Transgenic Crops Research Articles

Extended reality gives digital agricultural biotechnology a new dimension

Facing up to the global challenges of designing climate-resilient biotech crops involves a great deal of out-of-the-box thinking. Extended reality is coming of age in digital agricultural biotechnology. Here, we seek to stimulate technological innovation by empowering future innovators, researchers, academics, and startups to think and partner creatively.

Phage-displayed nanobody-based fluorescence-linked immunosorbent assay for the detection of Cry3Bb toxin in corn

Cry toxins have been widely used as biopesticides and applied in transgenic crops for the control of pests, raising public concerns for unforeseen environmental and health risks. In this study, five phage-displayed nanobodies against Cry3Bb toxin were selected from a naive nanobody library by screening. Using purified phage-displayed nanobody as capture antibody, a novel double-antibody sandwich fluorescence-linked immunosorbent assay (FLISA) based on quantum dot beads (QBs) was established for the determination of Cry3Bb toxin. The developed method exhibited a linear working range of 31.25–500 ng/mL and a low detection limit of 8.45 ng/mL. The recoveries of Cry3Bb toxin from spiked corn samples were ranging from 93.1% to 116.8% with a coefficient of variation lower than 9.4%. Molecular modeling results showed that key amino acids in the CDR3 region of nanobody P27 combine with Cry3Bb toxin through hydrogen bonds and hydrophobic interactions. These results indicated that the phage-displayed nanobody-based QBs-FLISA may provide a possible tool for detecting Cry3Bb toxin in corn.

Genetically Modified (GM) Crop Use 1996–2020: Environmental Impacts Associated with Pesticide Use Change

ABSTRACT This paper assesses the environmental impacts associated with changes in pesticide use with GM crops at a global level. The main technologies impacting on pesticide use have been crops modified to be tolerant to specific herbicides so as to facilitate improved weed control and crops resistant to a range of crop insect pests that otherwise damage crops or typically require the application of insecticides to control them. Over the 24 year period examined to 2020, the widespread use of GM insect resistant and herbicide tolerant seed technology has reduced pesticide application by 748.6 million kg (−7.2%) of active ingredient and, as a result, decreased the environmental impact associated with insecticide and herbicide use on these crops (as measured by the indicator, the Environmental Impact Quotient (EIQ)) by a larger 17.3% between 1996 and 2020. The technology that has delivered the largest change in pesticide use has been insect resistant cotton, where a 339 million kg of active ingredient saving has occurred and the associated environmental impact (as measured by the EIQ indicator) has fallen by about a third.

Development and Validation of a New Robust Detection Method for Low-Content DNA Using ΔΔCq-Based Real-Time PCR with Optimized Standard Plasmids as a Control Sample.

Real-time polymerase chain reaction (PCR) is the gold standard for DNA detection in many fields, including food analysis. However, robust detection using a real-time PCR for low-content DNA samples remains challenging. In this study, we developed a robust real-time PCR method for low-content DNA using genetically modified (GM) maize at concentrations near the limit of detection (LOD) as a model. We evaluated the LOD of real-time PCR targeting two common GM maize sequences (P35S and TNOS) using GM maize event MON863 containing a copy of P35S and TNOS. The interlaboratory study revealed that the LOD differed among laboratories partly because DNA input amounts were variable depending on measurements of DNA concentrations. To minimize this variability for low-content DNA samples, we developed ΔΔCq-based real-time PCR. In this study, ΔCq and ΔΔCq are as follows: ΔCq = Cq (P35S or TNOS) – Cq (SSIIb; maize endogenous gene), ΔΔCq = ΔCq (analytical sample) – ΔCq (control sample at concentrations near the LOD). The presence of GM maize was determined based on ΔΔCq values. In addition, we used optimized standard plasmids containing SSIIb, P35S, and TNOS with ΔCq equal to the MON863 genomic DNA (gDNA) at concentrations near the LOD as a control sample. A validation study indicated that at least 0.2% MON863 gDNA could be robustly detected. Using several GM maize certified reference materials, we have demonstrated that this method was practical for detecting low-content GM crops and thus for validating GM food labeling. With appropriate standards, this method would be applicable in many fields, not just food.

