Glucokinase Gene Research Articles

Genetic Structure of Hereditary Forms of Diabetes Mellitus in Russia

Analyzing the genetic architecture of hereditary forms of diabetes in different populations is a critical step toward optimizing diagnostic and preventive algorithms. This requires consideration of regional and population-specific characteristics, including the spectrum and frequency of pathogenic variants in targeted genes. As part of this study, we used a custom-designed NGS panel to screen for mutations in 28 genes associated with the pathogenesis of hereditary diabetes mellitus in 506 unrelated patients from Russia. The study identified 180 pathogenic or likely pathogenic variants across 13 genes (GCK, HNF1A, HNF1B, HNF4A, ABCC8, INS, INSR, KCNJ11, PAX4, PDX1, ZFP57, BLK, WFS1), representing 46.44% of the analyzed cohort (235 individuals). The glucokinase gene (GCK) had the highest number of identified variants, with 111 variants detected in 161 patients, 20 of which were identified for the first time. In the tissue-specific transcription factor genes HNF1A, HNF4A, and HNF1B, 34 variants were found in 38 patients, including 13 that were previously unreported. Seventeen variants were identified in the ABCC8 gene, which encodes the ATP-binding cassette transporter 8 of subfamily C, each found in a different patient; four of these were novel discoveries. Nine pathogenic or likely pathogenic variants were identified in the insulin gene (INS) and its receptor gene (INSR), including four previously unreported variants. Additionally, we identified 10 previously unreported variants in six other genes among 11 patients. Variants in the genes GCK, HNF1A, HNF1B, HNF4A, ABCC8, INS, and INSR were the main contributors to the genetic pathogenesis of hereditary diabetes mellitus in the Russian cohort. These findings enhance our understanding of the molecular mechanisms underlying the disease and provide a solid basis for future studies aimed at improving diagnostic accuracy and advancing personalized therapeutic strategies. This knowledge provides a foundation for developing region-specific genetic testing algorithms and personalized therapeutic strategies, which are critical for future initiatives in precision medicine.

Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood

To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.

The rs1799884 Glucokinase Gene Polymorphism Modulates Susceptibility to HIV Status and CD4 Cell Count and Viral Load before and After Treatment in AIDS Progressors.

The human immunodeficiency virus (HIV), a retrovirus targeting the immune system and the primary agent causing acquired immunodeficiency syndrome (AIDS), can have fatal consequences. Although antiretroviral treatment has significantly reduced mortality and comorbidity in people living with HIV (PLHIV), its impact on metabolic syndrome (MetS) remains notable. Several genome-wide association studies have identified a link between the glucokinase gene (GCK) and MetS, particularly in type 2 diabetes. However, no studies have investigated the association between this gene and HIV status. Our study aims to evaluate the association of the rs1799884 polymorphism in the GCK gene with HIV status in a group of Moroccan patients. This case-control study includes 207 PLHIV and 181 HIV-uninfected controls. Genotyping of the rs1799884 polymorphism in the GCK gene was performed using a predesigned TaqMan single-nucleotide polymorphism genotyping assay. The genotypic distribution between PLHIV and HIV-uninfected controls revealed a significant difference. Patients with the CT genotype had a 4.47-fold increased risk of infection [odds ratio (OR) = 4.47; 95% confidence interval (CI) = 2.75-7.29; p = .001]. However, the TT genotype conferred protection against HIV in a recessive model (OR = 0.50; 95% CI = 0.28-0.91; p = .021). Interestingly, the risk associated with the CT genotype was even higher in AIDS-related cases (OR = 9.37; 95% CI = 4.32-20.36; p = .0001). Additionally, under the dominant model, individuals with CT and TT genotypes had a 7.67-fold increased risk of infection (OR = 7.67; 95% CI = 3.60-16.36; p < .0001). However, the TT genotype under the recessive model was not significantly associated with disease progression. No significant association was observed between these genotypes and CD4 count; however, there was a significant variation in viral load after treatment. Our findings suggest that the rs1799884-C/T variant of the GCK gene may influence susceptibility to HIV status, progression to AIDS, and response to treatment.

