Coat Protein Gene Research Articles

First report of Soybean mosaic virus of sword bean in South Korea.

Soybean mosaic virus (SMV) is a member of the genus Potyvirus in the family Potyviridae. Legume crops are often infected by SMV. SMV has not been naturally isolated from sword bean (Canavalia gladiata) in South Korea. In July 2021, 30 samples of sword bean were collected at the field located in Hwasun and Muan, Jeonnam, Korea to investigate viruses infecting sword bean. The samples exhibited symptoms typical of viral infection such as mosaic pattern and, mottling of leaves. Reverse transcription polymerase chain reaction (RT-PCR) and reverse transcription loop-mediated isothermal amplification (RT-LAMP) techniques were employed to identify the agent of viral infection in sword bean samples. Total RNA was extracted from the samples using the Easy-SpinTM Total RNA Extraction Kit (Intron, Seongnam, Korea). Out of the 30 samples, seven were found to be infected by the SMV. RT-PCR was performed using RT-PCR Premix (GeNet Bio, Daejeon, Korea) with SMV-specific primer set, forward primer (SM-N40, 5'-CATATCAGTTTGTTGGGCA-3') and the reverse primer (SM-C20, 5'-TGCCTATACCCTCAACAT-3'), yielding a product of 492 bp (Lim et al., 2014). RT-LAMP was performed using RT-LAMP Premix (EIKEN Chemical, Tokyo, Japan) with SMV-specific primer set, the forward primer (SML-F3, 5'-GACGATGAACAGATGGGC-3', SML-FIP, 5'-GCATCTGGAGATGTGCTTTTGTGGTTATGAATGGTTTCATGG-3') and reverse primer (SML-B3, 5'-TCTCAGAGTTGGTTTTGCA-3', SML-BIP, 5'-GCGTGTGGGTGATGATGGATTTTTTCGACAATGGGTTTCAGC-3') for diagnosis of viral infection (Lee et al., 2015). The full coat protein genes of seven isolates were amplified using RT-PCR to determine their nucleotide sequence. The standard nucleotide BLAST (blastn suite) showed that the seven isolates had approximately 98.2-100% homology with SMV isolates (FJ640966, MT603833, MW079200, and MK561002) in NCBI GenBank. The sequences of seven isolates were deposited in the GenBank database under the accession numbers: OP046403-9. For the pathogenicity assay of the isolate, the crude saps from SMV-infected samples were mechanically inoculated into sword bean. Fourteen days after inoculation, the mosaic symptoms were observed on the upper leaves of sword bean. As a result of the RT-PCR diagnosis in the upper leaves, SMV was reconfirmed in sword bean. This is the first report of natural SMV infection in sword bean. As sword beans are increasingly consumed for teas, transmitted seeds are resulting in a decrease in pod production and quality. It is necessary to develop efficient methods of seed processing and management strategies to control SMV infection in sword bean.

Bean Common Mosaic Potyvirus (BCMV) Characterized from Bean (Phaseolus vulgaris L.) Crops Affected by Mosaic Disease in Denizli Province, Türkiye

Bean (Phaseolus vulgaris L.) is one of the world's oldest crops with both financial and nutritional importance. Bean common mosaic potyvirus (BCMV) is one of the prevalent viral agents that affect beans across the globe. Determining the presence of the agent in the relevant region is critical for minimizing crop losses by implementing appropriate preventive and control measures. In this study, 73 bean leaf samples were collected from bean-growing areas in the Denizli province of Türkiye in 2022. The samples were screened for the presence of viral agents using Polymerase Chain Reaction (PCR) with specific primers targeting the polypeptide gene. 26 of the bean samples were found to be positive for BCMV. The coat protein gene sequences of two randomly selected positive isolates were sequenced and deposited in the GenBank with accession numbers OQ910196 and OQ910197. The nucleotide sequences of isolates were found to have high similarity with those of isolates identified in various regions of the world. Phylogenetic analysis indicated that these isolates from Denizli, Türkiye were closely related to other Turkish isolates. However, since some Turkish isolates in the cluster associated with the Denizli isolates were identified as belonging to the US-5 or NL-6 strain, the current sequences may be related to these strains. Further research is necessary to identify the exact strain of the Denizli isolates, which could be achieved through the use of a strain differentiation set.

First Report of Tomato mottle mosaic virus infecting Chinese snake gourd (Trichosanthes kirilowii) in China.