Points to consider in seeking biosafety approval for research, testing, and environmental release of experimental genetically modified biocontrol products during research and development

Novel genetically modified biological control products (referred to as “GM biocontrol products”) are being considered to address a range of complex problems in public health, conservation, and agriculture, including preventing the transmission of vector-borne parasitic and viral diseases as well as the spread of invasive plant and animal species. These interventions involve release of genetically modified organisms (GMOs) into the environment, sometimes with intentional dissemination of the modification within the local population of the targeted species, which presents new challenges and opportunities for regulatory review and decision-making. Practices developed for GMOs, primarily applied to date for GM crops may need to be adapted to accommodate different types of organisms, such as insects, and different technologies, such as gene drive. Developers of new GM biocontrol products would benefit from an early understanding of safety data and information that are likely to be required within the regulatory dossier for regulatory evaluation and decision making. Here a generalizable tool drawing from existing GM crop dossier requirements, forms, and relevant experience is proposed to assist researchers and developers organize and plan their research and trialing. This tool requires considering specifics of each investigational product, their intended use, and country specific requirements at various phases of potential product development, from laboratory research through contained field testing and experimental release into the environment. This may also be helpful to risk assessors and regulators in supporting their systematic and rigorous evaluation of new biocontrol products.

Book review: Aniket Aga. 2021. Genetically Modified Democracy: Transgenic Crops in Contemporary India

Aniket Aga. 2021. Genetically Modified Democracy: Transgenic Crops in Contemporary India. New Haven and London: Yale University Press. 328 pp. Notes, references, index. $65 (hardback—ISBN: 9780300245905)

Evaluation of the Effects of Climate Change on Agricultural Production - La Rinconada Town Center – Ancash, Peru

The objective of this research is to evaluate the effects of climate change on agricultural production in the town of Rinconada in the district of Santa, Ancash, Peru. Climate change variables (Precipitation and Temperature) vs. agricultural production were analyzed. We worked with the information collected from the SENAHMI (Servicio Nacional de Methodology e Hydrology del Peru), Lima - Peru through the database of the Pisco station, the Santa Users Board, the La Rinconada Irrigation Commission and the integrated system of agrarian statistics of the Ancash region, Peru [20]. The perception of the irrigation commission of the town of La Rinconada, district of Santa, Ancash, Peru was also evaluated through a survey with questions about the effects of the 2 variables of climate change: precipitation and temperature vs agricultural production of the main crops: corn, cotton, and rice. Climate change was modeled between the periods of 2006 and 2010 and between 2011-2015, through the variables of maximum precipitation and average precipitation in comparison with the variables of planting area, yield, and agricultural production [22]. It can be concluded that it is possible to predict the planting, yield and production of the crops evaluated: corn, cotton, and rice, using only the variables of maximum rainfall, and average rainfall, and that it is necessary to keep investigating the presence of transgenic crops in the Rinconada valley.

Differential assembly of root-associated bacterial and fungal communities of a dual transgenic insect-resistant maize line at different host niches and different growth stages.

