Gene Expression In Colonic Mucosa Research Articles

Paneth Cell TCF4 Deficiency Alters Gut Microbiota and Host Tissue Gene Expression

Introduction: The mucosal immune system is crucial in regulating gut microbiota composition. Paneth cells, the specialized secretory cells in the small intestine, produce α-defensins that regulate gut microbiota. The Wnt signaling pathway with T-cell factor-4 (TCF4) as the terminal signaling molecule regulates Paneth cell differentiation and function. Wnt signaling plays a role in Paneth cell α-defensin expression. TCF4 binds to the α-defensin promoter and increases the transcriptional activity. In this study, we investigated the role of Paneth cell TCF4 in regulating gut microbiota and the host intestinal gene expression. Materials and methods: We generated the Paneth cell-specific TCF4 knockout mice by crossing Tcf4flox/flox mice with the Defa6Cre mice. Tcf4flox/flox-Defa6Cre (KO) were compared with Tcf4flox/flox and Defa6Cre mice (WT). Colonic flushing from these mice was subjected to metatranscriptomics, metagenomics, and proteomics. Colonic tissue was analyzed for transcriptomics. Plasma lipopolysaccharide (LPS) was measured to evaluate endotoxemia. Intestinal mucosal inflammatory response and Paneth cell function were assessed by RT-PCR for cytokines, defensins, and lysozyme. Bioinformatics was applied to assess the taxonomic diversity and functional activity of the gut microbiome, colonic luminal peptides, and colonic mucosal gene expression. Results: The metatranscriptome profile of colonic contents showed an altered microbial diversity in KO mice compared to WT mice. PCoA analyses indicated that the microbial composition in the three strains was distinctly different from each other. At the phylum level, Proteobacteria and viruses such as Pisuviricota, Cressdnaviricota, and Artiverviricota were higher in KO mice than in WT mice. LEfSe analyses showed that the abundance of numerous bacterial and viral populations, such as Firmicutes, Clostridia, and Geminiviridae, was high in KO mice. Functional profiling further confirmed the alteration of microbial diversity in the KO mice. The increased abundance of bacteria in KO mice was related to human diseases, infectious diseases, and bacterial toxin production. Proteomic analyses indicated that nearly 36% of proteins identified in the KO mice were significantly altered compared to WT mice. The Reactome analyses indicated that the altered proteins in the KO mice were related to the immune system, cell cycle, cell signaling, and protein metabolism. RT-PCR of intestinal tissue showed that the expression of Defa6, lysozyme, and Reg3γ was low in KO mice compared to WT mice. On the other hand, the expression of IL-1β, IL-6, and MCP1 in the intestine was higher in KO mice compared to WT mice. These changes in microbiota and mucosa in the KO mice were associated with increased plasma LPS. Finally, there was a significant sex-dependent differences in the Paneth TCF4 activity on gut microbiota, intestinal gene expression and endotoxemia. Conclusion: This study indicates that the Paneth cell TCF4 is essential in regulating the gut microbial composition and host intestinal gene expression. NIH/NIAID, UO1-AI170019 and U01-AI172991. This is the full abstract presented at the American Physiology Summit 2024 meeting and is only available in HTML format. There are no additional versions or additional content available for this abstract. Physiology was not involved in the peer review process.

Socializing Models During Lactation Alter Colonic Mucosal Gene Expression and Fecal Microbiota of Growing Piglets.

The enrichment of the social environment during lactation alleviates the stress of weaned piglets. It is significant to understand how the enriched social environment improves the weaning stress of piglets. RNA sequencing (RNA-seq) of colonic mucosa, 16S rRNA sequencing of feces, and short-chain fatty acids (SCFAs) of colonic content were used to determine the effects of social contact during lactation. In this study, thirty litter lactating piglets were divided into intermittent social contact (ISC) group that contacted with neighbors intermittently, continuous social contact (CSC) group that contacted with neighbors starting at day (D) 14 after birth, and control (CON) group in which piglets were kept in their original litter. The piglets were weaned at D35 and regrouped at D36. The colonic mucosal RNA-seq, fecal microbes, and SCFAs of colonic contents of 63-day-old piglets were analyzed. The results of RNA-seq showed that compared with the CON group, the pathways of digestion and absorption of minerals, protein, and vitamins of piglets were changed in the ISC group, whereas the pathways of retinol metabolism and nitrogen metabolism in the colonic mucosal were affected and stimulated the immune response in the CSC group. Compared with the CON group, the abundances of pernicious microorganisms (Desulfovibrio, Pseudomonas, Brevundimonas, etc.) in the CSC group and pernicious microorganisms (Desulfovibrio, Neisseria, Sutterella, etc.) and beneficial bacteria (Bifidobacterium, Megamonas, and Prevotella_9) in the ISC group were significantly higher (p < 0.05). The abundances of proinflammatory bacteria (Coriobacteriaceae_unclassified, Coprococcus_3, and Ruminococcus_2) in the CSC group were significantly increased (p < 0.05), but the abundances of SCFAs producing bacteria (Lachnospiraceae_UCG-010, Parabacteroides, Anaerotruncus, etc.) and those of anti-inflammatory bacteria (Eubacterium, Parabacteroides, Ruminiclostridium_9, and Alloprevotella) were significantly reduced (p < 0.05) in the CSC group. Compared with the CON group, the concentrations of microbial metabolites, acetate, and propionate in the colonic contents were reduced (p < 0.05) in the ISC group, whereas the concentration of acetate was reduced (p < 0.05) in the CSC group. Therefore, both ISC and CSC during lactation affected the composition of fecal microbes and changed the expression of intestinal mucosal genes related to nutrient metabolism and absorption of piglets.