In Vivo Glucose Transporter-2 Regulation of Dorsomedial Versus Ventrolateral VMN Astrocyte Metabolic Sensor and Glycogen Metabolic Enzyme Gene Expression in Female Rat.

Astrocyte glycogenolysis shapes ventromedial hypothalamic nucleus (VMN) regulation of glucostasis in vivo. Glucose transporter-2 (GLUT2), a plasma membrane glucose sensor, controls hypothalamic primary astrocyte culture glycogen metabolism in vitro. In vivo gene silencing tools and single-cell laser-catapult-microdissection/multiplex qPCR techniques were used here to examine whether GLUT2 governs dorsomedial (VMNdm) and/or ventrolateral (VMNvl) VMN astrocyte metabolic sensor and glycogen metabolic enzyme gene profiles. GLUT2 gene knockdown diminished astrocyte GLUT2 mRNA in both VMN divisions. Hypoglycemia caused GLUT2 siRNA-reversible up-regulation of this gene profile in the VMNdm, but down-regulated VMNvl astrocyte GLUT2 transcription. GLUT2 augmented baseline VMNdm and VMNvl astrocyte glucokinase (GCK) gene expression, but increased (VMNdm) or reduced (VMNvl) GCK transcription during hypoglycemia. GLUT2 imposed opposite control, namely stimulation versus inhibition of VMNdm or VMNvl astrocyte 5'-AMP-activated protein kinase-alpha 1 and -alpha 2 gene expression, respectively. GLUT2 stimulated astrocyte glycogen synthase (GS) gene expression in each VMN division. GLUT2 inhibited transcription of the AMP-sensitive glycogen phosphorylase (GP) isoform GP-brain type (GPbb) in each site, yet diminished (VMNdm) or augmented (VMNvl) astrocyte GP-muscle type (GPmm) mRNA. GLUT2 enhanced VMNdm and VMNvl glycogen accumulation during euglycemia, and curbed hypoglycemia-associated VMNdm glycogen depletion. Results show that VMN astrocytes exhibit opposite, division-specific GLUT2 transcriptional responsiveness to hypoglycemia. Data document divergent GLUT2 control of GCK, AMPK catalytic subunit, and GPmm gene profiles in VMNdm versus VMNvl astrocytes. Ongoing studies seek to determine how differential GLUT2 regulation of glucose and energy sensor function and glycogenolysis in each VMN location may affect local neuron responses to hypoglycemia.

8616 A Novel Mutation of Maturity Onset Diabetes of the Young

Abstract Disclosure: K.H. Weerasinghe: None. N. Branis: None. Background: Maturity onset diabetes of the young (MODY) is an autosomal dominant condition characterized by various subsets (Nkonge et al., 2020). A mutation in the glucokinase gene (GCK), otherwise known as MODY type 2, is often characterized by mild hyperglycemia managed with lifestyle modifications (Nkonge et al., 2020). Novel mutations in this gene may differ in their clinical course and need close clinical monitoring. Clinical Case: A 19 year old male presented for evaluation of his diabetes mellitus. In 2020, the patient was hyperglycemic on routine blood work, with asymptomatic features. His condition was managed with lifestyle modifications. The HbA1c was 6.8 and 7; while fructosamine was 338 mmol/L (normal 205-285 mmol/L). Subsequent workup revealed GAD 65 to be less than 5 U/ml(normal range being 0-5 U/ml) with negative islet antibodies. C-peptide was similarly measured and found to be 1.5 ng/ml, within the limits of 1.1-4.4 ng/ml, demonstrating a good pancreatic reserve. A MODY genetic profile was then conducted which revealed a novel mutation in the GCK gene, variant c.1064T&amp;gt;C (p.L355P). As this is a novel mutation, the probability of MODY was calculated, and found to be 75% using the Exeter maturity-onset diabetes of the young (MODY) probability calculator (EMPC).The patient’s clinical course thus far has been managed conservatively as his hyperglycemia has been mild. However, recently the patient’s post prandial sugars were found to be persistently elevated. Pharmacotherapy such as sulfonylureas was discussed however, as per the patient’s wishes, stricter dietary modifications will be applied prior to the initiation of medication. Conclusion: Patients with novel mutations should be closely monitored as the general expected clinical course may vary. These changes are demonstrated in this case report as the patient started developing elevation in postprandial sugar levels uncharacteristically. Close monitoring of the patient’s future clinical status will be essential in learning more about the differences in prognosis and long term management.

