GenBank Accession Number Research Articles

Green Copper Carbonate Nanoparticles Produced by the Ureolytic Fungus Alternaria sp. Strain ccf7 and Their Antibacterial Activity

Background: Copper carbonate nanoparticles have several applications in the fields of pigments, insecticides, and fungicides. They are also used as catalysts in chemical processes and crude oil desulfurization. Fungi can biosynthesize metal nanoparticles due to their high tolerance, extracellular synthesis, simplicity of extraction, and large-scale exploitation. Objectives: This study aimed to investigate the potential of fungal isolates (which are resistant to copper chloride with urease activity) as biocatalysts for the synthesis of copper carbonate nanoparticles. This approach was considered due to the advantages of using fungal isolates in nanoparticle biosynthesis. Methods: In a PDA culture medium with 25 mM copper chloride, an enrichment culture was used to isolate copper-resistant fungal isolates. Fungal isolates’ urease enzyme was qualitatively assessed using 2% urea agar-based culture media. Studies on the synthesis of copper carbonate nanoparticles and the effect of different parameters on the synthesis of these nanoparticles were conducted using a mycelium-free supernatant strategy. Field emission scanning electron microscope (FESEM), dynamic light scattering (DLS), energy-dispersive X-ray spectroscopy (EDX), and Fourier transform infrared spectroscopy (FTIR) studies were used to determine the properties of calcium carbonate nanoparticles. The selected fungal isolate was identified using macroscopic and microscopic characteristics, as well as molecular analysis using amplification of the ITS1-5.8S-ITS2 gene sequences. Results: Alternaria sp. strain ccf7 (GenBank accession number OP242500) was chosen as the superior strain for copper carbonate nanoparticle synthesis tests based on the pattern of resistance to copper chloride salt and the qualitative assessment of urease activity. Based on the findings of the electron microscope studies, spherical copper carbonate nanoparticles with an average size of 66.7 nm were synthesized after 24 hours of incubation at the optimal concentration of 45 mM copper chloride, temperature of 25°C, and shaker speed of 100 rpm. The distribution of the produced nanoparticles was appropriate, as indicated by a polydispersity index (PDI) of 0.25. The strongest inhibitory impact of these copper carbonate nanoparticles was against Pseudomonas aeruginosa, with an average inhibition of 31 mm at a concentration of 50 mg/L, according to the results of their antibacterial activities. Conclusions: For the first time, the synthesis and development of a green approach for the fabrication of copper carbonate nanoparticles using the genus Alternaria have been proposed in this study.

Genome Sequence of Novel Clostridium perfringens Bacteriophage vB_CpeS-17DYC, Isolated from Wastewater in China.

Phage vB_CpeS-17DYC was isolated from wastewater from a poultry market using Clostridium perfringens strain DYC. The vB_CpeS-17DYC genome is 39,184 bp long, with 65 open reading frames and a GC content of 30.6%. It shared 93.95% nucleotide identity, with 70% query coverage, with Clostridium phage phiCP13O (GenBank accession number NC_019506.1). Virulence factor genes were not found in the vB_CpeS-17DYC genome.

Promising bioactive metabolites of mangrove inhabitant Streptomyces tauricus and prostate cancer PC3 cell inhibition by antimicrobial peptides.

Streptomyces is a group of microbes known for antibiotic production and has contributed to more than 70% of present commercially available antibiotics. These antibiotics are important in the management, protection, and treatment of chronic illnesses. In the present study, the isolated S. tauricus strain from mangrove soil in Mangalore, India (GenBank accession number: MW785875) was subjected for differential cultural characterization, phenotype involving brown pigmentation, filamentous mycelia, and ash-colored spore production was observed using field emission scanning electron microscopy (FESEM) analysis revealing filamentous mycelia possessing a straight spore chain. Spores were visualized as elongated, rod-shaped, smooth surfaces with curved edges. After optimized growth conditions for S. tauricus on starch-casein agar medium, the GC/MS analysis of S. tauricus intracellular extract detected bioactive compounds reported for pharmacological applications. Analyzed using the NIST library, most of the bioactive compounds identified in intracellular extract had molecular weights of less than 1 kDa. On the PC3 cell line, the Sephadex G-10 partially purified eluted peak protein fraction demonstrated significant anticancer activity. The LCMS analysis revealed the presence of Tryprostatin B, Fumonisin B1, Microcystin LR, and Surfactin C with molecular weights below 1 kDa. This study found that small molecular weight microbial compounds are more effective in a variety of biological applications.