Tomato mottled mosaic virus (ToMMV) was first identified in tomato in Mexico (Li et al. 2013). It belongs to the genus Tobamovirus and family Virgaviridae, and is a positive-sense single-stranded RNA virus. The viral genome contains about 6400 nucleotides, encoding four proteins, including the 126 K protein, 183 K protein, movement protein (MP) and coat protein (CP) (Tu et al. 2021). ToMMV mainly poses a serious risk to solanaceous crops. The virus-infected plants appear stunted growth and top necrosis, and the disease leaves show mottled, shrinkage and necrosis symptoms, resulting in a significant decline in tomato fruit yield and quality (Li et al. 2017; Tu et al. 2021). Chinese snake gourd (Trichosanthes kirilowii Maxim) is a perennial climbing herb in the family Cucurbitaceae, and the fruit, seed, peel and root can all be used as traditional Chinese medicine. In May of 2021, twenty-seven symptomless seedlings (developed from tissue culture plantlets) were randomly collected from nursery in Fengyang, Anhui Province. Total RNA of each sample was extracted, and RT-PCR was performed using degenerate tobamovirus primers Tob-Uni1 (5'-ATTTAAGTGGASGGAAAAVCACT-3') and Tob-Uni2 (5'-GTYGTT GATGAGTTCRTGGA-3') (Letschert et al. 2002). Amplicons with expected size were obtained from 6 of 27 samples and sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98.7 to 100% with all ToMMV isolates deposited in NCBI GenBank. Then, ToMMV coat protein (CP) gene was amplified using specific primers CP-F (5'-ATGTCTTACGCTATTACTT CTCCG-3') and CP-R (5'-TTAGGACGCTGGCGCAGAAG-3'). The CP fragment was obtained and sequenced. Sequence alignment indicated that CP sequence of isolate FY (GenBank accession no. ON924176) exhibited a 100% identity with ToMMV isolate LN (MN853592.1). The anti-ToMMV polyclonal antibody (PAb) was prepared by the author (S.L.) by immunizing rabbit with purified virus from Nicotiana benthamiana, and serological tests (dot-enzyme linked immunosorbent assay, Dot-ELISA) of RNA-positive T. kirilowii leaf samples using anti-ToMMV PAb were also positive. To fulfill a Koch's postulate, a pure culture of ToMMV was obtained from N. benthamiana using infectious cDNA clone of ToMMV (Tu et al. 2021), and then healthy T. kirilowii plants were mechanically inoculated with a prepared inoculum from ToMMV-infected N. benthamiana, as described previously (Sui et al. 2017). T. kirilowii seedlings showed chlorosis and leaf tip necrosis symptoms at 10 and 20 day post-inoculation respectively, and ToMMV infection on symptomatic plants was also verified by RT-PCR detection using primers CP-F and CP-R. These results demonstrated that T. kirilowii is a host of ToMMV under natural conditions, which might threaten the production of this medicinal plant. The seedlings from nursery appeared to be asymptomatic, but the plants showed chlorosis and necrosis symptoms after indoor inoculation. In qRT-PCR analysis, viral accumulation level in greenhouse-inoculated plants was a 25.6-fold of that in field-collected samples, which may be the reason of different symptom expression between field samples and inoculated samples. ToMMV has now been detected from the solanaceous (tomato, pepper and eggplant) and leguminous (pea) crops in the field (Li et al. 2014; Ambrós et al. 2017; Zhang et al. 2022). To our knowledge, this is the first report of natural infection of ToMMV in T. kirilowii as well as its natural infection on Cucurbitaceae plants.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Serological relationships among strains of grapevine leafroll-associated virus 4 reflect the evolutive behavior of its coat protein gene

This research studied serological relationships and genetic diversity of Argentinean isolates of grapevine leafroll-associated virus-4 (GLRaV-4). Phylogenetic analysis of coat protein (CP) sequences from 19 local isolates revealed clustering with the previously described GLRaV-4 strain 5, strain 6, and strain 9 groups. Evolutionary sequence analysis of the obtained and database-available sequences showed evidence of recombination events. Additionally, both CP N- and C-terminal regions appeared to be under purifying selection, but the N-terminal region presented seven sites under positive selection, with a dN/dS ratio 5-fold greater than that of the C-terminal region. Serological reactivity against monoclonal antibodies supports a higher occurrence probability for linear epitopes in the N-terminal region, as inferred by the sequence analysis. The obtained results reflect an unusual evolutionary behavior of the CP that, together with protein serological reactivity, suggests biological significance of the observed variability. Highlights: The occurrence of GLRaV-4 strains -5, -6 and -9 was recorded in Argentina. The coat protein sequence showed a highly variable N-terminal region among the strains. An evolutionary analysis inferred the occurrence of sites under positive diversifying selection pressure. The most variable region of the coat protein presented the highest probability of occurrence of linear epitopes.