Case report of a patient with a biallelic variant in glucokinase (GCK) gene causing maturity onset diabetes of the young

Case report of a patient with a biallelic variant in glucokinase (GCK) gene causing maturity onset diabetes of the young

Dorzagliatin: A Breakthrough Glucokinase Activator Coming on Board to Treat Diabetes Mellitus.

Dorzagliatin, an innovative dual-acting allosteric oral glucokinase activator that targets glucose homeostasis and insulin resistance, has gained approval for treating type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM). The effectiveness of existing antidiabetic treatments in enhancing beta cell (β-cell) activity is restricted. Currently, there are no satisfactory medications available to address the fundamental deficiency in glucose sensing for glucokinase-maturity-onset diabetes of the young (GCK-MODY), which is caused by mutations in the glucokinase gene; researchers have embarked on glucokinase activators. Dorzagliatin enhances the affinity of glucokinase for glucose and glucose-sensing capacity, improves β-cell function, and reduces insulin resistance. Two phase 3 studies, an adjunct trial of dorzagliatin with metformin for T2DM patients and a monotherapy trial for drug-naïve T2DM patients, are key clinical trials that have shown a favorable safety and tolerability profile. They also demonstrated a rapid, sustained reduction in glycated hemoglobin (HbA1c) and a significant decrease in postprandial blood glucose. This review will summarize the substantial clinical evidence supporting the safety and efficacy of dorzagliatin in treating diabetes mellitus (DM) and clarify the molecular mechanisms underlying its action.

Pengzhenrongella phosphoraccumulans sp. nov., isolated from high Arctic glacial till, and emended description of the genus Pengzhenrongella.

A yellow pigmented, Gram-stain-positive, motile, facultatively anaerobic and irregular rod-shaped bacteria (strain M0-14T) was isolated from a till sample collected from the foreland of a high Arctic glacier near the settlement of Ny-Ålesund in the Svalbard Archipelago, Norway. Phylogenetic analysis based on 16S rRNA gene sequence comparisons revealed that M0-14T formed a lineage within the family Cellulomonadaceae, suborder Micrococcineae. M0-14T represented a novel member of the genus Pengzhenrongella and had highest 16S rRNA gene sequence similarity to Pengzhenrongella sicca LRZ-2T (97.3 %). Growth occurred at 4-25 °C (optimum 4-18 °C), at pH 6.0-9.0 (optimum pH 7.0), and in the presence of 0-5 % (w/v) NaCl. The predominant menaquinone was MK-9(H4) and the major fatty acids were anteiso-C15 : 0, C16 : 0 and summed feature 3 (comprising C16 : 1ω7c and/or C16 : 1ω6c). The major polar lipids were phosphatidylglycerol, phosphatidylinositol mannosides, phosphatidylinositol, one undefined phospholipid and five undefined phosphoglycolipids. The cell-wall diamino acid was l-ornithine whereas rhamnose and mannose were the cell-wall sugars. Polyphosphate particles were found inside the cells of M0-14T. Polyphosphate kinase and polyphosphate-dependent glucokinase genes were detected during genomic sequencing of M0-14. In addition, the complete pstSCAB gene cluster and phnCDE synthesis genes, which are important for the uptake and transport of phosphorus in cells, were annotated in the genomic data. According to the genomic data, M0-14T has a metabolic pathway related to phosphorus accumulation. The DNA G+C content of the genomic DNA was 70.8 %. On the basis of its phylogenetic relationship, phenotypic properties and chemotaxonomic distinctiveness, strain M0-14T represents a novel species of the genus Pengzhenrongella, for which the name Pengzhenrongella phosphoraccumulans sp. nov. is proposed. The type strain is M0-14T (= CCTCC AB 2012967T = NRRL B-59105T).

Salvia officinalis Improves Glycemia and Suppresses Pro-inflammatory Features in Obese Rats with Metabolic Syndrome.