The complete chloroplast genome sequence of Phyllostachys incarnata Wen, 1982

Phyllostachys incarnata Wen, 1982 is one of the important material and edible bamboo specie of high quality in China. We reported the complete chloroplast(cp) genome of P. incarnata in this study. The cp genome of P. incarnata (GenBank accession number: OL457160) was a typical tetrad structure with a full length of 139,689 bp, comprising a pair of inverted repeated (IR) regions (21,798 bp) separated by a large single-copy (LSC) region (83,221 bp) and a small single-copy (SSC) region (12,872 bp). And the cp genome contained 136 genes, including 90 protein-coding genes, 38 tRNA genes, and 8 rRNA genes. Phylogenetic analysis based on 19 cp genomes suggested that P. incarnata was relatively close to P. glauca among the species analyzed.

First report of leaf blight caused by Alternaria alternata on Platanus acerifolia in China.

Platanus acerifolia Willd. is widely planted in cities in China due to its strong adaptability to different environmental conditions. In August 2021, light brown, oval to circular, sunken spots were observed on leaves of P. acerifolia trees with 8-35% incidence, leading to severe necrosis and abscission of leaves on a street in Haidian district of Beijing (116°29'84''E, 39°95'93''N). Small pieces (5 mm×5 mm) were taken from the margin of diseased tissues, disinfected with 0.3% sodium hypochlorite for 2 min and 70% ethanol for 40 s, rinsed with sterile water, then plated on potato dextrose agar (PDA) and incubated at 28°C. After 4 days, representative isolates were transferred to new PDA plates. Four isolates with similar morphological characteristics were obtained and deposited in the culture collection (ID: DAA3, DAA5, DAA6 and DAA7) of our laboratory. Colonies on PDA were dense, fluffy, and light to dark gray, with a prominent white margin. Conidia formed in chains on the branched conidiophores, and were obpyriform to ellipsoid, 19.5-32.3×5.5-10.2 μm (average=26.4×7.1 µm, n=30) in size, with 3 to 5 transversal and 1 to 3 longitudinal septa. These morphological characteristics matched those of Alternaria spp. (Simmons 2007). Genomic DNA was extracted with modified CTAB method and the internal transcribed spacer (ITS) region, translation elongation factor 1-α (EF1-α), RNA polymerase II largest subunit (RPB2), glyceraldehyde 3 - dehydrogenase (GPD), endopolygalacturonase (EndoPG), as well as Alternaria major allergen (Alt a1) genes were amplified with primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Carbone and Kohn 1999), RPB2-5F/RPB2-7cR (Liu et al. 1999), gpd1/gpd2 (Berbee et al. 1999), PG3/PG2b (Andrew et al. 2009), and Alt-for/Alt-rev (Hong et al. 2005), respectively. The obtained sequences were deposited in GenBank (accession numbers: OM228653-OM228656, OM221523-OM221542). In a BLAST search, the sequences were 100% identical with corresponding sequences of A. alternata. Phylogenetic analysis based on combined sequences using maximum parsimony method showed that the four isolates clustered together with the type strain CBS 916.96 of A. alternata. For pathogenicity test, three healthy leaves of three one-year-old P. acerifolia plants were wounded with a sterile needle and inoculated with 20 µl of spore suspension (106 conidia/ml). Plants inoculated with sterile water were treated as control. The pathogenicity test was also conducted on the unwounded leaves. After 8 days of inoculation at 25°C and 90% RH with a 12-h photoperiod, the symptoms on spore suspension-inoculated leaves were similar to those observed on trees in the street, whereas the control leaves remained symptomless. Lesions on wounded leaves were larger than those on unwounded leaves. The assay was repeated twice with consistent results. The pathogen was re-isolated from symptomatic leaf tissues and identified based on morphological and rDNA-ITS sequencing, thus, fulfilling Koch's postulates. Examples of other tree species where Alternaria alternata has been reported to cause leaf blight were Ophiopogon japonicas in China (Wang et al. 2021) and Pistacia terebinthus in Spain (López-Moral et al. 2018). To our knowledge, this is the first report of A. alternata causing leaf blight on P. acerifolia in China. The identification could provide information for developing effective disease management strategies.