Transgenic technology has been widely applied to crop development, with genetically modified (GM) maize being the world’s second-largest GM crop. Despite the fact that rhizosphere bacterial and fungal populations are critical regulators of plant performance, few studies have evaluated the influence of GM maize on these communities. Plant materials used in this study included the control maize line B73 and the mcry1Ab and mcry2Ab dual transgenic insect-resistant maize line 2A-7. The plants and soils samples were sampled at three growth stages (jointing, flowering, and maturing stages), and the sampling compartments from the outside to the inside of the root are surrounding soil (SS), rhizospheric soil (RS), and intact root (RT), respectively. In this study, the results of alpha diversity revealed that from the outside to the inside of the root, the community richness and diversity declined while community coverage increased. Morever, the different host niches of maize rhizosphere and maize development stages influenced beta diversity according to statistical analysis. The GM maize line 2A-7 had no significant influence on the composition of microbial communities when compared to B73. Compared to RS and SS, the host niche RT tended to deplete Chloroflexi, Gemmatimonadetes and Mortierellomycota at phylum level. Nitrogen-fixation bacteria Pseudomonas, Herbaspirillum huttiense, Rhizobium leguminosarum, and Sphingomonas azotifigens were found to be enriched in the niche RT in comparison to RS and SS, whilst Bacillus was found to be increased and Stenotrophomonas was found to be decreased at the maturing stage as compared to jointing and flowering stages. The nitrogen fixation protein FixH (clusters of orthologous groups, COG5456), was found to be abundant in RT. Furthermore, the pathogen fungus that causes maize stalk rot, Gaeumannomyces radicicola, was found to be abundant in RT, while the beneficial fungus Mortierella hyalina was found to be depleted in RT. Lastly, the abundance of G. radicicola gradually increased during the development of maize. In conclusion, the host niches throughout the soil-plant continuum rather than the Bt insect-resistant gene or Bt protein secretion were primarily responsible for the differential assembly of root-associated microbial communities in GM maize, which provides the theoretical basis for ecological agriculture.

Heterologous expression of cry1Ia12 insecticidal gene in cotton encodes resistance against pink bollworm, Pectinophora gossypiella (Lepidoptera: Gelechiidae); an alternate insecticidal gene for insect pest management.

Cotton is continuously exposed to sucking and chewing insect pest pressure since emergence to harvesting. Pink bollworm (Pectinophora gossypiella) has become major chewing insect pest to reduce the cotton yield and results in bad lint quality even in transgenic crops. The efficiency of insecticidal genes has been compromised due to extensive utilization of transgenic crops. The present study was conducted to evaluate the efficacy of an alternate cry1Ia12 insecticidal gene against pink bollworm (PBW) in cotton. Agrobacterium tumefaciens strain LBA4404 harboring pCAMBIA2300 expression vector containing cry1Ia12 gene under the control of 35S CaMV was used to transform a local cotton cultivar GS-01. The various molecular analyses revealed the transgene integration and expression in primary transformants. Among five selected transgenic plants, tcL-08 showed maximum (16.06-fold) mRNA expression of cry1Ia12 gene whereas tcL-03 showed minimum (2.33-fold) expression. Feeding bioassays of 2nd and 3rd instar pink bollworm (PBW) larvae on immature cotton bolls, flowers and cotton squares revealed up to 33.33% mortality on tcL-08 while lowest mortality (13.33%) was observed in tcL-03 and tcL-15. Furthermore, the average weight and size of survived larvae fed on transgenic plants was significantly lesser than the average weight of larvae survived on non-transgenic plants. The present study suggests the cry1Ia12 gene as an alternate insecticidal gene for the resistance management of cotton bollworms, especially PBW.

Transgenic cotton expressing Cry1B protein has no adverse effect on predatory insect Propylea Japonica

The lady beetle Propylea japonica is a dominant natural predator of insect pests in farmland ecosystems and an important non-target indicator insect for the environmental safety assessment of GM crops. The commercial cultivation of GM crops may cause P. japonica to frequently be exposed to the Bt protein environment. In this study, the biological characteristics, enzyme activity, and expression levels of detoxification and metabolism in P. japonica were studied after Cry1B protein treatment. No significant differences were observed in developmental duration, emergence rate, or body weight at different ages after feeding larvae 0.5 mg/mL of Cry1B protein compared with the control. Furthermore, there were no significant differences in the activities of glutathione S-transferase (GST), catalase (CAT), and peroxidase (POD) after feeding 0.25 mg/mL and 0.5 mg/mL Cry1B protein. However, when the concentration of Cry1B protein increased to 1.0 mg/mL, the activities of the GST, CAT, and POD increased significantly. Compared with the control group, there were no significant differences in the expression levels of most detoxification metabolism related genes; only a few genes had changed expression levels at the individual concentrations (CYP345B1, CYP4Q2, CYP9F2, GST, and microsomal GST). Overall, these results suggest that Cry1B protein has little or no effect on the biological characteristics of P. japonica. Genes related to enzyme activity and detoxification are differentially expressed at high concentration stimulation. Therefore, this research suggests that the potential risks of Cry1B for the predator P. japonica are negligible.