Obesity is regarded as the main cause of metabolic diseases and a core factor for all-cause mortality in the general population, notably from cardiovascular disease. The majority of people with type 2 diabetes have obesity and insulin resistance. Some evidence indicates that an individual with obesity is approximately 10 times more likely to develop type 2 diabetes than someone with moderate body weight. One of the most significant therapeutic herbs, Salvia officinalis (Lamiaceae) (SAGE), possesses potent medicinal importance. The aim of this article was to evaluate the anti-diabetic and antiobesity activity of SAGEAE against HFD-induced obesity in rats. Thirty adult albino rats were randomly divided into five equal groups: control, High-fat Diet (HFD) administrated rats, HFD + Salvia officinalis Aqueous Extract (SAGEAE) (150 mg/kg.bw.), HFD + SAGEAE (300 mg/kg.bw.) and HFD + metformin (500 mg/kg.bw.). Body weight, plasma biochemical parameters, oxidative stress, inflammatory indicators, hepatic Phosphoenolpyruvate Carboxykinase 1 (PCK1), Glucokinase (GK), brain Leptin Receptor (LepRb), Glucose Transporter-4 (GLUT4), Sirtuin 1 (SIRT1) and mRNA33-5P gene signalling mRNA levels were all assessed after 8 weeks. A histological examination of the liver was also performed to check for lipid accumulation. The administration of HFD resulted in increased body weight, glucose, insulin, leptin, Total Cholesterol (TC), Triglycerides (TG), Thiobarbaturic Acid Reactive Substances (TBARS), Monocyte Chemoattractant Protein-1 (MCP1), Interleukine-6 (IL-6) and tumor necrosis factor-α (TNF- α) as well as hepatic PCK1, brain LepRb and adipose tissue mRNA33-5P gene expression. However, our findings revealed a significant reduction in adiponectin, High-density Lipoproteincholesterol (HDL-C), reduced glutathione (GSH) and Superoxide Dismutase (SOD) levels as well as the expression of hepatic GK and adipose tissue SIRT1 and GLUT4 genes. Also, administration of SAGEAE significantly normalized body weight, glucose, insulin, leptin, adiponectin, TC, TG, HDL-C, TBARs, SOD, IL-6, MCP-1 and TNF-α in plasma and liver tissue of HFD-treated rats. On the other hand, PCK1, GK, LepRb, SIRT1, GLUT4 and mRNA33-5P gene expression was enhanced in obese rats when administrated with SAGEAE. Histological and US studies support the biochemical, PCR and electrophoretic results. The findings imply that SAGEAE could be used as a new pharmaceutical formula in the treatment of obesity.

Current status and progress of research on the ADP-dependent glucokinase gene.

ADP-dependent glucokinase (ADPGK) produces glucose-6-phosphate with adenosine diphosphate (ADP) as the phosphate group donor, in contrast to ATP-dependent hexokinases (HKs). Originally found in archaea, ADPGK is involved in glycolysis. However, its biological function in most eukaryotic organisms is still unclear, and the molecular mechanism of action requires further investigation. This paper provides a concise overview of ADPGK's origin, biological function and clinical application. It aims to furnish scientific information for the diagnosis and treatment of human metabolic diseases, neurological disorders, and malignant tumours, and to suggest new strategies for the development of targeted drugs.

A combined administration of GABA agonist and L-histidine synergistically alleviates obesity-induced neuro-lipotoxicity and distorted metabolic transcriptome

