed a script to help identify potential pseudogenes within an organism's genome, offering researchers a new tool for genomic analysis and understanding. We extended all our analysis to Trypanosoma cruzi and Leishmania major to assess the impact of this approach across different species.Our study demonstrates that by utilizing pairwise sequence similarity alignment, even with stringent cutoffs, we can attribute 2986, 3953, and 3798 new GO terms to the genomes of T. brucei, T. cruzi, and L. major. Additionally, we found that 210, 239, and 29 genes exhibit increased sequence signature coverage following frame correction, suggesting the presence of pseudogenes.

Epidemiological investigation of equine rotavirus B outbreaks in horses in central Kentucky

Using metagenomic sequencing we identified equine rotavirus group B (ERVB) of ruminant origin in foal diarrhea outbreaks in the 2021 foaling season. To further investigate ERVB occurrence and determine its environmental stability, we collected mare and foal fecal samples from different farms in central Kentucky during the 2022 foaling season. The RT-qPCR-based analyses showed that ERVB genome was detected in 16.67% (42/252) of surveyed mare samples and 26.56% (34/128) of foal samples. Furthermore, 94.12% (16/17) of collected soil samples and 100% (13/13) of water samples obtained from the ERVB-positive farm premises also tested weakly positive. In addition, ERVB genome fragments were detected in 58.33% (7/12) of indoor samples collected from the equipment/barn/hospital wards during the outbreak period. Finally, the seroprevalence study showed 87% (113/130) of surveyed horse serum samples were positive for ERVB antibodies. Despite unsuccessful attempts in ERVB cultivation, phylogenetic analyses showed that fecal ERVB strains representing 2022 and 2023 foal diarrhea outbreaks, like 2021 strains, were more closely related to ruminant rotavirus B than other viruses. Further sequence analyses revealed that none of the three viral capsid proteins, the primary targets of virus-neutralizing antibodies, exhibited notable mutations among ERVB strains circulated over the past three years. Our data demonstrated that ERVB was widespread in horses on affected farms with extreme stability in the farm environment. These findings continue to support the need for future surveillance of ERVB in horses and the surrounding environment, and the development of effective countermeasures to protect horses against this new viral disease.

First Report of Beet Western Yellows Virus Infecting Vasconcellea x heilbornii (Caricaceae) in Ecuador.