Assessing Impacts of Transgenic Plants on Soil Using Functional Indicators: Twenty Years of Research and Perspectives.

Assessment of the effects of transgenic plants on microbiota and soil fertility is an important part of the overall assessment of their biosafety. However, the environmental risk assessment of genetically modified plants has long been focused on the aboveground effects. In this review, we discuss the results of two decades of research on the impact of transgenic plants on the physicochemical properties of soil, its enzyme activities and microbial biomass. These indicators allow us to assess both the short-term effects and long-term effects of cultivating transgenic plants. Most studies have shown that the effect of transgenic plants on the soil is temporary and inconsistent. Moreover, many other factors, such as the site location, weather conditions, varietal differences and management system, have a greater impact on soil quality than the transgenic status of the plants. In addition to the effects of transgenic crop cultivation, the review also considers the effects of transgenic plant residues on soil processes, and discusses the future prospects for studying the impact of genetically modified plants on soil ecosystems.

An ultra-sensitive test strip combining with RPA and CRISPR/Cas12a system for the rapid detection of GM crops

Advanced molecular biotechnology has been developed to provide favorable technical support for genetically modified (GM) crop detection. For sensitive on-site detection, a Cas12a-based immunoassay strip was self-prepared and evaluated in this study. The strip was applied to analyze transgenic screening elements P-CaMV 35S and T-NOS by combination with RPA and Cas12a cleavage reaction. The assay can be completed at 37 °C within 40 min, and the result can be interpreted by the naked eye. For strip analysis, 1 copy/μL of the standard plasmid containing T-NOS and 10 copies/μL of the standard plasmid containing P-CaMV 35S could be detected, and the detection limits of genomic DNA were 10−4 and 0.01 ng/μL for T-NOS and P-CaMV 35S, respectively. In addition, the response signal of the test strips was stable under the detection limit concentration, which was distinguished from the negative control. Moreover, the strip has good specificity for 16 kinds of transgenic samples and can be applied to random samples in the market. In summary, the proposed Cas12a-based strip showed good detection performance and provided an ultra-sensitive tool for the visual detection of GM crops.

GMO or non-GMO? That is the question.

This article is a Commentary on Buchholzer & Frommer (2023); 237: 12–15.

Characteristics and Fitness Analysis through Interspecific Hybrid Progenies of Transgenic Brassica napus and B. rapa L. ssp.

Interspecific hybridization between transgenic crops and their wild relatives is a major concern for transgene dispersal in the environment. Under controlled conditions, artificial hand pollination experiments were performed in order to assess the hybridization potential and the fitness of interspecific hybrids between Brassica rapa and genetically modified (GM) Brassica napus. Initially, six subspecies of B. rapa were hybridized with GM B. napus through hand pollination. In the resulting F1 hybrids, the combination of B. rapa ssp. narinosa (♀) × GM B. napus (♂) had the highest crossability index (16.9 ± 2.6). However, the F1 selfing progenies of B. rapa ssp. rapa (♀) × GM B. napus were found to be more effective in producing viable future generations with the highest crossability index (1.6 ± 0.69) compared to other subspecies. Consequently, they were used for the generation of F2 and F3 progenies. The 18 different morphological characteristics among the parental cross-combinations and F1 hybrid progenies were measured and visualized through hierarchical clustering. Different generations were found to be grouped based on their different morphological characteristics. The chromosome numbers among the interspecific hybrids ranged from 2n = 29 to 2n = 40. Furthermore, the SSR markers revealed the presence of genomic portions in the hybrids in comparison with their parental lines. There is a high possibility of transgene flow between GM B. napus and B. rapa. The study concluded that the interspecific hybrids between B. napus and B. rapa can be viable and can actively hybridize up to F3 generations and more. This suggests that the GM B. napus can disperse the transgene into B. rapa, and that it can pass through for several generations by hand pollination in a greenhouse environment.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Practical resistance to Cry toxins and efficacy of Vip3Aa in Bt cotton against Helicoverpa zea.