Obesity stands as a pervasive and significant global health issue, with a lack of definitive and curative therapeutic solutions currently available. Here we studied the synergetic ameliorating effect of coupled administration of GABA agonist; baclofen with histidine against the high fat (HFD) induced lipotoxicity in experimentally obese rats. Animals were divided into six groups. The control group (group 1) was fed a basal diet. Obesity was induced in groups 2 to 6 by HFD for 60 days and concomitantly treated with distilled water or Fluoxetine or Baclofen or L-Histidine or a half-dose combination of Bac plus His, respectively. HFD leads to aberrations in neuronal function, affecting neurotransmitters such as monoamines, turnover rates, and levels of excitatory and inhibitory amino acids when compared to control (P < 0.05). Additionally, it induces notable cellular oxidative stress and energy homeostasis distortion. Simultaneous dysregulation of genes associated with glucose sensing and availability was observed, characterized by a notable decrease in the expression of the glycogen phosphorylase gene and a marked increase in the expression of glucokinase and proglucagon genes (P < 0.05). Both Bac and His single dosing rectified the HDF-induced alterations in 5HT, DA and NE neurotransmitters with their metabolites 5HIAA, DOPAC and HVA, together with Nrf1 and NF-KB1 inflammatory markers and partially quenched the HDF-induced increase in the level of MDA and 8OHdG oxidative stress byproducts, and restored the activity of GSH and SOD antioxidant enzymes. Remarkably, the combined administration of Bac and His at half-dose exhibited significant behavioral improvement, fully normalizing neurochemical and cellular energy homeostasis, and restoring cellular redox and inflammatory parameters to control values following HFD-induced cellular insult. In conclusion, the combined half-dosing of Bac plus His treatment exhibited substantial improvements in behavior and fully normalized neurochemical and cellular parameters, offering a promising approach for addressing obesity-related complexities.

FpOGT is required for fungal growth, stress response, and virulence of Fusarium proliferatum by affecting the expression of glucokinase and other glucose metabolism-related genes

O-GlcNAcylation, an important post-translational modification catalyzed by O-GlcNAc transferase (OGT), plays critical roles in several biological processes. In this study, we present our findings on the function of FpOGT in regulating physiological processes and pathogenicity of Fusarium proliferatum (Fp), the alfalfa root rot fungus. The deletion of FpOGT impaired mycelial growth and altered macroconidia morphology in Fp. Furthermore, ΔFpOGT mutant displayed altered tolerance to various stressors, including cell wall perturbing agents, osmotic stressors, metal ionic stressors, and fungicides. Deletion of FpOGT significantly decreased Fp virulence toward alfalfa. The transcriptome analysis demonstrated that FpOGT plays a regulatory role in glucose metabolic pathways, including glycolysis, tricarboxylic acid (TCA) cycle, and hexosamine biosynthesis pathway (HBP), by influencing the expression of relevant genes. The downregulation of the glucokinase gene, FpGCK, was observed in ΔFpOGT, and the disruption of FpGCK led to a decrease in Fp virulence. Additionally, FpOGT affected the expression levels of the FpGCK-AS1 isoform, thereby impacting glucokinase function. The molecular docking analysis elucidated the plausible physical interaction between FpOGT and FpGCK, thereby offering valuable insights into their interrelationship. These findings underscore the indispensable involvement of FpOGT, the sole O-GlcNAc transferase in Fp, in various biological processes and the pathogenicity through its regulation of fundamental metabolic processes. Consequently, this study emphasizes the significance and elucidates the molecular mechanism underlying the role of O-GlcNAc transferase in diverse fundamental biological processes and the pathogenicity of phytopathogenic fungi.

GCK-MODY у молодых мужчин: значение поведенческих и кардиометаболических факторов риска в развитии осложнений