Downregulated Mucosal Autophagy, Alpha Kinase-1 and IL-17 Signaling Pathways in Active and Quiescent Ulcerative Colitis.

BackgroundImproved mucosal immune profiling in active and quiescent colonic inflammatory bowel disease (IBD) is needed to develop therapeutic options for treating and preventing flares. This study therefore aimed to provide a comprehensive mucosal characterization with emphasis on immunological host response of patients with active ulcerative colitis (UC active), UC during remission (UC remission) and active colonic Crohn’s disease (CD active).MethodsColonic biopsies from 47 study subjects were collected for gene expression and pathway analyses using the NanoString host-response panel, including 776 genes and 56 immune-related pathways.ResultsThe majority of mucosal gene expression and signaling pathway scores were increased in active IBD (n=27) compared to healthy subjects (n=10). However, both active IBD and UC remission (n=10) demonstrated decreased gene expression and signaling pathway scores related to autophagy, alpha kinase-1 and IL-17 signaling pathways compared to healthy subjects. Further, UC remission was characterized by decreased scores of several signaling pathways linked to homeostasis along with increased mononuclear cell migration pathway score as compared to healthy subjects. No major differences in the colonic mucosal gene expression between CD active (n=7) and UC (n=20) active were observed.ConclusionThis study indicates that autophagy, alpha kinase-1 and IL-17 signaling pathways are persistently downregulated in UC irrespective of disease activity. Further, UC patients in remission present a unique mucosal environment, potentially preventing patients from reaching and sustaining true homeostasis. These findings may enable better comprehension of the remitting and relapsing pattern of colonic IBD and guide future treatment and prevention of flares.

Effects of Colesevelam on Bowel Symptoms, Biomarkers, and Colonic Mucosal Gene Expression in Patients With Bile Acid Diarrhea in a Randomized Trial

Approximately one-third of patients with IBS-diarrhea (IBS-D) have increased bile acid (BA) synthesis or excretion. An open-label study showed benefits of colesevelam on bowel functions, consistent with luminal BA sequestration by colesevelam. We compared the effects of colesevelam vs placebo on symptoms and gene expression patterns in the sigmoid colon mucosa in patients with BA diarrhea associated with IBS-D. We performed a double-blind, parallel-group study of 30 adults with IBS-D and evidence of increased BA synthesis or fecal excretion, from December 2017 through December 2018 at a single center. Patients were randomly assigned (1:1) to groups given colesevelam (3 tablets, 625 mg each) or matching placebo, orally twice daily for 4 weeks. Stool diaries documented bowel functions for 8 days before and 28 days during colesevelam or placebo. Stool and fasting serum samples were collected for analyses of fecal BAs and serum levels of C4 and FGF19. We measured colonic transit by scintigraphy, mucosal permeability by invivo excretion of saccharide probes, and mRNA levels in rectosigmoid biopsies. All measurements were made at baseline and on the last days of treatment. The primary endpoints were change in total fecal BA concentration and stool consistency. Compared with placebo, colesevelam was associated with significant changes in sequestered fecal total BA excretion (P < .001) and serum levels of C4 and FGF19 (both P < .001), and with a mean increase in fecal level of deoxycholic acid (10%; P = .07) compared to placebo. Colesevelam decreased colon mucosal expression of NR1H4 and P2RY4 and increased expression of GPBAR1, compared with baseline. Stool frequency and consistency, colonic transit, and permeability did not differ significantly between groups. Colesevelam was well tolerated. In a randomized trial, we found that colesevelam increases delivery of total and secondary BAs to stool, hepatic BA synthesis, and colonic mucosal expression of genes that regulate BA, farnesoid X, and GPBAR1 receptors. Larger studies are needed to determine the effects on clinical responses. ClinicalTrials.gov no: NCT03270085.