Vasconcellea x heilbornii, known as babaco, is a hybrid native to Ecuador grown in small orchards in sub-tropical highland regions. Over the last decade, several viruses have been identified in babaco using high-throughput sequencing (HTS) (Cornejo-Franco et al. 2020, (Reyes-Proaño et al. 2023). In 2021, total RNA from a babaco plant showing distinctive leaf yellowing was extracted using the PureLink RNA Mini Kit (Thermo Fischer Scientific, USA) and subjected to HTS on an Illumina NovaSeq6000 system as 150 paired-end reads (Macrogen Inc., South Korea). Library construction was done using the TruSeq Stranded Total RNA Sample kit with Plant Ribo-Zero, as described (Villamor et al. 2022). Reads were processed using BBDuk and de novo assembled using SPAdes 3.15. both implemented in Geneious 2022. Contig analysis was done by BLASTx using the NCBI viral sequence database (as of November 2022). HTS generated 54 million reads, of which 12% assembled into contigs corresponding to genomes of previously reported babaco viruses including babaco virus Q (BabVQ), babaco nucleorhabdovirus 1 (BabRV1) and babaco ilarvirus 1 (BabIV1). Interestingly, 144 reads (0.0003%) assembled into seven contigs ranging from 100 to 480 nucleotides (nt) in length. These contigs showed homology, with 97% amino acid (aa) identity (100% query coverage), to regions of the RNA-dependent-RNA-polymerase (RdRp) of beet western yellows virus (BWYV, Acc. No. NC_004756), a member of the Polerovirus genus. To confirm the occurrence of BWYV in babaco, double-stranded RNA (dsRNA) was extracted from 15 g of leaf tissue from the original sample as described (Dodds et al. 1984) and used as template for reverse-transcription (RT)-PCR using overlapping primers designed to span all short contigs. RT-PCR amplified fragments were cloned into a pGEM®T-easy vector (Promega, USA) and sequenced by the Sanger method (Macrogen Inc., South Korea). The sequences were assembled into a single 2.7 kbp BWYV genome fragment comprising the complete protein 1 (P1) and partial RdRp gene (GenBank Acc. No. PP480670). Sequence alignments between the partially sequenced genome of the babaco isolate and its corresponding fragment from the closest BWYV isolate (NC_004756) revealed 94% and 97% identities at the nt and aa levels, respectively. To assess the prevalence of BWYV in babaco, 30 leaf samples showing yellowing symptoms from Pichincha (n=15) and Azuay (n=15) provinces were tested by RT-PCR using total RNA. Total RNA extraction and reverse transcription were done using the methodology described by Halgren et al. (2007). For RT-PCR, the primer set BWYV_Bab_F: 5'-CAGTGTCCTCCAAGTGCAACAT-3' / BWYV_Bab_R: 5'GGTTCCTTCCCAGTTTGGTGGT-3', which amplifies a 235 nt-long P1 region, was used. Three RT-PCR products from each positive sample were purified using the GeneJET PCR clean-up kit (Thermo Scientific, USA) and sequenced. BWYV was confirmed in 9 out of 15 samples (60%) from Pichincha, and in 10 out of 15 samples (64%) from Azuay. Samples were also tested for additional babaco viruses as described (Reyes-Proaño et al. 2023). All BWYV-infected plants turned out positive for papaya ringspot virus (PRSV), babaco mosaic virus (BabMV), BabVQ, and BabIV1. Hence, the impact of BWYV infection on babaco plants in single and mixed infections warrants further investigation. To the best of our knowledge, this is the first report of BWYV in a crop in Ecuador, and the first time it has been found in a Caricaceae species.

Exploring genetic diversity of hepatitis D virus full-length genome in Brazil: Discovery of a novel HDV-8 subgenotype beyond African borders

Hepatitis D virus (HDV) is currently classified into 8 genotypes (1 to 8) and several subgenotypes, with distinct distribution worldwide. However, due to the scarcity of complete genome sequences in databases, this classification is constantly being updated and tends to be regularly revisited in upcoming years as more sequence data becomes available. Aiming to increase knowledge about the genetic variability of HDV, this study presents the full-length genomes of 11 HDV samples collected in Brazil in endemic and non-endemic regions, including the first complete genomes of the genotypes 5 and 8 obtained outside Africa. We also determined the co-infecting HBV genotypes to investigate their prevalence among the HDV-infected individuals throughout the country. Whole genome sequencing confirmed our previous findings based on a partial fragment of the HDV genome, in which HDV subgenoypes 3c (9/11; 81.8 %), 5b (1/11; 9.1 %) and one HDV-8 sequence (1/11; 9.1 %) were detected. As previously observed, HDV-8 formed a distinct branch apart from subgenotypes 8a and 8b, a monophyletic clade representing a novel HDV-8 subgenotype, designated as 8c. Among HDV-3 samples, the main co-infecting HBV genotype found was HBV-F (4/8; 50 %), reflecting the higher incidence of this native South American genotype in the endemic Amazon Basin. Both samples infected with HDV-5 and HDV-8 were coinfected with HBV genotype E, also a genotype with African origin. Our findings based on complete genome sequence of HDV corroborated our results based on a partial region of the HDV genome of a novel HDV-8 subgenotype and reinforced the need to use full-length genomes to properly subdivide genotypes with very low intragroup genetic variability, such as HDV-3. The provision of these complete genomes is expected to contribute to the enrichment of sequence databases for future molecular and evolutionary investigations of HDV.

Identification of a major QTL region and candidate genes responsible for harvest date combining QTL mapping and QTL-seq approaches in walnut (Juglans regia L.)