The Tomato Brown Rugose Fruit Virus Movement Protein Gene Is a Novel Microbial Source Tracking Marker.

Microbial source tracking (MST) identifies sources of fecal contamination in the environment using host-associated fecal markers. While there are numerous bacterial MST markers that can be used herein, there are few such viral markers. Here, we designed and tested novel viral MST markers based on tomato brown rugose fruit virus (ToBRFV) genomes. We assembled eight nearly complete genomes of ToBRFV from wastewater and stool samples from the San Francisco Bay Area in the United States. Next, we developed two novel probe-based reverse transcription-PCR (RT-PCR) assays based on conserved regions of the ToBRFV genome and tested the markers' sensitivities and specificities using human and non-human animal stool as well as wastewater. The ToBRFV markers are sensitive and specific; in human stool and wastewater, they are more prevalent and abundant than a commonly used viral marker, the pepper mild mottle virus (PMMoV) coat protein (CP) gene. We used the assays to detect fecal contamination in urban stormwater samples and found that the ToBRFV markers matched cross-assembly phage (crAssphage), an established viral MST marker, in prevalence across samples. Taken together, these results indicate that ToBRFV is a promising viral human-associated MST marker. IMPORTANCE Human exposure to fecal contamination in the environment can cause transmission of infectious diseases. Microbial source tracking (MST) can identify sources of fecal contamination so that contamination can be remediated and human exposures can be reduced. MST requires the use of host-associated MST markers. Here, we designed and tested novel MST markers from genomes of tomato brown rugose fruit virus (ToBRFV). The markers are sensitive and specific to human stool and highly abundant in human stool and wastewater samples.

First Report of Bidens Mottle Virus Causing Mild mottle and Leaf Distortion in Stachytarpheta jamaicensis in Taiwan.

Stachytarpheta jamaicensis, a traditional herbal pharmacological plant in the Family Verbenaceae that produces purplish-blue flowers, is mainly used as a garden plant in tropical and subtropical areas, including Taiwan. A begomovirus, stachytarpheta leaf curl virus (StaLCV) that caused disease on S. jamaicensis, has been reported (Xiong et al. 2005). In 2021, five symptomatic plants with mild mottle and leaf distortion (Fig. S1A, B) and three asymptomatic plants were collected in Taichung City, Taiwan. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR assays using degenerate primer pairs with expected amplicon sizes of 1.2-1.3 kb (PAL1v1978/PAR1c715; Rojas et al. 1993), 312 bp (dTospo-F2/dTospo-R2; Huang et al. 2018), and 600-750 kb (Hrp5/Pot1; Chen et al. 2006, Colinet and Kummert 1993) for Begomovirus, Orthotospovirus, and Potyvirus, respectively were performed using total DNA and total RNA plant extracts. Results showed the expected fragments were only amplified from the 5 symptomatic plants using Potyvirus degenerate primers. Three out of five randomly picked amplicons, coding the 3'-end of nuclear inclusion b protein (NIb) and 5'-end coat protein (CP) genes, were cloned and sequenced with the ABI3730 automatic sequencer (Applied Biosystems, Hammonton, NJ, USA) in Biotechnology Centre DNA-sequencing facility at National Chung Hsing University (NCHU). After NCBI BLASTN analysis, the sequences were shown to be most closely related to bidens mottle virus (BiMoV). The nucleotide sequence identities analyzed using the CLUSTAL W Methods of MegAlign program (DNASTAR, Inc., Madison, WI, USA), showed the three amplicons shared 95.8-99.8% to each other and 94.3-97.1% with 18 BiMoV isolates available in NCBI GenBank. Further RT-PCR with a specific primer (FJJ2021-278) designed from the CP of previously amplified amplicons, paired with oligo d(T) primer, were used for amplification of the 3'-CP gene and 3'-untranslated region (UTR) from total RNAs purified from symptomatic plants. The full-length CPs (804-nt and 268-aa) of the BiMoV isolates described here (Acc. Nos. OM406329 and OM406330; designated as isolate Stachy3 and Stachy7, respectively) shared 96.5-98.5% nucleotide and 97.8-99.3% amino acid identity to other BiMoV isolates. The isolate used for back-inoculation to S. jamaicensis was selected after the completion of triple single chlorotic local lesion isolation in Chenopodium quinoa. Two mechanically-inoculated S. jamaicensis plants exhibited symptoms 14-16 days post-inoculation similar to those observed in field plants and tested positive in RT-PCR using BiMoV-specific primers. In transmission electron microscopy, crude sap extracted from mechanically-inoculated C. quinoa and stained with uranyl acetate (UA) revealed flexuous filamentous virions of approximately 720 × 12 nm (Fig. S1C). A western blot assay using BiMoV antiserum (Chen and Lee 2012) revealed bands of about 34 KDa only from the mechanically-inoculated C. quinoa and the five symptomatic S. jamaicensis plants collected from the field. Taken together, we believe this is the first report of BiMoV infecting and causing mild chlorotic mottle and leaf distortion on S. jamaicensis. S. jamaicensis may serve as a new alternative host of BiMoV that can spread the disease, and consequently may directly impact the producers of horticultural or economical crops, such as lettuce, calendula, sunflower, lisianthus, and garland chrysanthemum in Taiwan.