Aim. Present two clinical cases of Maturity-Onset Diabetes of the Young, which is based on the presence of pathogenic variants in the glucokinase (GCK) gene — GCK-MODY; to characterize behavioral and cardiometabolic risk factors for diabetes complications. Key points. In the first clinical case, the pathogenic variant p.Trp257Ter (c.770G&gt;A, NM_000162.5) of the GCK gene, previously described in the literature, was identified in the proband and his father, in the second — the pathogenic variant p.Cys271Ter (c.1113C&gt;A, NM_000162. 5) GCK gene. Probands are young men, 22 and 21 years old, respectively. They were first diagnosed with diabetes in the ages of 10 and 6 years during routine examinations. There were no clinical symptoms of hyperglycemia; they did not take and do not currently take hypoglycemic drugs. When examined 11 and 15 years after the diagnosis of diabetes, in each patient the level of C-peptide was within the reference values, which indicates the preservation of the secretory function of pancreatic β-cells. Antibodies were negative, the level of glycated hemoglobin (HbA1c) was 5.7 and 6.1%, respectively. No complications of diabetes were identified in either patient. The fathers of probands from both families had HbA1c levels of 6.4 and 6.5%, respectively. The father of the proband from the first clinical case does not comply with recommendations for a healthy lifestyle and nutrition, and does not deny weekly alcohol consumption. Upon examination, he was found to be overweight, arterial hypertension, dyslipidemia, steatohepatitis, and atherosclerosis of the brachiocephalic vessels, which increase the risk of cardiovascular events. The father of the proband from the second clinical case follows recommendations for a healthy lifestyle. During the examination, body weight, blood pressure, blood lipids are within the target range. Conclusion. Presenting two clinical cases and family histories of patients with GCK-MODY, the authors note that the compliance with the principles of a healthy lifestyle, assessment and correction of the main risk factors will help avoid the emergence and progression of complications in patients with GCK-MODY. When monitoring and treating patients with diabetes of any type, it is important to follow the principles of preventive medicine. Keywords: Molecular genetic research, GCK gene, monogenic diabetes mellitus, Maturity-Onset Diabetes of the Young, hyperglycemia, diabetes mellitus in young people.

Integration of proteomics and metabolomics reveals energy and metabolic alterations induced by glucokinase (GCK) partial inactivation in hepatocytes

AimsGlucokinase (GCK) acts as the glucose sensor in maintaining glucose homeostasis. The inactivating mutation of the GCK gene leads to glucokinase-maturity onset diabetes of the young (GCK-MODY). This study aims to gain further insights into the molecular alterations triggered by GCK partial inactivation in hepatocytes, potentially underlying the favorable prognosis of GCK-MODY. Main methodsA GCK knockdown HepG2 cell model was established, and the integration of proteomics and metabolomics was used to gain a comprehensive understanding of the molecular pathway changes caused by GCK inactivation in the liver. Key findingsProteomic analysis identified 257 differential proteins. KEGG pathway enrichment analysis showed that protein expression changes in the GCK knockdown group were significantly enriched in central carbon metabolism, the TCA cycle, amino acid metabolism and the oxidative phosphorylation pathway. Among them, enzymes in the TCA cycle (PC, IDH2, SDH) were significantly downregulated in GCK-knockdown group. Targeted metabolomics revealed that in the GCK knockdown hepatocytes, TCA cycle intermediates were significantly decreased, including pyruvate, oxaloacetate, citrate and succinic acid, and three metabolites increased including glycine, betaine and homocysteine. These metabolic alterations in turn reduced the accumulation of reactive oxygen species in GCK knockdown hepatocytes. Correlation analysis indicated that TCA cycle metabolites were positively correlated with proteins involved in the TCA cycle, carbon metabolism, glycolysis, Ras signaling, fibrosis and inflammation. SignificanceIn conclusion, GCK knockdown reduced TCA cycle flux and oxidative stress in hepatocytes by influencing the levels of key transcription factors and enzymes, providing a comprehensive understanding of the effects of GCK partial inactivation on liver metabolism and molecular mechanisms.

Tetrahydropalmatine from medicinal plants activates human glucokinase to regulate glucose homeostasis.

Many synthetic glucokinase activators (GKAs), modulating glucokinase (GK), an important therapeutic target in diabetes have failed to clear clinical trials. In this study, an in silico structural similarity search with differing scaffolds of reference GKAs have been used to identify derivatives from natural product databases. Ten molecules with good binding score and similar interactions to that in the co-crystallized GK as well good activation against recombinant human GK experimentally were identified. Tetrahydropalmatine, an alkaloid present in formulations and drugs from medicinal plants, has not been explored as an antidiabetic agent and no information regarding its mechanism of action or GK activation exists. Tetrahydropalmatine activates GK with EC50 value of 71.7±17.9μM while lowering the S0.5 (7.1mM) and increasing Vmax (9.22μM/min) as compared to control without activator (S0.5=10.37mM; Vmax=4.8μM/min). Kinetic data (α and β values) suggests it to act as mixed, nonessential type activator. Using microscale thermophoresis, Kd values of 3.8μM suggests a good affinity for GK. In HepG2 cell line, the compound potentiated the uptake of glucose and maintained glucose homeostasis by increasing the expression of GK, glycogen synthase, and insulin receptor genes and lowering the expression of glucokinase regulatory protein (GKRP) and glucagon. Tetrahydropalmatine at low concentrations could elicit a good response by reducing expression of GKRP, increasing expression of GK while also activating it. Thus, it could be used alone or in combination as therapeutic drug as it could effectively modulate GK and alter glucose homeostasis.