Walnut (Juglans regia L.) takes place within the Juglandaceae family and is one of the most popular nut species. In walnut breeding, several limiting factors need to be revealed regarding the genetic mechanism underlying important agronomical traits. In the current report, the monitoring of the ‘Chandler x Kaplan-86’ F1 walnut population was carried out four successive years (2015, 2016, 2017, 2018) and the distribution of the plants for harvest date from four years was ranged from August 27th to October 22nd. Then, we dissected the genomic regions associated with harvest date using classical Quantitative Trait Loci (QTLs) mapping and a rapid and cost-effective QTL-seq approach in ‘Chandler x Kaplan-86’ F1 walnut population for the first time. In classical QTL mapping, a major QTL was recognized in LG4 corresponding to Chr1 in Chandler female map with 27.6 (%) phenotyping variance. In QTL-seq, we bulked the DNAs of the genotypes with extreme harvest date separately, the whole genome resequencing was performed for a parent Chandler and both bulks (early and late) to calculate Delta SNP indexes for each Single Nucleotide Polymorphisms (SNPs) and Insertion/Deletion (InDels). Approximately 48.04 million paired reads for Chandler, 149.72, and 150.14 million paired reads were obtained from early and late harvest bulks, respectively. A total of 229,307 SNPs and 45,223 InDels were mined from the merged sequences data covered whole chromosomes. The responsible genomic fragments were identified in Chr2 and Chr11 in QTL-seq. The highest linked InDel locus detected in QTL-seq in Chr11 around 17 million base pairs distinguished the plants according to harvest date. InDel Sequence Characterized Amplified Region (SCAR) marker is a candidate for marker-assisted selection for future walnut breeding studies.

Diverse RNA viruses discovered in multiple seagrass species.

Seagrasses are marine angiosperms that form highly productive and diverse ecosystems. These ecosystems, however, are declining worldwide. Plant-associated microbes affect critical functions like nutrient uptake and pathogen resistance, which has led to an interest in the seagrass microbiome. However, despite their significant role in plant ecology, viruses have only recently garnered attention in seagrass species. In this study, we produced original data and mined publicly available transcriptomes to advance our understanding of RNA viral diversity in Zostera marina, Zostera muelleri, Zostera japonica, and Cymodocea nodosa. In Z. marina, we present evidence for additional Zostera marina amalgavirus 1 and 2 genotypes, and a complete genome for an alphaendornavirus previously evidenced by an RNA-dependent RNA polymerase gene fragment. In Z. muelleri, we present evidence for a second complete alphaendornavirus and near complete furovirus. Both are novel, and, to the best of our knowledge, this marks the first report of a furovirus infection naturally occurring outside of cereal grasses. In Z. japonica, we discovered genome fragments that belong to a novel strain of cucumber mosaic virus, a prolific pathogen that depends largely on aphid vectoring for host-to-host transmission. Lastly, in C. nodosa, we discovered two contigs that belong to a novel virus in the family Betaflexiviridae. These findings expand our knowledge of viral diversity in seagrasses and provide insight into seagrass viral ecology.

New evidence supports the prophage origin of RcGTA.