Phylogenetic and Recombination Analysis of Apple Stem Grooving Virus Isolates from Pears in Korea

The apple stem grooving virus (ASGV) is one of the most harmful latent viruses infecting pear orchards worldwide. To examine the genetic diversity of ASGV in Korean pear orchards, the complete coat protein (CP) gene of five ASGV isolates collected from various regions were identified. The five Korean ASGV isolates showed 88–96% nucleotide identity with the 11 isolates worldwide occurring elsewhere in the world. Phylogenetic analysis of five isolates, as well as the previously sequenced isolates, indicated that the ASGV clusters had no correlation with the host or geographical regions of origin. Recombination analysis showed that one of the five Korean isolates is a recombinant, with a recombination site in the CP gene region (nt 532–708). This study is the first report of natural recombination within the CP gene of ASGV isolates from pears grown in Korea.

Two mutually exclusive evolutionary scenarios for allexiviruses that overcome host RNA silencing and autophagy by regulating viral CRP expression.

The genus Allexivirus currently includes eight virus species that infect allium plants. Previously, we showed that there are two distinct groups of allexiviruses (deletion [D]-type and insertion [I]-type) based on the presence or absence of a 10- to 20-base insert (IS) between the coat protein (CP) and cysteine rich protein (CRP) genes. In the present study of CRPs to analyze their functions, we postulated that evolution of allexiviruses may have been largely directed by CRPs and thus proposed two evolutionary scenarios for allexiviruses based mainly on the presence or absence of IS and determined by how the allexiviruses challenge host resistance mechanisms (RNA silencing and autophagy). We found that both CP and CRP are RNA silencing suppressors (RSS), that they can inhibit each other's RSS activity in the cytoplasm, and that CRP becomes a target of host autophagy in the cytoplasm but not CP. To mitigate CRP interference with CP, and to increase the CP's RSS activity, allexiviruses developed two strategies: confinement of D-type CRP in the nucleus and degradation of I-type CRP by autophagy in the cytoplasm. Here, we demonstrate that viruses of the same genus achieve two completely different evolutionary scenarios by controlling expression and subcellular localization of CRP.

In silico identification and validation of microRNAs from the genome of Solanum lycopersicum targeting Groundnut bud necrosis orthotospovirus

Tomato, an extensively cultivated edible crop is prone to many viral pathogens. Among them, bud necrosis incited by Groundnut bud necrosis orthotospovirus (GBNV) causes huge yield loss (80–100%). Out of all known strategies for viral disease management in plants, RNA interference (RNAi) mediated approaches have greater potential in managing viral diseases. Small RNAs especially microRNA (miRNA) play a major role in RNAi-mediated defense in plants. Using in silico analysis, we have identified the possible tomato encoded miRNA that have the potential to interact with GBNV-mRNA. The results revealed that, sly-MIR9479-3p, sly-MIR10529, sly-MIR397-5p, sly-MIR10528, sly-MIR477-3p, and sly-MIR6024 predicted by the computational algorithms viz., miRanda, psRNA target, RNA22 and RNA hybrid have the potential to interact with different GBNV-ORFs. Conserved complementary sequences of sly-MIR10529 and sly-MIR6024, targeting GBNV genome regions (ORF2 and ORF5), were confirmed in multiple GBNV isolates. The expression of Sly-miR-10529 (1.72-fold increase),Sly-miR-6024 (2.83-fold decrease) and their corresponding glycoprotein and coat protein gene expression were quantified through q-RT-PCR. These predicted miRNAs can offer useful information for the production of antiviral agents/RNAi mediated transgenic crop plants against GBNV in tomato.