Exploring the biological application of Penicillium fimorum-derived silver nanoparticles: In vitro physicochemical, antifungal, biofilm inhibitory, antioxidant, anticoagulant, and thrombolytic performance

This study showed the anti-candida, biofilm inhibitory, antioxidant, anticoagulant, and thrombolytic properties of biogenic silver nanoparticles (AgNPs) fabricated by using the supernatant of Penicillium fimorum (GenBank accession number OQ568180) isolated from soil. The biogenic AgNPs were characterized by using different analytical techniques. A sharp surface plasmon resonance (SPR) peak of the colloidal AgNPs at 429.5 nm in the UV–vis spectrum confirmed the fabrication of nanosized silver particles. The broth microdilution assay confirmed the anti-candida properties of AgNPs with a minimum inhibitory concentration (MIC) of 4 μg mL−1. In the next step, the protein and DNA leakage assays as well as reactive oxygen species (ROS) assay were performed to evaluate the possible anti-candida mechanisms of AgNPs representing an increase in the total protein and DNA of supernatant along with a climb-up in ROS levels in AgNPs-treated samples. Flow cytometry also confirmed a dose-dependent cell death in the AgNPs-treated samples. Further studies also confirmed the biofilm inhibitory performance of AgNPs against Candia albicans. The AgNPs at the concentrations of MIC and 4*MIC inhibited 79.68 ± 14.38% and 83.57 ± 3.41% of biofilm formation in C. albicans, respectively. Moreover, this study showed that the intrinsic pathway may play a significant role in the anticoagulant properties of AgNPs. In addition, the AgNPs at the concentration of 500 μg mL−1, represented 49.27%, and 73.96 ± 2.59% thrombolytic and DPPH radical scavenging potential, respectively. Promising biological performance of AgNPs suggests these nanomaterials as a good candidate for biomedical and pharmaceutical applications.

First Report of Anthracnose Caused by Colletotrichum kahawae and Colletotrichum horri on Tea-oil Tree in China.