Gene transfer agents (GTAs) are phage-like entities that package and transfer random host genome fragments between prokaryotes. RcGTA, produced by Rhodobacter capsulatus, is hypothesized to originate from a prophage ancestor. Most of the evidence supporting this hypothesis came from the finding of RcGTA-like genes in phages. More than 75% of the RcGTA genes have a phage homolog. However, only a few RcGTA homologs have been identified in a (pro)phage genome, leaving the hypothesis that GTAs evolved from prophages through gene loss with only weak evidence. We herein report the discovery of an inducible prophage (vB_MseS-P1) from a Mesorhizobium sediminum strain that contains the largest number (12) of RcGTA homologs found in a phage genome to date. We also identified three putative prophages and two prophage remnants harboring 12-14 RcGTA homologs in a Methylobacterium nodulans strain. The protein remote homology detection also revealed more RcGTA homologs from other phages than we previously thought. Moreover, the head-tail gene architecture of these newly discovered prophage-related elements closely resembles that of RcGTA. Furthermore, vB_MseS-P1 virions have structural proteins similar to RcGTA particles. Close phylogenetic relationships between certain prophage genes and RcGTA-like genes in Alphaproteobacteria further support the shared ancestry between RcGTA and prophages. Our findings provide new relatively direct evidence of the origin of RcGTA from a prophage progenitor.IMPORTANCEGTAs are important genetic elements in certain groups of bacteria and contribute to the genetic diversification, evolution, and ecological adaptation of bacteria. RcGTA, a common type of GTA, is known to package and transfer random fragments of the bacterial genome to recipient cells. However, the origin of RcGTA is still elusive. It has been hypothesized that RcGTA evolved from a prophage ancestor through gene loss. However, the few RcGTA homologs identified in a (pro)phage genome leave the hypothesis lacking direct evidence. This study uncovers the presence of a large number of RcGTA homologs in an inducible prophage and several putative prophages. The similar head-tail gene architecture and structural protein compositions of these newly discovered prophage-related elements and RcGTA further demonstrate an unprecedentedly observed close evolutionary relationship between prophages and RcGTA. Together, our findings provide more direct evidence supporting the origin of RcGTA from prophage.

Numb Suppresses Notch-Dependent Activation of Enhancer of split during Lateral Inhibition in the Drosophila Embryonic Nervous System.

The role of Drosophila numb in regulating Notch signaling and neurogenesis has been extensively studied, with a particular focus on its effects on the peripheral nervous system (PNS). Previous studies based on a single loss-of-function allele of numb, numb1, showed an antineurogenic effect on the peripheral nervous system (PNS), which revealed that the wild-type numb suppresses Notch signaling. In the current study, we examined whether this phenotype is consistently observed in loss-of-function mutations of numb. Two more numb alleles, numbEY03840 and numbEY03852, were shown to have an antineurogenic phenotype in the PNS. We also found that introducing a wild-type numb genomic fragment into numb1 homozygotes rescued their antineurogenic phenotype. These results demonstrated that loss-of-function mutations of numb universally induce this phenotype. Many components of Notch signaling are encoded by maternal effect genes, but no maternal effect of numb was observed in this study. The antineurogenic phenotype of numb was found to be dependent on the Enhancer of split (E(spl)), a downstream gene of Notch signaling. We found that the combination of E(spl) homozygous and numb1 homozygous suppressed the neurogenic phenotype of the embryonic central nervous system (CNS) associated with the E(spl) mutation. In the E(spl) allele, genes encoding basic helix-loop-helix proteins, such as m5, m6, m7, and m8, remain. Thus, in the E(spl) allele, derepression of Notch activity by numb mutation can rescue the neurogenic phenotype by increasing the expression of the remaining genes in the E(spl) complex. We also uncovered a role for numb in regulating neuronal projections. Our results further support an important role for numb in the suppression of Notch signaling during embryonic nervous system development.

Cucurbit Leaf Crumple Virus (CuLCrV) is Seed Transmitted in Yellow Squash (Cucurbita pepo L.).

The traditional understanding of begomovirus transmission exclusively through the whitefly Bemisia tabaci (Gennadius) has shifted with findings of seed transmission in some begomoviruses over the last decade. We investigated the seed transmissibility of cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus that has recently emerged as a severe constraint for yellow squash (Cucurbita pepo L.) production in the southeastern United States. We found high concentration of CuLCrV in male and female flower tissues of infected squash, including pollen and ovules. The virus infiltrated the fruit tissues including the endocarp and funiculus, which are anatomically positioned adjacent to the seeds. In seeds, CuLCrV was detected in the endosperm and embryo where there are no vascular connections, in addition to the seed coat. The virus was detected in the radicle, plumule, cotyledonary leaves, and true leaves of seedlings grown from seeds collected from infected fruits. In the grow-out test conducted, CuLCrV infections ranged from 17-56% of the progeny plants. To ensure that partial viral genome fragments were not being mistaken for replicative forms of the virus, we performed RCA ̶ PCR and amplified complete DNA-A and DNA-B of CuLCrV from seed tissues, seedlings, progeny plants of CuLCrV infected squash. Near complete DNA-A and DNA-B sequences of CuLCrV were recovered from a progeny plant, further validating our findings. Our results demonstrate that CuLCrV can translocate from vegetative to reproductive tissues of yellow squash, persist within the seeds, and subsequently induce infection in progeny plants, confirming its capacity for seed transmission.