Incidence and genetic diversity of raspberry bushy dwarf virus (RBDV) in Rubus spp. in Turkey

AbstractRaspberry bushy dwarf virus (RBDV), recently renamed to Idaeovirus rubi, is one of the most common viruses infecting Rubus species worldwide but there is still a limited number of genome sequences available in the GenBank database and the majority of the sequences include partial sequences of RNA‐1 and RNA‐2. The distribution and incidence of RBDV in main raspberry and blackberry growing provinces in Turkey were monitored during 2015–2019 and 537 Rubus spp. samples were tested by both DAS‐ELISA and RT‐PCR. Among the tested samples, 36 samples tested positive for RBDV by DAS‐ELISA and 67 samples by RT‐PCR. There was relatively low nucleotide diversity among the Turkish isolates. Turkish isolates shared 93%–97.7%, 84.3%–98.9%, and 85%–99.2% nucleotide sequence identities with available sequences in the GenBank, in partial RNA‐1, movement protein (MP) and coat protein (CP) genes, respectively. In the phylogenetic tree constructed for RNA‐1, MP, and CP sequences, all Turkish raspberry isolates were clustered in a distinct clade. However, the blackberry isolates showed considerable variation in nucleotide sequences and were placed in three distinct groups. The divergent blackberry isolates showed high variability in MP (84.5%–89.3%) and CP (85.5%–89.7%) regions and were placed in a distinct group. The rest of blackberry isolates clustered together with sweet cherry RBDV isolates adjacent to the grapevine clade or together with raspberry isolates. The comparative analysis conducted on three RNA segments of RBDV highlighted the high sequence diversity of Turkish RBDV isolates. This study also emphasizes the importance of regular monitoring of RBDV infections in Turkey, with special regard to those Rubus spp. and grapevine accessions employed in conservation and selection programmes. In particular, the presence of new RBDV genetic variants and infection of Rubus species must be taken into account to choose a correct detection protocol and management strategy.

Unraveling the genome and gene expression of Hibiscus chlorotic ringspot virus isolated from Hibiscus rosa-sinensis in Southwest Iran

Hibiscus chlorotic ringspot virus (HCRSV; genus Betacarmovirus, family Tombusviridae) is one of the pathogens causing disease on Hibiscus rosa-sinensis (Chinese rose), an ornamental plant grown throughout the tropic and subtropic regions of the world. In a survey on Chinese hibiscus plants showing chlorotic ring spots leaves in Khuzestan Province, Southwestern Iran, HCRSV was identified and the complete genome of the first Iranian isolate of the virus, HCRSV-IR, was determined using Illumina RNA-Seq. The genome of HCRSV-IR was 3911 nucleotides long and potentially encodes seven open reading frames (ORFs) similar to previously known HCRSV isolates. Iranian isolate of virus showed the highest nucleotide sequence identity, 94.39 %, to the Brazil isolate (MK279671.1) Hibiscus chlorotic ringspot virus (HCRSV; genus Betacarmovirus, family Tombusviridae) is one of the pathogens causing disease on Hibiscus rosa-sinensis (Chinese rose), an ornamental plant grown throughout the tropic and subtropic regions of the world. In a survey on Chinese hibiscus plants showing chlorotic ring spots leaves in Khuzestan Province, Southwestern Iran, HCRSV was identified and the complete genome of the first Iranian isolate of virus, HCRSV-IR, was determined using Illumina RNA-Seq. The genome of HCRSV-IR was 3911 nucleotides long and potentially encodes seven open reading frames (ORFs) similar to previously known HCRSV isolates. Iranian isolate of the virus showed the highest nucleotide sequence identity, 94.39 %, to Brazil isolate (MK279671.1) Chinese hibiscus plants exhibiting chlorotic ringspot symptoms were surveyed in southwestern Iran to determine the presence of Hibiscus chlorotic ringspot virus (HCRSV; genus Betacarmovirus, family Tombusviridae). The complete sequence of the Iranian isolate of the virus, HCRSV-IR, was obtained using Illumina RNA-Seq, marking the first time this sequence has been documented. HCRSV-IR (Accession No. OP779319) has a genome comprising 3911 nucleotides, which encodes seven potential open reading frames (ORFs). Comparative analysis revealed that HCRSV-IR shares the highest nucleotide sequence identity (94.39 %) with an isolate from Brazil (MK279671.1). Analysis of the gene expression profile of the HCRSV-IR population infecting hibiscus plants indicated increased expression of the coat protein gene. Additionally, seventeen single nucleotide polymorphisms (SNPs) were identified within the viral variant populations from the infected hibiscus plants. These SNPs were located in coding regions across the entire genome, implying potential evolutionary significance. To the best of our knowledge, this study represents the first investigation into the molecular characterization of the complete genome of HCRSV, specifically infecting Chinese hibiscus in Iran.