Quantitative profiling and diagnostic potential of one-carbon and central metabolism pools in MODY2 and T1DM

BackgroundMaturity-onset diabetes of the young type 2 (MODY2) is a rare genetic disorder characterized as mild fasting hyperglycemia with low risk of vascular complications caused by glucokinase gene mutation. This study aims to investigate metabolites alteration associated with MODY2, exploring possible mechanism underlying characteristic clinical manifestations and low cardiovascular risks of MODY2 and providing serum metabolite biomarkers to facilitating MODY2 diagnosis.MethodsFasting serum samples from MODY2, type 1 diabetes (T1DM) and healthy individuals were collected. By using targeted metabolomics via liquid chromatography–tandem mass spectrometry platform, we quantified the metabolites involved in tricarboxylic acid (TCA) cycle and one-carbon metabolism.ResultsMetabolomic profiling revealed significant difference of intermediates from central metabolism cycle, methionine cycle and several amino acids between MODY2 and T1DM groups. Among these, serum citrate, α-ketoglutaric acid, serine, glycine, glutamine and homocysteine were significantly elevated in MODY2 patients compared with T1DM patients; and compared with healthy subjects, malate and methionine levels were significantly increased in the two groups of diabetic patients. The correlation analysis with clinical indexes showed that α- ketoglutarate, serine, glycine, and glutamine were negatively correlated with blood glucose indicators including fasting blood glucose, HbA1c, and GA, while citrate was positively correlated with C-peptide. And homocysteine displayed positive correlation with HDL and negative with C-reactive protein, which shed light on the mechanism of mild symptoms and low risk of cardiovascular complications in MODY2 patients. A panel of 4 metabolites differentiated MODY2 from T1DM with AUC of 0.924, and a combination of clinical indices and metabolite also gained good diagnostic value with AUC 0.948.ConclusionIn this research, we characterized the metabolite profiles of TCA cycle and one-carbon metabolism in MODY2 and T1DM and identified promising diagnostic biomarkers for MODY2. This study may provide novel insights into the pathogenesis and clinical manifestations of MODY2.

Two novel GCK mutations in Chinese patients with maturity-onset diabetes of the young.

Heterozygous inactivating mutations in the glucokinase (GCK) gene result in the asymptomatic fasting hyperglycemia named as GCK-MODY or MODY2. The genetic testing can effectively avoid the misdiagnosis and inappropriate treatment for GCK-MODY. A total of 25 unrelated families with MODY were screened for mutations in coding region of GCK by using direct sequencing. Three different bioinformatics tools such as PolyPhen2, Mutation Taster and PROVEAN were performed to predict the function of mutant proteins. The glucose profile was recorded by continuous glucose monitoring system (CGMS) to evaluate the glycemic variability for the GCK-MODY patient. Our study identified five GCK mutations in 24% of the families (6/25): two novel mutations (I126fs and G385A) and three already described mutations (G44S, H50fs and S383L). In silico analyses predicted that these mutations altered structural conformational changes. The values of mean amplitude of glycemic excursions (MAGE), an important index of blood glucose fluctuation in CGMS system, were 0.81 in the first 24 h and 1.61 in the second 24 h record in the patient with GCK-MODY (F3), suggesting little glucose fluctuation. The genetic testing is suggested to be important to differentiate GCK-MODY from other types of diabetes. CGMS might be used to screen GCK-MODY cases prior to genetic testing.

Phenotypic Characterization of Congenital Hyperinsulinism Due to Novel Activating Glucokinase Mutations.