Optimization of Genotyping‐by‐Sequencing (GBS) for Germplasm Fingerprinting and Trait Mapping in Faba Bean

ABSTRACTFaba bean (Vicia faba L.) is an important pulse crop with a wide range of agroecological adaptations. The development of genomic tools and a comprehensive catalog of extant genetic diversity are crucial for developing improved faba bean cultivars. The lack of a cost‐effective genotyping platform limits the characterization of large germplasm collections, understanding of genetic diversity across populations, and implementing breeder's tools like genomic selection. Genotyping‐by‐sequencing (GBS) offers high‐resolution genotyping for both model and crop plant species, even without a reference genome sequence. The genome fragments targeted by GBS depend substantially on the restriction enzyme (RE) used for the complexity reduction step. Species with complex genomic architecture require optimization of GBS with proper RE to realize the full potential of GBS. Here, we evaluated various REs in the GBS method and identified that the combination of ApeKI/MseI proved to be the most appropriate for faba bean based on the best library quality, a high number of genomic loci spread across chromosomes, and high enrichment loci associated with the gene space. With the new optimized protocol, we constructed a genetic map using a recombinant inbred line (RIL) population and identified a QTL for seed hilum color on Chromosome 1. In addition, we also genotyped a diversity panel and performed a genome‐wide association studies (GWAS) for important agronomic traits, including plant height (PH), flowering time (FT), and number of pods per plant (PPP). We identified six SNP markers significantly associated with these traits and listed potential candidate genes. The optimized faba bean‐specific GBS procedure will facilitate access to the untapped genetic diversity for genetic research and breeding and may facilitate functional genomics.

MICROPHERRET: MICRObial PHEnotypic tRait ClassifieR using Machine lEarning Techniques

BackgroundIn recent years, there has been a rapid increase in the number of microbial genomes reconstructed through shotgun sequencing, and obtained by newly developed approaches including metagenomic binning and single-cell sequencing. However, our ability to functionally characterize these genomes by experimental assays is orders of magnitude less efficient. Consequently, there is a pressing need for the development of swift and automated strategies for the functional classification of microbial genomes.ResultsThe present work leverages a suite of supervised machine learning algorithms to establish a range of 86 metabolic and other ecological functions, such as methanotrophy and plastic degradation, starting from widely obtainable microbial genome annotations. Tests performed on independent datasets demonstrated robust performance across complete, fragmented, and incomplete genomes above a 70% completeness level for most of the considered functions. Application of the algorithms to the Biogas Microbiome database yielded predictions broadly consistent with current biological knowledge and correctly detecting functionally-related nuances of archaeal genomes. Finally, a case study focused on acetoclastic methanogenesis demonstrated how the developed machine learning models can be refined or expanded with models describing novel functions of interest.ConclusionsThe resulting tool, MICROPHERRET, incorporates a total of 86 models, one for each tested functional class, and can be applied to high-quality microbial genomes as well as to low-quality genomes derived from metagenomics and single-cell sequencing. MICROPHERRET can thus aid in understanding the functional role of newly generated genomes within their micro-ecological context.

Versatile and efficient mammalian genome editing with Type I-C CRISPR System of Desulfovibrio vulgaris.