Development, Validation, and Application of Reverse Transcription Real-Time and Droplet Digital PCR Assays for the Detection of the Potyviruses Watermelon Mosaic Virus and Zucchini Yellow Mosaic Virus in Cucurbits.

Among the cucurbit-infecting viruses, watermelon mosaic virus (WMV) and zucchini yellow mosaic virus (ZYMV) (Potyvirus: Potyviridae) are responsible for severe symptoms on cucumber, melon, watermelon, and zucchini cultivations worldwide. In this study, reverse transcription real-time PCR (real-time RT-PCR) and droplet-digital PCR (RT-ddPCR) assays targeting the coat protein (CP) genes of WMV and ZYMV were developed and validated according to the international standards of plant pest diagnosis (EPPO PM 7/98 (5)). First, the diagnostic performance of WMV-CP and ZYMV-CP real-time RT-PCRs was evaluated, and the assays displayed an analytical sensitivity of 10-5 and 10-3, respectively. The tests also showed an optimal repeatability, reproducibility and analytical specificity, and were reliable for the virus detection in naturally infected samples and across a wide range of cucurbit hosts. Based on these results, the real-time RT-PCR reactions were adapted to set up RT-ddPCR assays. These were the first RT-ddPCR assays aiming at the detection and quantification of WMV and ZYMV and showed a high sensitivity, being able to detect until 9 and 8 copies/µL of WMV or ZYMV, respectively. The RT-ddPCRs allowed the direct estimation of the virus concentrations and opened to a broad range of applications in disease management, such as the evaluation of partial resistance in breeding processes, identification of antagonistic/synergistic events, and studies on the implementation of natural compounds in the integrated management strategies.

Watermelon mosaic virus in the Czech Republic, its recent and historical origins

AbstractWatermelon mosaic virus (WMV) is a potyvirus and a member of the bean common mosaic virus (BCMV) lineage. It is one of the most economically important viral pathogens of cucurbits worldwide and was first reported in the Czech Republic in 2011 from serological surveys (2005–2011). In this study, we confirmed this identification by determining the complete coding regions of five Czech WMV isolates using high‐throughput sequencing and Sanger sequencing (MW188031; OP585149–OP585152), together with the coat protein (CP) genes of 26 additional isolates. Phylogenies were made from these and more than 128 genomes or 128 CP genes from GenBank. They showed that the Czech isolates were most closely related to other European isolates, but, surprisingly, 96.2% of the genomes were recombinant. The nonrecombinant sequences mostly came from basal isolates, all originating from China, and some from unusual hosts (Ailanthus altissima, Alcea rosea and Panax ginseng). The complete WMV genomes form three phylogenetic clades, two of them small and basal, and the third includes all other isolates. Comparative dating suggests that the basal Chinese isolates are descendants of a potyvirus population infecting various dicotyledonous plant species in China at least 2000 years ago. WMV became a crop pathogen around 1000 years ago, a few years after watermelon was taken to northern China and first grown as a crop during the Five Dynasties (907–960 ce).