OP09 Immunomodulatory mechanisms of faecal microbiota transplantation are associated with clinical response in ulcerative colitis: early results from STOP-Colitis

Abstract Background Studies of faecal microbiota transplantation (FMT) for treating ulcerative colitis (UC) have shown promising results. Mechanisms by which FMT modulates inflammation, however, remain unexplored. Through a prospective, open-label pilot of FMT in UC (STOP-Colitis) we conducted a sub-study to explore changes in host colonic mucosal immune cell subsets and gene expression following FMT. Methods Patients in this study received eight infusions of FMT over an 8-week period. Colon biopsies and blood were obtained at baseline and at the end of the study. Immunophenotyping of colonic lamina propria mononuclear cells (LPMC) and peripheral blood mononuclear cells (PBMC) was conducted. RNA sequencing was performed on colon biopsies for differential gene expression analysis followed by multi-omic integration. Results Seventeen patients were recruited to this sub-study; of which, 12 completed 8 weeks of FMT per protocol. Response (reduction in MAYO score) was seen in 67% (8/12) of patients. Analysis of colonic LPMC populations revealed a significant increase in regulatory T cells (Tregs, CD4+CD25+CD127lowFoxP3+; Δ 5.02%; p &amp;lt; 0.01), especially effector memory Treg subset (CD4+CD25+CD127-CCR7-CD45RA-; Δ 12%; p &amp;lt; 0.001), gut homing Tregs (CD4+CD25+CD127-CCR7-CD45RA-α4+; Δ 18.55%; p &amp;lt; 0.01) and IL-10 producing CD4 cells (Δ 2.16%; p = 0.04) in responders following FMT. Along with this, there was a significant reduction in mucosal Th17 cell (CD4+CD161+CCR6+; Δ −7.61%; p = 0.017), IL-17 producing CD4 cell (Δ −7.69%; p = 0.05) and CD8 cell (Δ -5.18%; p = 0.04) populations in FMT responders. Colonic mucosal gene expression and pathway analysis demonstrated that response to FMT was associated with significant downregulation of host antimicrobial defence response mainly REG and defensin family of anti-microbial peptides, pathogen-associated molecular pattern binding receptors, proteases, multiple MHC class II genes associated with antigen presentation and proinflammatory immune pathways. There was a significant upregulation of butanoate and propionate metabolic pathways in FMT responders. Analysis of PBMC revealed a significant increase in IL-10 producing CD4 cells suggesting that induction of peripheral immune tolerance is preferentially compartmentalised to the gut mucosa. Conclusion Response to FMT is associated with a significant increase in mucosal gut homing Tregs and butanoate metabolism along with a reduction in Th17 cells and multiple anti-microbial defence and proinflammatory pathways. FMT induces change in immune balance in local milieu which leads to clinical response in UC. Exploring microbial mediators in FMT which influence immunometabolism is now under investigation to underpin novel biotherapeutic approaches.

Hermetia illucens larvae as a potential dietary protein source altered the microbiota and modulated mucosal immune status in the colon of finishing pigs

BackgroundInsects, such as Hermetia illucens larvae, are rich in chitin and proteins, and represent a suitable feed ingredient replacement for animals. However, little is known about the effect of administering H. illucens larvae on intestinal microbiota, bacterial metabolite profiles, and mucosal immune status in animals. This study aimed to investigate the effects of administering H. illucens larvae on colonic microbiota and bacterial metabolites production in finishing pigs. Seventy-two crossbred (Duroc × Landrace × Large White) female pigs (initial body weight, 76.0 ± 0.52 kg) were randomly allocated to three different dietary treatments: a control diet (Control group) and two diets corresponding to 4% (H1 group) and 8% (H2 group) H. illucens larvae inclusion levels, respectively. Each treatment consisted of eight pens (replicates), with three pigs per pen. After 46 days of feeding, eight pigs per treatment (n = 8) were slaughtered, and the colonic digesta and mucosa were collected for microbial composition and microbial fermentation products, and genes expression analyses.ResultsThe results showed that the H1 diet significantly increased the abundance of Lactobacillus, Pseudobutyrivibrio, Roseburia, and Faecalibacterium compared with those in the control group (P < 0.05), with a decrease in the abundance of Streptococcus. The numbers of Lactobacillus, Roseburia, and Clostridium cluster XIVa were significantly greater in the H1 group than in the control group (P < 0.05). Meanwhile, H2 diet increased the number of Clostridium cluster XIVa compared with the control group (P < 0.05). For colonic metabolites, total short chain fatty acids, butyrate, and isobutyrate concentrations were significantly higher in the H1 group than those in the control group (P < 0.05); the H1 treatment caused a striking decrease in protein fermentation compared with the control group, as the concentrations of total amines, cadaverine, tryptamine, phenol, p-cresol, and skatole were significantly lower (P < 0.05). Additionally, H2 diet also increased butyrate concentration compared with control group (P < 0.05), while decreased the concentrations of phenol, p-cresol, and skatole (P < 0.05). Pigs in the H1 group down-regulated the expression of TLR-4 and pro-inflammatory cytokines (IFN-γ) compared with pigs in the control group (P < 0.05), and up-regulated anti-inflammatory cytokine (IL-10) and intestinal barrier genes (ZO-1, occludin, and mucin-1). H2 diet up-regulated the expression of ZO-1 compared with control group (P < 0.05). Furthermore, the changes in the colonic mucosal gene expression were associated with changes in the bacterial composition and their metabolites.ConclusionsCollectively, dietary inclusion of Hermetia illucens larvae may enhance mucosal immune homeostasis of pigs via altering bacterial composition and their metabolites. These findings provide a new perspective on insect meal as a sustainable protein source rich in nutrient ingredients for swine.