Tea-oil tree (Camellia oleifera Abel) is an important economic woody plant in southern China. The buds, fruits, and leaves of tea oil tree are all susceptible to the disease, causing the wilt or even fall of the plant. Every year, the disease incidence of anthracnose reached 20%-40% in diseased fields. In 2020, leaves with anthracnose were collected from the main producing areas of tea-oil tree in Yunnan Province and Guizhou Province, China. To isolate the pathogen, several fragments of diseased tissues (5×5mm) were disinfected in 75% alcohol for 40 s, and rinsed 3 times in sterilized water. Then, tissues were placed on PDA medium and incubated at 26℃ for 5 days. Fungal isolates with morphology characteristics similar to Colletotrichum spp. were consistently recovered from diseased tissues. Eighteen fungal isolates were obtained. Among them, 3 representative single-spore isolates (C2, gy15, Ch) were picked for further analysis. The isolates C2 and gy15 on the PDA were gray-white in the initial stage, and later became olive green and spread to the edge. Abundant orange-red conidial masses were present in the colony surface. Conidia were cylindrical and with blunt circles at both ends, with a size of 9.9 µm ~ 21.8 µm × 4.0 µm ~ 6.8 µm (n=50). The hyphae of isolate Ch on PDA were thin, cotton-like, gray to gray-black; the center of the back of the colony was brown, and the color of the colony became darker, and concentric rings could be produced. The conidia were cylindrical , with blunt circles at both ends, with a size of 6.3 µm ~15.0 µm × 3.2 µm ~ 7.0µm (n=50). In order to further identify the pathogens, the internal transcribed spacer (ITS) region of ribosomal DNA, actin (ACT), chitin synthase (CHS), β-tubulin (TUB2), calmodulin (CAL) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were amplified (Weir et al. 2012; Yang et al. 2009). The resulting sequences were deposited under the GenBank accession numbers OK148894, OM397909, OM249943, OL422149, OM184266 and OM718003 for C2,OK148975, OM397910, OM249944, OL422150, OM184267, OM718004 for gy15, OK148976, OM397911, OM249945, OL422151, OM184268 and OM718005 for Ch. A BLAST search showed that the sequences of isolates C2 and gy15 had 99.57% to 100% similarity to the type strain of Colletotrichum kahawae ICMP12952. The sequences of isolate Ch had 99.03% to 100% similarity to the type strain of Colletotrichum horri ICMP 17968. Further, a phylogenetic tree based on the combined ITS, ACT, CHS, TUB, CAL, and GAPDH sequence using the neighbor-joining algorithm revealed that the isolates were C. kahawae and C. horri (Fig. 1). Pathogenicity assays were conducted on healthy leaves collected from 1-year-old tea-oil tree. The experiments were repeated twice. The leaves were surface-sterilized with 75% ethanol. After drying, they were placed in a plastic box pre-laid with sterilized absorbent paper. The leaf surface was slightly pierced with a sterile needle, and each stab wound was inoculated with 10 μL of conidial suspension (1×106 conidia/ml). All inoculated leaves were placed in a moist chamber at 25℃ with 80% relative humidity. After 10 days, inoculated leaves showed similar symptoms as observed in the field, whereas controls remained symptomless. C. kahawae and C. horri were re-isolated from the diseased leaves, and identifed by sequencing. C. kahawae is widespread on coffee in Africa (Waller et al. 1993). C. horri has been associated with fruit and stem diseases of Diospyros kaki from China, Japan, and New Zealand (Weir et al. 2010). To our knowledge, this is the first report of C. kahawa and C. horri causing anthracnose of tea-oil tree.

Complete genome sequence of a new virus from Allium sativum L in China

The complete genome of a new virus belonging to the family Betaflexiviridae was identified in garlic and sequenced by next-generation sequencing and reverse transcription PCR. The complete RNA genome (GenBank accession number OP021693) is 8191 nucleotides in length, excluding the 3' poly(A) tail, and contains five open reading frames (ORFs). These open reading frames encode the viral replicase, triple gene block, and coat protein, and the genome organization is typical of members of the subfamily Quinvirinae. The virus has been tentatively named "garlic yellow curl virus" (GYCV). Phylogenetic analysis suggested that it represents an independent evolutionary lineage in the subfamily, clustering with the currently unclassified garlic yellow mosaic associated virus (GYMaV) and peony betaflexivirus 1 (PeV1). Differences between the phylogenies inferred for the replicase and coat protein indicate that the new virus does not belong to any established genus of the family Betaflexiviridae. This is the first report of GYCV in China.

Postharvest fruit rot of Bell pepper (Capsicum annuum L.): Pathogenicity and Host range of Alternaria alternata

Bell pepper is a fleshy vegetable cultivated in many countries. A severe fruit rot symptom was observed on green bell pepper in the local vegetable market in New Delhi, India. Fruit rot-associated fungal pathogen isolated on culture medium showed greyish-to-olive green mycelium with prolific conidial production. The pathogenicity test on green bell pepper indicated that inoculated fungus remained quiescent for ten days, triggering typical fruit rot upon the physiological maturation of bell pepper. Based on microscopic features and sequencing of genomic loci such as ITS, Alt a1, and RPB2, the pathogen identity was established as Alternaria alternata. Annotated nucleotides sequence of three genes were deposited and assigned NCBI GenBank accession numbers. Phylogenetic analysis using the taxonomic species of Alternaria strains revealed that the isolate A. alternata Cap_Aa clustered with reference strains of Alternaria alternata. A host range study of A. alternata Cap_Aa confirmed its pathogenicity on tomatoes and eggplant. Results presented in the present work provide knowledge on pathogen identity, host range, and genetic-relationship for developing suitable fruit rot management strategies and postharvest handling in the future.