Genetic diversity analysis of lychnis mottle virus and first identification of Angelica sinensis infection

Gansu Province is a district renowned for the cultivation of Angelica sinensis (Oliv.) Diels, accounting for greater than 90% of China's total annual production. However, virus infection has caused a reduction in A. sinensis yield. Here, we collected suspected virus-infected A. sinensis leaf samples from Gansu Province's A. sinensis cultivation area. For the first time, using small RNA deep sequencing and RT-PCR, lychnis mottle virus (LycMoV) was found to naturally infect A. sinensis. The coat protein (cp) gene of the Gansu A. sinensis LycMoV isolate was obtained through cloning, where its nucleotide and amino acid identity was highest while having the closest affinity to the China Pearl (i.e., Prunus persica) isolate. Recombination analysis indicated that genetic recombination had only a limited influencing effect on the molecular evolution of LycMoV. Moreover, results from genetic diversity analysis indicated that the host, geographic isolation, and genetic drift may be the main factors that contributed to the formation of genetic diversity and differentiation in LycMoV. Furthermore, the LycMoV population trend was expansionary. Selection pressure may also be the main driver for the evolution of the entire LycMoV population, while the driving effect of genetic recombination is limited. This study marks a new LycMoV host (i.e., A. sinensis) for the first time and provides scientific support for the identification, prevention, and control of LycMoV.

Current status and molecular phylogeny of some economically important viruses infecting wheat crops of Şırnak province, Turkey

A survey of yellow dwarf viruses (YDVs) -associated diseases of wheat plants was performed for the first time in the Şırnak Province, Turkey. In plants wheat cultivated areas, symptoms such as diminished leaf size, dwarfing, yellowing, and reddening of leaves wheat plants were observed in cultivated areas. A total of 441 specimens were collected regardless of showing symptoms and assayed for Barley/Cereal Yellow Dwarf Viruses [B/CYDV] association by PCR tests using virus coat protein gene (CPG)-specific primer pairs. These assays demonstrated that 13.38% (55 samples) were positive to the occurrence of BYDV-PAV (9.73%) and CYDV-RPV (0.73%) for wheat viruses, but no BYDV-MAV, -SGV, and -RMV infections of BYDVs were found in PCR assays of collected samples. In addition, double infection of BYDV-PAV and CYDV-RPV was detected in 12 samples with a 2.91% infection rate. The CPG sequences of randomly selected two isolates were revealed using bacterial cloning and sequencing. Sequences obtained were deposited in GenBank under Accession numbers OL685734 and OL685736 for BYDV-PAV; and OL685735 and OL685737 for CYDV-RPV. BLASTn analysis of CPG sequences of four isolates shared high nucleotide homology with their intraspecies isolates, with 97.35-98.67% for two BYDV-PAV and 97.72-97.89 for two CYDV-RPV. The consensus tree constructed classified B/CYDV-associated wheat viruses with their phylogenetically closest individuals from Turkey and the world. This survey is the first report of BYDV-PAV and CYDV-RPV associated with wheat plants in Şırnak Province of Turkey. Keywords: BYDVs; Coat protein gene; Incidence; Sequencing; Şırnak

Evolution and biogeography of apple stem grooving virus

BackgroundApple stem grooving virus (ASGV) has a wide host range, notably including apples, pears, prunes and citrus. It is found worldwide.MethodIn this study, two near complete genomes, and seven coat protein (CP) sequences of Iranian isolates from apple were determined. Sequences added from GenBank provided alignments of 120 genomic sequences (54 of which were recombinant), and 276 coat protein genes (none of them recombinant).ResultThe non-recombinant genomes gave a well supported phylogeny with isolates from diverse hosts in China forming the base of the phylogeny, and a monophyletic clade of at least seven clusters of isolates from around the world with no host or provenace groupings among them, and all but one including isolates from China. The six regions of the ASGV genome (five in one frame, one − 2 overlapping) gave significantly correlated phylogenies, but individually had less statistical support. The largest cluster of isolates contained those from Iran and had isolates with worldwide provenances, and came from a wide range of mono- and dicotyledonous hosts. Population genetic comparisons of the six regions of the ASGV genome showed that four were under strong negative selection, but two of unknown function were under positive selection.ConclusionASGV most likely originated and spread in East Asia in one or more of various plant species, but not in Eurasia; the ASGV population of China had the greatest overall nucleotide diversity and largest number of segregating sites.

Global Population Structure of Apple Mosaic Virus (ApMV, Genus Ilarvirus).