P164 FOX04 gene expression in colonic mucosa is a potential marker associated with histological remission in patients with ulcerative colitis

Background: Ulcerative colitis (UC) is a chronic and inflammatory disease that affects the colon of unknown etiology. The genetics factors play an important role in the pathogenesis of UC. FOX04 is a transcription factor that regulates the immune response by inhibition of nuclear factor kappa B (NF-kB). The NF-kB regulates the expression of pro-inflammatory cytokines and proteins from tight junctions such as occludins. The aim of this study was to measure the gene expression of FOX04 in patients with UC and normal controls as well as to determine their association with clinical outcomes. Methods: We included a total of 37 patients with confirmed diagnosis of UC and 20 controls without endoscopic evidence of any type of colitis or neoplasia. All colonic biopsies were taken by colonoscopy. The histological remission was defined according Riley and Geboes index. The relative quantification of the gene expression was performed by real time PCR for FOX04: forward: cgagggactggacttcaact; reverse: ggctcaagggtaaagagtagatatga and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH): reverse 3'-agccacatcgctcagacac and forward 5'-gcccaatacgaccaaatcc, as housekeeping gene was analyzed for normalization. Statistical analysis was performed using the program SPSS Ver. 17.Statistical significance was considered when P value was <0.05. Results: Of the 37 patients with UC (17 male and 20 female) with a mean age at diagnosis of 42 years and 20 normal control individuals with a mean age of 44 years. Regarding to the UC group, 22 had histological activity and the remaining 15 UC patients were on histological remission. The extent of UC was pancolitis (74%), distal colitis (23%) and left side colitis (3%) and clinical course was distributed as follows: 37% were initially active and then inactive; 30% had intermittent activity and 33% had continuous activity. The gene expression of FOX04 was increased in patients with remission UC compared to active UC patients (p<0.002) and normal control group (p<0.001). No significant differences were found between patients with active UC and normal controls. The overexpression of FOX04 gene was associated significantly with histological remission (p<0.05, OR=8.5, 95% CI: 0.83–87.8). Conclusions: The gene expression of FOX04 in colonic mucosa was increased in patients with remission UC. FOX04 could be a potential marker of histological remission and its over-expression in remission UC might suggest an anti-inflammatory mechanism as inhibitor of the production of NF kappa B.

Overexpression of GRß in colonic mucosal cell line partly reflects altered gene expression in colonic mucosa of patients with inflammatory bowel disease

The glucocorticoid receptor (GR) plays a crucial role in inflammatory responses. GR has several isoforms, of which the most deeply studied are the GRα and GRß. Recently it has been suggested that in addition to its negative dominant effect on GRα, the GRß may have a GRα-independent transcriptional activity. The GRß isoform was found to be frequently overexpressed in various autoimmune diseases, including inflammatory bowel disease (IBD). In this study, we wished to test whether the gene expression profile found in a GRß overexpressing intestinal cell line (Caco-2GRß) might mimic the gene expression alterations found in patients with IBD. Whole genome microarray analysis was performed in both normal and GRß overexpressing Caco-2 cell lines with and without dexamethasone treatment. IBD-related genes were identified from a meta-analysis of 245 microarrays available in online microarray deposits performed on intestinal mucosa samples from patients with IBD and healthy individuals. The differentially expressed genes were further studied using in silico pathway analysis. Overexpression of GRß altered a large proportion of genes that were not regulated by dexamethasone suggesting that GRß may have a GRα-independent role in the regulation of gene expression. About 10% of genes differentially expressed in colonic mucosa samples from IBD patients compared to normal subjects were also detected in Caco-2 GRß intestinal cell line. Common genes are involved in cell adhesion and cell proliferation. Overexpression of GRß in intestinal cells may affect appropriate mucosal repair and intact barrier function. The proposed novel role of GRß in intestinal epithelium warrants further studies.