Our evaluation of six novel and two previously published activating GCK mutations revealed that the detrimental effects of these mutations on glucose homeostasis can be attributed not only to a lowering of the glucose threshold of insulin secretion but also to a decreased counterregulatory glucagon secretory response. These studies provide insights into the pathophysiology of GCK-hyperinsulinism and the dual role of glucokinase in β-cells and α-cells to regulate glucose homeostasis.

Production and evaluation of a mutant galactose-utilizing strain of Streptococcus thermophilus for application in milk fermentation

Streptococcus thermophilus is a thermophilic gram-positive bacterium used in the production of fermented milk. Most S. thermophilus strains originating from milk can only use the glucose moiety of lactose as a carbon source, while the galactose moiety is secreted into the fermenting milk. In this study, one galactose-positive mutant (S. thermophilus IMAU80285Y) was produced by treating S. thermophilus IMAU80285 with the chemical mutagen, N-methyl-N′-nitro-N-nitrosoguanidine (NTG), and fermentation characteristics were evaluated. β-Galactosidase activity was higher in the mutant strain while glucokinase and pyruvate kinase activities were significantly decreased compared with the wild type. Sequencing revealed that S. thermophilus IMAU80285Y had mutations in the β-galactosidase, glucokinase and pyruvate genes. High performance liquid chromatography (HPLC) analysis demonstrated that accumulation of galactose in milk fermented by the mutant S. thermophilus IMAU80285Y was reduced by 55.4%, compared with the wild strain. Our results indicate that mutation enabled rerouting of the galactose metabolism pathways and provides new insights into using chemical mutagenesis to select strains with excellent characteristics for dairy application.

Effects of High Dietary Carbohydrate Levels on Growth Performance, Enzyme Activities, Expression of Genes Related to Liver Glucose Metabolism, and the Intestinal Microbiota of Lateolabrax maculatus Juveniles

The present study was conducted to investigate the effects of high dietary carbohydrate levels on growth performance, enzyme activities, and gene expressions related to liver glucose metabolism and the intestinal microbiota of Lateolabrax maculatus juveniles. Two experimental diets with levels of carbohydrates (20% and 30%, named the NCD group and the HCD group, respectively) were designed to feed L. maculatus (initial weight 9.45 ± 0.03 g) for 56 days. The results showed that, compared with the NCD group, the condition factor (CF) was significantly elevated in the HCD group (p &lt; 0.05). The plasma advanced glycosylation end products (AGEs), glycated serum protein (GSP), total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL), low-density lipoprotein (LDL), and glutamate aminotransferase (AST) were significantly higher in the HCD group than those in the NCD group (p &lt; 0.05). The intestinal lipase, chymotrypsin, and α-amylase in the HCD group were significantly higher than those in the NCD group (p &lt; 0.05). The liver superoxide dismutase (SOD), total antioxidant capacity (T-AOC), and catalase (CAT) were significantly lower in the HCD group than in the NCD group (p &lt; 0.05). The liver malondialdehyde (MDA) and hexokinase (HK) levels were significantly higher than those in the NCD group (p &lt; 0.05). In the histopathological findings, liver cells in the HCD group appeared to have many vacuoles, and the number of lipid droplets increased. Compared with the NCD group, the relative expression of liver glucokinase (GK) and glycogen synthetase kinase-3 (GSK3β) genes in the HCD group was significantly increased (p &lt; 0.05), while the relative expression of phosphoenolpyruvate carboxykinase (PEPCK) and glycogen phosphorylase (GP) genes in the HCD group was significantly reduced (p &lt; 0.05). High-throughput 16S rRNA gene sequencing showed that high dietary carbohydrate intake changed the composition and structure of the intestinal microbiota. At the phylum level of the intestinal microbiota, high dietary carbohydrates decreased the relative abundance of Firmicutes and increased the relative abundance of Proteobacteria and Bacteroidetes. At the genus level of the intestinal microbiota, high carbohydrates decreased the relative abundance of Bacillus and increased the relative abundance of Photobacterium and Paraclostridium. From the results of this experiment on L. maculatus, high carbohydrates led to increased condition factor and liver glycogen, lipid deposition, decreased antioxidant capacity of the liver, increased relative abundance of harmful intestinal microorganisms, and disrupted glucose metabolism.