Crops genetically engineered to make insect-killing proteins from Bacillus thuringiensis (Bt) have revolutionized management of some pests. However, the benefits of such transgenic crops are reduced when pests evolve resistance to Bt toxins. We evaluated resistance to Bt toxins and Bt cotton plants using laboratory bioassays and complementary field trials focusing on Helicoverpa zea, one of the most economically important pests of cotton and other crops in the United States. The data from 235 laboratory bioassays demonstrate resistance to Cry1Ac, Cry1Fa, and Cry2Ab occurred in most of the 95 strains of H. zea derived from Arkansas, Louisiana, Mississippi, Tennessee, and Texas during 2016 to 2021. Complementary field data show efficacy decreased for Bt cotton producing Cry1Ac + Cry1Fa or Cry1Ac + Cry2Ab, but not Cry1Ac + Cry1Fa + Vip3Aa. Moreover, analysis of data paired by field site and year shows higher survival in bioassays was generally associated with lower efficacy of Bt cotton. The results confirm and extend previous evidence showing widespread practical resistance of H. zea in the United States to the Cry toxins produced by Bt cotton and corn, but not to Vip3Aa. Despite deployment in combination with Cry toxins in Bt crops, Vip3Aa effectively acts as a single toxin against H. zea larvae that are highly resistant to Cry toxins. Furthermore, Vip3Aa adoption is increasing and previous work provided an early warning of field-evolved resistance. Thus, rigorous resistance management measures are needed to preserve the efficacy of Vip3Aa against this highly adaptable pest. © 2022 Society of Chemical Industry.

Functional characterization of the pUceS8.3 promoter and its potential use for ectopic gene overexpression.

The pUceS8.3 is a constitutive gene promoter with potential for ectopic and strong genes overexpression or active biomolecules in plant tissues attacked by pests, including nematode-induced giant cells or galls. Soybean (Glycine max) is one of the most important agricultural commodities worldwide and a major protein and oil source. Herein, we identified the soybean ubiquitin-conjugating (E2) enzyme gene (GmUBC4; Glyma.18G216000), which is significantly upregulated in response to Anticarsia gemmatalis attack and Meloidogyne incognita-induced galls during plant parasitism by plant nematode. The GmUBC4 promoter sequence and its different modules were functionally characterized in silico and in planta using transgenic Arabidopsis thaliana and G. max lines. Its full-length transcriptional regulatory region (promoter and 5´-UTR sequences, named pUceS8.3 promoter) was able to drive higher levels of uidA (β-glucuronidase) gene expression in different tissues of transgenic A. thaliana lines compared to its three shortened modules and the p35SdAMV promoter. Notably, higher β-glucuronidase (GUS) enzymatic activity was shown in M. incognita-induced giant cells when the full pUceS8.3 promoter drove the expression ofthis reporter gene. Furthermore, nematode-specific dsRNA molecules were successfully overexpressed under the control of the pUceS8.3 promoter in transgenic soybean lines. The RNAi gene construct used here was designed to post-transcriptionally downregulate the previously characterized pre-mRNA splicing factor genes from Heterodera glycines and M. incognita. A total of six transgenic soybean lines containing RNAi gene construct were selected for molecular characterization after infection with M. incognita pre-parasitic second-stage (ppJ2) nematodes. A strong reduction in the egg number produced by M. incognita after parasitism was observed in those transgenic soybean lines, ranging from 71 to 92% compared to wild-type control plants. The present data demonstrated that pUceS8.3 is a gene promoter capable of effectively driving dsRNA overexpression in nematode-induced giant cells of transgenic soybean lines and can be successfully applied as an important biotechnological asset to generate transgenic crops with improved resistance to root-knot nematodes as well as other pests.