Colonic mucosal gene expression and genotype in irritable bowel syndrome patients with normal or elevated fecal bile acid excretion.

The mucosal gene expression in rectosigmoid mucosa (RSM) in irritable bowel syndrome with diarrhea (IBS-D) is unknown. Our objectives were, first, to study mRNA expression [by RT(2) PCR of 19 genes pertaining to tight junctions, immune activation, intestinal ion transport and bile acid (BA) homeostasis] in RSM in IBS-D patients (n = 47) and healthy controls (n = 17) and study expression of a selected protein (PDZD3) in 10 IBS-D patients and 4 healthy controls; second, to assess RSM mRNA expression according to genotype and fecal BA excretion (high ≥ 2,337 μmol/48 h); and third, to determine whether genotype or mucosal mRNA expression is associated with colonic transit or BA parameters. Fold changes were corrected for false detection rate for 19 genes studied (P < 0.00263). In RSM in IBS-D patients compared with controls, mRNA expression of GUC2AB, PDZD3, and PR2Y4 was increased, whereas CLDN1 and FN1 were decreased. One immune-related gene was upregulated (C4BP4) and one downregulated (CCL20). There was increased expression of a selected ion transport protein (PDZD3) on immunohistochemistry and Western blot in IBS-D compared with controls (P = 0.02). There were no significant differences in mucosal mRNA in 20 IBS-D patients with high compared with 27 IBS-D patients with normal BA excretion. GPBAR1 (P < 0.05) was associated with colonic transit. We concluded that mucosal ion transport mRNA (for several genes and PDZD3 protein) is upregulated and barrier protein mRNA downregulated in IBS-D compared with healthy controls, independent of genotype. There are no differences in gene expression in IBS-D with high compared with normal fecal BA excretion.

Mo1744 Ulcerative Colitis Patients With Endoscopic Healing After Infliximab or Vedolizumab Therapy Have Persistent Dysregulation in Colonic Mucosal Gene Expression

Mo1744 Ulcerative Colitis Patients With Endoscopic Healing After Infliximab or Vedolizumab Therapy Have Persistent Dysregulation in Colonic Mucosal Gene Expression

DOP075. Persistent dysregulated colonic mucosal gene expression in ulcerative colitis patients with endoscopic healing after infliximab or vedolizumab therapy

DOP075. Persistent dysregulated colonic mucosal gene expression in ulcerative colitis patients with endoscopic healing after infliximab or vedolizumab therapy

Antioxidant and Anti-inflammatory Effects of Yam (Dioscorea batatas Decne.) on Azoxymethane-induced Colonic Aberrant Crypt Foci in F344 Rats.

Yam (Dioscorea batatas Decne.) has long been used as a health food and oriental folk medicine because of its nutritional fortification, tonic, anti-diarrheal, anti-inflammatory, antitussive, and expectorant effects. Reactive oxygen species (ROS), which are known to be implicated in a range of diseases, may be important progenitors of carcinogenesis. The aim of this study was to investigate the modulatory effect of yam on antioxidant status and inflammatory conditions during azoxymethane (AOM)-induced colon carcinogenesis in male F344 rats. We measured the formation of aberrant crypt foci (ACF), hemolysate antioxidant enzyme activities, colonic mucosal antioxidant enzyme gene expression, and colonic mucosal inflammatory mediator gene expression. The feeding of yam prior to carcinogenesis significantly inhibited AOM-induced colonic ACF formation. In yam-administered rats, erythrocyte levels of glutathione, glutathione peroxidase (GPx), and catalase were increased and colonic mucosal gene expression of Cu/Zn-superoxide dismutase (SOD), Mn-SOD, and GPx were up-regulated compared to the AOM group. Colonic mucosal gene expression of inflammatory mediators (i.e., nuclear factor kappaB, inducible nitric oxide synthase, cyclooxygenase-2, tumor necrosis factor alpha, and interleukin-1beta) was suppressed by the yam-supplemented diet. These results suggest that yam could be very useful for the prevention of colon cancer, as they enhance the antioxidant defense system and modulate inflammatory mediators.

Evaluation of selected cytokine gene expression in colonic mucosa from dogs with idiopathic lymphocytic-plasmacytic colitis.

