Evolution of Endoscopic Activity Scores in Patients With Crohn's Disease Under Azathioprine and/or Infliximab: A Post-Hoc Analysis of the Sonic Data

Abstract

Background: Genetic polymorphisms in the carnitine organic cation transporter (OCTN) and mutations in disc large homologue 5 (DLG5) have been associated with the development of Crohn Disease (CD). Preliminary functional studies have demonstrated that the OCTN1/ 2 variants resulted in impaired transporter function of various organic cations and carnitine, however, no previous studies have explored the expression of these genes in the mucosa from patients with ulcerative colitis (UC). Aim: To study the DLG5, OCTN1 and OCTN2 gene expression in colonic mucosa from patients with UC. Material and Methods: We studied the DLG5 gene expression from colonic biopsies of UC patients from August 2009 to July 2010. All individuals were divided in 3 groups: 1) Active UC (n=25); 2) Quiescent UC (n= 20); and 3) Healthy Control group (n=24). Expression of mRNA DLG5, OCTN1 and OCTN2 were measured by Real Time Polymerase Chain Reaction (RT-PCR) method. The following primers were used: DLG5: left tccagtagtgattcctgctcagt; and right: gagctccggggagagttc; OCTN1: left cggaatattgccataatgacc and right cagagcaaagtaacccactgag; OCTN2: left: gcagtgtccttctcttcatgc and right: gaaaaggcagccgtgactc; GADPH left agccacatcgctcagacac and right gcccaatacgaccaaatcc for normalization. The data analysis was performed by Kruskall-Wallis and Spearman tests using the SSPS Program Version 15.0 for Windows. Results: These results showed that DLG5 mRNA expression was increased from colonic mucosa in patients with active UC as compared to healthy control group (p<0.0001) as well as UC in remission was up-regulated when compared to healthy control group (p<0.0001). No significant differences were found between active and remission UC groups in the DLG5 gene expression. On the other hand, the OCTN1 and OCTN2 gene expression were significantly decreased in active and remission UC patients as compared to healthy normal controls (p=0.001 y p=0.005 respectively). No significant differences were found between active and remission UC groups in the OCTN1 andOCTN2 gene expression. Conclusions: The gene expression of DLG5was found increased in UC patients suggesting that over-expression of DLG5 gene could act as defence mechanism in UC patients with altered intestinal permeability. On the other hand, a decreased gene expression of OCTN1 and OCTN2 genes in UC patients might suggest that both genes are involved in the impaired intestinal permeability.