Establishment of an ELISA Method for Quantitative Detection of PAT/pat in GM Crops

The phosphinothricin N-acetyltransferase gene (pat) is widely used to confer resistance to the herbicide phosphinothricin for genetically modified (GM) crops. A quantitative sandwich enzyme-linked immunosorbent assay (ELISA) is developed to detect PAT/pat in GM crops. Two anti-PAT/pat monoclonal antibodies (mAbs), 1F5-1F2 and 1B6-2D3, with titers of 1:1,024,000 and 1:896,000, respectively, against overexpressed His-PAT/pat, were screened out, raised, and characterized. An ELISA method was established with the 1F5-2F2 mAb for capture and the biotin-labeled 1B6-2D3 mAb for detection of PAT/pat. The linear detection range of the method was approximately 1.5625–12.5 ng/mL, with a sensitivity of 0.085 ng/mL and a coefficient of variation (CV) less than 5.0%. No cross-reactivity was found with other herbicide resistance proteins, especially PAT/bar. The established sensitive and specific ELISA was successfully applied in the detection of PAT/pat expression in GM crops.

A Genotype-Independent, Simple, Effective and Efficient in Planta Agrobacterium-Mediated Genetic Transformation Protocol.

Crop improvement under changing climatic conditions is required to feed the growing global population. The development of transgenic crops is an attractive and conceivably the most effective approach for crop improvement with desired traits in varying climatic situations. Here, we describe a simple, efficient and robust in planta Agrobacterium-mediated genetic transformation method that can be used in most crops, including rice, wheat and cotton, and particularly in tissue culture recalcitrant crops, such as chickpea and pigeon pea. The protocol was successfully used for the development of transgenic chickpea and pigeon pea lines for resistance against pod borer. Transgenic lines in chickpea, pigeon pea and wheat were also developed for salt stress tolerance. These lines exhibited improved salt tolerance in terms of various physio-biochemical parameters studied. Since the protocol is rapid, as no tissue culture step is involved, it will significantly contribute to the improvement of most crops and will be of interest for plant biologists working with genetic engineering or genome editing.

Qualitative and Quantitative Real-Time PCR Methods for Assessing False-Positive Rates in Genetically Modified Organisms Based on the Microbial-Infection-Linked HPT Gene

The hygromycin phosphotransferase (HPT) gene as a selective marker is normally used in screening tests as a first step in detecting and quantifying genetically modified organisms (GMOs) in seeds, food, and feed materials. Nevertheless, if researchers only focus on the HPT gene, it is difficult to distinguish genetically modified (GM) crops from microbial infection, leading to miscalculation of the rate of GM materials in a given sample set. Here, we cloned the 7259 bp sequence carrying the HPT gene from soybean sprouts using the genome walking strategy. BLAST analysis revealed that this sequence was derived from plasmids naturally occurring in microorganisms, such as Escherichia coli, Klebsiella pneumoniae or Salmonella sp. Using the reconstructed plasmid pFP-hpt, qualitative PCR and quantitative real-time PCR (qPCR) methods were established, and 261 bp and 156 bp products were produced. The specificity of these assays was assessed against related pFP-hpt plasmids, plant species with important agronomic traits, and GM crops containing the HPT gene. No unexpected results were observed between samples using these qualitative PCR and qPCR methods. The sensitivity of this qualitative PCR assay was determined at 20 copies, while the limit of detection (LOD) and limit of quantification (LOQ) of qPCR were both 5 copies per reaction. Our in-house validation indicated that the amplification efficiency, linearity, and repeatability of this qPCR assay were in line with performance requirements. Furthermore, a qualitative and quantitative duplex PCR showed high reliability for the simultaneous detection of the HPT gene in a plant sample and environmental micro-organisms harboring the HPT gene in one PCR reaction. These qualitative PCR and qPCR assays were able to differentiate between plants infected with E. coli harboring the HPT gene from GM plants, indicating that these two methods are broadly applicable for routine GMO testing.