ABSTRACTLymphocytic-plasmacytic colitis (LPC) is a common form of inflammatory bowel disease (IBD) affecting the canine large intestine. Cytokines are thought to be involved in the pathogenesis of IBD. However, to date, few studies have investigated cytokine mRNA expression in dogs with LPC. In this study, we investigated mRNA transcription levels of T helper cell cytokines, such as IFN-γ, IL-4, IL-17 and IL-10 and pro-inflammatory cytokines, such as IL-1β, IL-6, TNF-α, IL-8, IL-12 and IL-23, in colonic mucosa from LPC dogs by quantitative real-time RT-PCR. No significant differences were detected in cytokine mRNA expressions between dogs with LPC and controls, except for IL-23p19. Dogs with LPC failed to express a predominant cytokine profile in inflamed colonic mucosa as opposed to human IBD.

Guanylate Cyclase C Deficiency Causes Severe Inflammation in a Murine Model of Spontaneous Colitis

BackgroundGuanylate Cyclase C (GC-C; Gucy2c) is a transmembrane receptor expressed in intestinal epithelial cells. Activation of GC-C by its secreted ligand guanylin stimulates intestinal fluid secretion. Familial mutations in GC-C cause chronic diarrheal disease or constipation and are associated with intestinal inflammation and infection. Here, we investigated the impact of GC-C activity on mucosal immune responses.MethodsWe utilized intraperitoneal injection of lipopolysaccharide to elicit a systemic cytokine challenge and then measured pro-inflammatory gene expression in colonic mucosa. GC-C+/+ and GC-C−/− mice were bred with interleukin (IL)-10 deficient animals and colonic inflammation were assessed. Immune cell influx and cytokine/chemokine expression was measured in the colon of wildtype, IL-10−/−, GC-C+/+IL-10−/− and GC-C−/−IL-10−/− mice. GC-C and guanylin production were examined in the colon of these animals and in a cytokine-treated colon epithelial cell line.ResultsRelative to GC-C+/+ animals, intraperitoneal lipopolysaccharide injection into GC-C−/− mice increased proinflammatory gene expression in both whole colon tissue and in partially purified colonocyte isolations. Spontaneous colitis in GC-C−/−IL-10−/− animals was significantly more severe relative to GC-C+/+IL-10−/− mice. Unlike GC-C+/+IL-10−/− controls, colon pathology in GC-C−/−IL-10−/− animals was apparent at an early age and was characterized by severely altered mucosal architecture, crypt abscesses, and hyperplastic subepithelial lesions. F4/80 and myeloperoxidase positive cells as well as proinflammatory gene expression were elevated in GC-C−/−IL-10−/− mucosa relative to control animals. Guanylin was diminished early in colitis in vivo and tumor necrosis factor α suppressed guanylin mRNA and protein in intestinal goblet cell-like HT29-18-N2 cells.ConclusionsThe GC-C signaling pathway blunts colonic mucosal inflammation that is initiated by systemic cytokine burst or loss of mucosal immune cell immunosuppression. These data as well as the apparent intestinal inflammation in human GC-C mutant kindred underscore the importance of GC-C in regulating the response to injury and inflammation within the gut.

Cytokine gene expression in intestinal tuberculosis and Crohn's disease

Intestinal tuberculosis (TB) and Crohn's disease closely resemble each other clinically and morphologically. Little is known of cytokine regulation in intestinal TB. To compare cytokine gene expression in colonic mucosa and peripheral blood mononuclear cells (PBMC) in TB with that in Crohn's disease. Biopsies were obtained from normal and ulcerated colonic mucosa of 12 intestinal TB and 11 Crohn's disease patients, and PBMC from 15 intestinal TB and 12 Crohn's disease patients and 11 healthy volunteers. RNA was extracted, and the expression of selected cytokines, chemokines and pattern recognition receptors quantified by reverse transcriptase real-time polymerase chain reaction using SYBR green. The mRNA expression of interleukin-8 (IL-8), induced protein-10, tumour necrosis factor-alpha, IL-23 p19 and IL-12 p40, and Toll-like receptors (TLR) 1 and 2 in the ulcerated mucosa was increased in both intestinal TB and Crohn's disease. Expression of growth-related oncogene-alpha was increased in intestinal TB, while expression of interferon-gamma (IFN-) and TLR 4, 5 and 9 was increased in Crohn's disease. Expression of RANTES (regulated upon activation, normal T-cell expressed and secreted) was decreased in Crohn's disease. Secretion of IFN- or IL-10 from PBMC was not significantly altered in either disease. PBMC mRNA expression of IL-1, IL-6 and IL-8 mRNA was upregulated in Crohn's disease, while that of IL-17 was upregulated in intestinal TB. Cytokine gene expression patterns in intestinal mucosa and PBMC of intestinal TB were remarkably similar to Crohn's disease, and demonstrated innate immune activation and T-helper 1 polarisation.