Acute Toxicity of Chlorpyrifos on the Freshwater Bivalves (Unio Tigridis) and Effects on Bioindicators

A freshwater bivalve plays a crucial function in aquatic habitats as the filtered water and burrowing mussels mix the sediment, thus increasing oxygen content and making the ecosystem healthier. The aim of the study is to see how chlorpyrifos affects biochemical markers in freshwater mussel Unio tigridis. About 180 individuals per taxon and water samples were collected from the Qandil water resource on the Greater Zab River, Erbil Province, Iraq. Once arrived at the lab, the individuals were kept in aquaria with river water and an air-conditioned room Temperature: 25±2 and Light: 12h/12h and acclimatized to laboratory conditions for seven days in aged tap water. The mussel's identification molecularly and the DNA sequence of the mussel includes U. tigridis supplied gene bank accession number ON872361, ON872362, ON872363, and ON872364 nucleotide sequencing. The 96-h toxicity of chlorpyrifos pesticide in the freshwater mussel U. tigridis was investigated using various nominal concentrations, including 50, 100, 200, 300 and 400 ppm. The water quality of the river and aquaria was tested for physicochemical parameters including water temperature, the potential of hydrogen ion pH, electrical conductivity EC, and total dissolved solids TDS, dissolved oxygen, total alkalinity, total hardness, calcium ion, magnesium ion. Water quality results of aquaria revealed that most tested variables were favorable for the breeding of mussels. The mortality of the mussels was observed daily and the 96 h LC50 value for mussels was 157.99 ppm. Within the tissue of the gills, Acetylcholinesterase (AChE), Glutathione S-transferase (GST), Catalase (CAT), and Malondialdehyde (MDA) were determined. The chlorpyrifos exposures caused significant increases in GST, CAT, and MDA. The elevation of oxidative stress biomarkers was inversely related to the AChE inhibition in the examined species. In conclusion water pollution by chlorpyrifos lead to unsafe condition for aquatic taxa.

First report of stem rot of Scrophularia ningpoensis caused by Fusarium commune in China.

First report of stem rot of Scrophularia ningpoensis caused by Fusarium commune in China.

Dissecting the features of TGA gene family in Saccharum and the functions of ScTGA1 under biotic stresses

Sugarcane is an important sugar and energy crop and smut disease caused by Sporisorium scitamineum is a major fungal disease which can seriously reduce the yield and quality of sugarcane. In plants, TGACG motif binding (TGA) transcription factors are involved in the regulation of salicylic acid (SA) and methyl jasmonate (MeJA) signaling pathways, as well as in response to various biotic and abiotic stresses. However, no TGA-related transcription factor has been reported in Saccharum. In the present study, 44 SsTGA genes were identified from Saccharum spontaneum, and were assorted into three clades (I, II, III). Cis-regulatory elements (CREs) analysis revealed that SsTGA genes may be involved in hormone and stress response. RNA-seq data and RT-qPCR analysis indicated that SsTGAs were constitutively expressed in different tissues and induced by S. scitamineum stress. In addition, a ScTGA1 gene (GenBank accession number ON416997) was cloned from the sugarcane cultivar ROC22, which was homologous to SsTGA1e in S. spontaneum and encoded a nucleus protein. It was constitutively expressed in sugarcane tissues and up-regulated by SA, MeJA and S. scitamineum stresses. Furthermore, transient overexpression of ScTGA1 in Nicotiana benthamiana could enhance its resistance to the infection of Ralstonia solanacearum and Fusarium solani var. coeruleum, by regulating the expression of immune genes related to hypersensitive response (HR), ethylene (ET), SA and jasmonic acid (JA) pathways. This study should contribute to our understanding on the evolution and function of the SsTGA gene family in Saccharum, and provide a basis for the functional identification of ScTGA1 under biotic stresses.

Diversity of Fungal Communities on Diseased and Healthy Cinnamomum burmannii Fruits and Antibacterial Activity of Secondary Metabolites.