CRISPR-Cas tools for mammalian genome editing typically rely on single Cas9 or Cas12a proteins. While type I CRISPR systems in Class I may offer greater specificity and versatility, they are not well-developed for genome editing. Here, we present an alternative type I-C CRISPR system from Desulfovibrio vulgaris (Dvu) for efficient and precise genome editing in mammalian cells and animals. We optimized the Dvu type I-C editing complex to generate precise deletions at multiple loci in various cell lines and pig primary fibroblast cells using a paired PAM-in crRNA strategy. These edited pig cells can serve as donors for generating transgenic cloned piglets. The Dvu type I-C editor also enabled precise large fragment replacements with homology-directed repair. Additionally, we adapted the Dvu-Cascade effector for cytosine and adenine base editing, developing Dvu-CBE and Dvu-ABE systems. These systems efficiently induced C-to-T and A-to-G substitutions in human genes without double-strand breaks. Off-target analysis confirmed the high specificity of the Dvu type I-C editor. Our findings demonstrate the Dvu type I-C editor's potential for diverse mammalian genome editing applications, including deletions, fragment replacement, and base editing, with high efficiency and specificity for biomedicine and agriculture.

Impact of rice GENERAL REGULATORY FACTOR14h (GF14h) on low-temperature seed germination and its application to breeding.

Direct seeding is employed to circumvent the labor-intensive process of rice (Oryza sativa) transplantation, but this approach requires varieties with vigorous low-temperature germination (LTG) when sown in cold climates. To investigate the genetic basis of LTG, we identified the quantitative trait locus (QTL) qLTG11 from rice variety Arroz da Terra, which shows rapid seed germination at lower temperatures, using QTL-seq. We delineated the candidate region to a 52-kb interval containing GENERAL REGULATORY FACTOR14h (GF14h) gene, which is expressed during seed germination. The Arroz da Terra GF14h allele encodes functional GF14h, whereas Japanese rice variety Hitomebore harbors a 4-bp deletion in the coding region. Knocking out functional GF14h in a near-isogenic line (NIL) carrying the Arroz da Terra allele decreased LTG, whereas overexpressing functional GF14h in Hitomebore increased LTG, indicating that GF14h is the causal gene behind qLTG11. Analysis of numerous Japanese rice accessions revealed that the functional GF14h allele was lost from popular varieties during modern breeding. We generated a NIL in the Hitomebore background carrying a 172-kb genomic fragment from Arroz da Terra including GF14h. The NIL showed superior LTG compared to Hitomebore, with otherwise comparable agronomic traits. The functional GF14h allele from Arroz da Terra represents a valuable resource for direct seeding in cold regions.

Effect of storage temperature on viral RNA accumulation in Plum pox virus-infected Red Lyon plum fruit from the Central Valley of Chile

Plum pox virus (PPV), the causative agent of Sharka disease, causes serious economic losses to the stone fruit industry. As PPV is not transmitted by seed, fruit from countries with Sharka present are considered low-risk for spreading the disease. However, there have been cases raising concerns about the safety of exporting fruit from countries with Sharka disease. Due to this, the generation of new scientific evidence becomes important to address these concerns. This study aimed to compare the relative accumulation of PPV viral titer between freshly harvested infected fruit with fruit subjected to cold storage, simulating transit conditions to export markets. During two consecutive seasons, the fruit was collected from a PPV-infected ’Red Lyon’ plum orchard, and divided into three treatments (T): freshly harvested fruit (T1); fruit exposed to cold (0 °C) for seven days (T2), and fruit exposed to cold (0 °C) for 15 days (T3). Semi-quantitative RT-PCR was used to estimate the viral titer; band density values obtained for products of amplification of a PPV genome fragment were normalized with the density values obtained from the constitutive gene nad5 and plotted relative to treatment T1, which served as a control for this purpose. The results showed a significant difference (p < 0.05) between T1 and other treatments. For the first season, the viral RNA reduction was of 50% in T2 and 61% in T3, compared to T1. For the second season, the corresponding RNA viral reductions were 45% in T2 and 56% in T3, compared to T1.