Su1167 The Ultrasensitive C Reactive Protein (hs CRP) Is a Relapse Marker in Patients With Ulcerative Colitis and Correlates With the IL-6 Gene Expression in Colonic Mucosa

Su1167 The Ultrasensitive C Reactive Protein (hs CRP) Is a Relapse Marker in Patients With Ulcerative Colitis and Correlates With the IL-6 Gene Expression in Colonic Mucosa

Differential expression of occludin in patients with ulcerative colitis and healthy controls

To the Editor: The etiology of inflammatory bowel disease (IBD) remains unknown. However, it has been postulated that IBD patients have a disruption of the intestinal barrier integrity that facilitates the trigger of an intestinal pathological process after exposure to several exogenous antigens. Barrier function is highly regulated, allowing the epithelium to control transmucosal permeability to solutes, water, and electrolytes. Occludin (OCLN) has a large cytoplasmic extension that may coordinate with the tight junctional complex, comprising a large number of membrane-associated proteins. OCLN is the first integral tight junction protein and the most ubiquitously expressed at the apical-most membranes. In order to confirm the contribution of OCLN gene in the pathogenesis of ulcerative colitis (UC), this is the first study to our best knowledge that explores the OCLN gene expression in colonic mucosa from patients with UC. We measured the OCLN gene expression from colonic biopsies of UC patients from September 2010 to July 2011. We studied a total of 54 individuals divided into three groups: 1) active UC (n 1⁄4 20); 2) remission UC (n 1⁄4 16); and 3) a healthy control group (n 1⁄4 18). Expression of mRNA OCLN was measured with the realtime polymerase chain reaction (RTPCR) method. The following primers were used: OCLN forward ggatgagc aatgccctttag and reverse aggaaccgaga gccaggt; and GADPH: forward gcccaa tacgaccaaatcc and reverse agccacatcgct cagaca for normalization. The OCLN mRNA expression was significantly decreased from colonic mucosa in UC remission patients as compared with the healthy control group (P 1⁄4 0.0001). Differential levels of expression were found between active and remission UC groups in OCLN gene expression, where active UC had significantly increased levels of OCLN compared to UC in remission (P 1⁄4 0.026), as shown in Figure 1. Our findings confirmed the potential role of OCLN in the pathogenesis of UC. This differential expression of OCLN between active and remission UC patients could be explained by the maintenance of epithelial cell polarity of the tight junction during the inflammatory process. Other proteins involved in the tight junction, like claudin-1 and claudin-2, were increased in patients with active IBD. In conclusion, expression of OCLN was elevated in colonic mucosa from the active UC compared to UC in remission and healthy control groups. Jesus K. Yamamoto-Furusho, MD, PhD, MSc Edgar J. Mendivil-Rangel, BS Gabriela Fonseca-Camarillo, PhD Inflammatory Bowel Disease Clinic Department of Gastroenterology Instituto Nacional de Ciencias Medicas y Nutricion Salvador Zubiran, Mexico

Evolution of Endoscopic Activity Scores in Patients With Crohn's Disease Under Azathioprine and/or Infliximab: A Post-Hoc Analysis of the Sonic Data

Background: Genetic polymorphisms in the carnitine organic cation transporter (OCTN) and mutations in disc large homologue 5 (DLG5) have been associated with the development of Crohn Disease (CD). Preliminary functional studies have demonstrated that the OCTN1/ 2 variants resulted in impaired transporter function of various organic cations and carnitine, however, no previous studies have explored the expression of these genes in the mucosa from patients with ulcerative colitis (UC). Aim: To study the DLG5, OCTN1 and OCTN2 gene expression in colonic mucosa from patients with UC. Material and Methods: We studied the DLG5 gene expression from colonic biopsies of UC patients from August 2009 to July 2010. All individuals were divided in 3 groups: 1) Active UC (n=25); 2) Quiescent UC (n= 20); and 3) Healthy Control group (n=24). Expression of mRNA DLG5, OCTN1 and OCTN2 were measured by Real Time Polymerase Chain Reaction (RT-PCR) method. The following primers were used: DLG5: left tccagtagtgattcctgctcagt; and right: gagctccggggagagttc; OCTN1: left cggaatattgccataatgacc and right cagagcaaagtaacccactgag; OCTN2: left: gcagtgtccttctcttcatgc and right: gaaaaggcagccgtgactc; GADPH left agccacatcgctcagacac and right gcccaatacgaccaaatcc for normalization. The data analysis was performed by Kruskall-Wallis and Spearman tests using the SSPS Program Version 15.0 for Windows. Results: These results showed that DLG5 mRNA expression was increased from colonic mucosa in patients with active UC as compared to healthy control group (p<0.0001) as well as UC in remission was up-regulated when compared to healthy control group (p<0.0001). No significant differences were found between active and remission UC groups in the DLG5 gene expression. On the other hand, the OCTN1 and OCTN2 gene expression were significantly decreased in active and remission UC patients as compared to healthy normal controls (p=0.001 y p=0.005 respectively). No significant differences were found between active and remission UC groups in the OCTN1 andOCTN2 gene expression. Conclusions: The gene expression of DLG5was found increased in UC patients suggesting that over-expression of DLG5 gene could act as defence mechanism in UC patients with altered intestinal permeability. On the other hand, a decreased gene expression of OCTN1 and OCTN2 genes in UC patients might suggest that both genes are involved in the impaired intestinal permeability.