The gene sequence data for apple mosaic virus (ApMV) in NCBI GenBank were analyzed to determine the phylogeny and population structure of the virus at a global level. The phylogenies of the movement protein (MP) and coat protein (CP) genes, encoded by RNA3, were shown to be identical and consisted of three lineages but did not closely correlate with those of P1 and P2, suggesting the presence of recombinant isolates. Recombination Detection Program (RDP v.4.56) detected significant recombination signal in the P1 region of K75R1 (KY883318) and Apple (HE574162) and the P2 region of Apple (HE574163) and CITH GD (MN822138). Observation on several diversity parameters suggested that the isolates in group 3 had higher divergence among them, compared to isolates in groups 1 and 2. The neutrality tests assigned positive values to P1, indicating that only this region experiencing balanced or contracting selection. Comparisons of the three phylogroups demonstrated high Fixation index (FST) values and confirmed genetic separation and the lack of gene flow among them. Additionally, ±500 bp of partial MP + 'intergenic region' + partial CP coding regions of two Turkish isolates from apple and seven from hazelnut were sequenced and determined that their phylogenetic positions fell within group 1 and 3, respectively.

Cucumber mosaic virus and turnip mosaic virus occurrence in garlic mustard in Ukraine

Garlic mustard (Alliaria petiolata) is an herbaceous biennial plant native to Europe. In Ukraine, in addition to becoming a serious invader, garlic mustard can serve as a host to several viruses, which may affect agricultural crops. In view of this, the purpose of the study was to identify the virome of garlic mustard growing in Ukraine. Plant samples collected in Kyiv regions were tested for the presence of cucumber mosaic virus (CMV), turnip mosaic virus (TuMV), turnip yellow mosaic virus (TYMV), watermelon mosaic virus II (WMV), and turnip crinkle virus (TCV) by serological and/or molecular methods. According to the results found in the present study, symptomatic A. petiolata obtained in 2021 were infected with CMV (60%), TuMV (20%), or co-infected with CMV + TuMV (20%). TYMV, WMV II, and TCV were not detected in any of the collected samples. The cDNA fragments encoded the coat protein (CP) gene of CMV and TuMV were sequenced and named as CMV-Ap and TuMV-Ap, respectively. In phylogenetic analysis, the CMV-Ap closely resembled the German isolate MW582807 (Sarracenia sp.), with 99.8% nucleotide identity and belongs to subgroup II of CMV. In the phylogenetic tree, TuMV-Ap clustered with isolates AP017803, AP017764, AP017791, and JQ073722, and represented the highest identity (98.6%) to Iranian isolate IRNTRa9 (AP017803) from Rapistrum rugosum and Turkish isolate TUR49 (AP017872) from Raphanus raphanistrum. The sequences of CMV-Ap and TuMV-Ap were deposited in the GenBank under Accession Numbers MZ540213 and OM799323, respectively. The results obtained in the study indicate the important role of infected garlic mustard as alternative host and natural reservoir of CMV and TuMV from which these economically important viruses can spread to other wild and cultivated plants. This is the first molecular evidence of TuMV infection in A. petiolata from Ukraine.

One-step Reverse Transcription-LoopMediated Isothermal Amplification (RT-LAMP) for closed-tube colorimetric detection of banana bract mosaic virus in Banana (Musa spp.).

The banana bract mosaic virus (BBrMV) is a major virus affecting bananas and plantains. Banana being propagated vegetatively, there arises a high risk of virus transmission through planting materials. Available molecular detection technique like the Reverse Transcriptase Polymerase Chain Reaction needs post-amplification sample handling, predisposing to sample cross contamination. A one-step Reverse Transcription-LoopMediated Isothermal Amplification (RT-LAMP) assay coupled with colorimetric detection was optimised for easy and quick detection of BBrMV in banana. The viral coat protein gene was amplified under isothermal conditions at 65 ºC. The RT-LAMP assay was optimised with respect to concentrations of MgSO4, dNTP, Bst polymerase enzyme and HNB dye. The total RNA purified from symptomatic samples was directly amplified under isothermal conditions by including 100 U M-MLV reverse transcriptase and 20 U RNasin® plus RNase inhibitor in the reaction. With the addition of 120µM of Hydroxy Naphthol Blue (HNB) dye in the RT-LAMP reaction, the BBrMV-positive samples had a colour change from violet to sky blue after the reaction. The RT-LAMP assay detected BBrMV in 0.1pg of total RNA isolated from symptomatic plants. Molecular characterisation of RT-LAMP products was done using restriction profiling and sequence analysis. The RT-LAMP assay was validated using field-collected banana leaf samples. The assay successfully detected the virus from symptomatic samples while the healthy samples showed no amplification. Samples sourced from banana plants with symptoms of banana bunchy top virus, banana streak virus and cucumber mosaic virus tested negative in the RT-LAMP assay, thus ensuring the specificity of the assay.