Classification of Diet-Modulated Gene Signatures at the Colon Cancer Initiation and Progression Stages

The effects of dietary polyunsaturated (PUFAs) and monounsaturated fatty acids (MUFAs) on intestinal cytokinetics within the context of colon cancer initiation and progression have been extensively studied. n-3 PUFAs have received the most attention due to their potential protective role. However, further investigation of the epigenetic perturbations caused by fatty acids in the context of colon cancer development is needed. We used DNA microarrays to identify discriminative gene signatures (gene combinations) for the purpose of classifying n-3 PUFA-fed, carcinogen-injected, Sprague-Dawley rats at the initiation and progression stages. Animals were assigned to three dietary treatments differing only in the type of fat (corn oil/n-6 PUFA, fish oil/n-3 PUFA, or olive oil/n-9 monounsaturated fatty acid). The effects of diet on colonic mucosal gene expression signatures during tumor initiation and progression were subsequently compared (12 h and 10 weeks after azoxymethane injection). Microarray analysis revealed that the number of differentially expressed (DE) genes in each of the three diet comparisons increased with the progression of colon cancer. Each dietary lipid source exhibited its own unique transcriptional profile, as assessed by linear discriminant analysis. Applying this novel approach, we identified the single genes and the two- to three-gene combinations that best distinguished the dietary treatment groups. For the chemoprotective (fish oil) diet, mediators of stem cell homeostasis, e.g., ephrin B1 and bone morphogenic protein 4, were the top-performing gene classifiers. These results suggest that dietary chemoprotective n-3 PUFA impact genes that regulate the colon stem cell niche and tumor evolution.

Mucosal Gene Expression of Cell Adhesion Molecules, Chemokines, and Chemokine Receptors in Patients With Inflammatory Bowel Disease Before and After Infliximab Treatment

Inflammatory bowel disease (IBD) is characterized by a continuous influx of leukocytes into the gut wall. This migration is regulated by cell adhesion molecules (CAMs), and selective antimigration therapies have been developed. This study investigated the effect of infliximab therapy on the mucosal gene expression of CAMs in IBD. Mucosal gene expression of 69 leukocyte/endothelial CAMs and E-cadherin was investigated in 61 IBD patients before and after first infliximab infusion and in 12 normal controls, using Affymetrix gene expression microarrays. Quantitative reverse transcriptase-PCR (qRT-PCR), immunohistochemistry, and western blotting were used to confirm the microarray data. When compared with control colons, the colonic mucosal gene expression of most leukocyte/endothelial adhesion molecules was upregulated and E-cadherin gene expression was downregulated in active colonic IBD (IBDc) before therapy, with no significant colonic gene expression differences between ulcerative colitis and colonic Crohn's disease. Infliximab therapy restored the upregulations of leukocyte CAMs in IBDc responders to infliximab that paralleled the disappearance of the inflammatory cells from the colonic lamina propria. Also, the colonic gene expression of endothelial CAMs and of most chemokines/chemokine receptors returned to normal after therapy in IBDc responders, and only CCL20 and CXCL1-2 expression remained increased after therapy in IBDc responders vs. control colons. When compared with control ileums, the ileal gene expression of MADCAM1, THY1, PECAM1, CCL28, CXCL1, -2, -5, -6, and -11, and IL8 was increased and CD58 expression was decreased in active ileal Crohn's disease (CDi) before therapy, and none of the genes remained dysregulated after therapy in CDi responders vs. control ileums. This microarray study identified a number of interesting targets for antiadhesion therapy including PECAM1, IL8, and CCL20, besides the currently studied α4β7 integrin-MADCAM1 axis. Our data demonstrate that many leukocyte/endothelial CAMs and chemokines/chemokine receptors are upregulated in inflamed IBD mucosa. Controlling the inflammation with infliximab restores most of these dysregulations in IBD. These results show that at least part of the mechanism of anti-tumor necrosis factor-α therapy goes through downregulation of certain adhesion molecules.