The composition and structure of fungal communities on healthy and diseased fruits of Cinnamomum burmannii (Nees and Nees) Blume were characterized, with evaluation of the antibacterial activity of secondary metabolites from culturable fungi following the first identification of secondary metabolites in the fungus Medicopsis romeroi (Esf-14; GenBank accession number OK242756). These results are significant for understanding the functional variation in bioactivity in fungal communities and developing a broader range of bioactive resources. High-throughput sequencing results indicated that the fungal community in diseased fruit differed from that in healthy fruit at the phylum, class, order, or genus level, with significant differences in the species and relative abundance of the dominant flora. A total of 49 (healthy fruit) and 122 (diseased fruit) artificially cultivable endophytic fungi were isolated, and 41 different strains (11 from healthy fruit and 30 from diseased fruit) were successfully identified by morphological and molecular biological analyses, which were classified into 8 groups and 23 genera by phylogenetic tree analysis, with Pleosporales, Glomerellales, and Hypocreales being the dominant groups at the order level and Colletotrichum being the dominant group at the genus level. The results of the antibacterial assay demonstrated that the secondary metabolites of all strains had different degrees of antibacterial activity, while the secondary metabolites of endophytic fungi from diseased fruit were generally stronger than those of fungi from healthy fruit, with the active secondary metabolites dominated by small and moderately polar compounds. Combined analysis of fungal communities, phylogenetic tree analysis, and bioactivity analysis of culturable strains revealed strong antibacterial activity of both upregulated and downregulated flora in diseased fruit. Five compounds, including two new (5,6-dimethoxy-[1',1:4,1″-terphenyl]-2-ol [compound 1] and 5-(methoxycarbonyl)-2-methylbenzo[d][1,3]dioxole-2-carboxylic acid [compound 2]) and three known compounds (3,7-dihydroxy-1,9-dimethyldibenzofuran [compound 3], methyl 3-hydroxybenzoate [compound 4], and uracil [compound 5]), were isolated and identified for the first time from the endophytic fungus Medicopsis romeroi. In general, the diversity of fungal communities on diseased fruit was lower than that on healthy fruits, while the antibacterial activity of artificially cultured endophytic fungi on diseased fruits was generally stronger than that on healthy fruits, suggesting excellent promise for the development of secondary metabolites from active strains on diseased fruit as antibacterial agents. IMPORTANCE Powdery fruit disease is a notorious disease of Cinnamomum burmannii that causes severe loss in fruit production. Studies on the function of endophytic fungal communities in healthy plant tissues are not new, while little is known about the functional changes of fungal communities in disease-causing plant tissues. Our results demonstrate that fungal communities in diseased fruits differ from those in healthy fruits at the level of phylum, class, order, or genus, with significant differences in the species and relative abundance of dominant groups. Endophytic fungi in diseased fruits appeared to produce secondary metabolites with stronger antibacterial properties, although the community diversity was not as varied as that in healthy fruits. In addition, secondary metabolites of the Medicopsis romeroi strain from diseased fruits were identified for the first time. These results have important implications for understanding the functional variation of bioactivity in fungal communities and for developing a broader resource of bioactivity.

The screening for marine fungal strains with high potential in alkaloids production by in situ colony assay and LC-MS/MS based secondary metabolic profiling.

Alkaloids are the second primary class of secondary metabolites (SMs) from marine organisms, most of which have antioxidant, antitumor, antibacterial, anti-inflammatory, and other activities. However, the SMs obtained by traditional isolation strategies have drawbacks such as highly reduplication and weak bioactivity. Therefore, it is significantly important to establish an efficient strategy for screening strains and mining novel compounds. In this study, we utilized in situ colony assay combined with liquid chromatography-tandem mass spectrometry (LC-MS/MS) to identify the strain with high potential in alkaloids production. The strain was identified by genetic marker genes and morphological analysis. The secondary metabolites from the strain were isolated by the combine use of vacuum liquid chromatography (VLC), ODS column chromatography, and Sephadex LH-20. Their structures were elucidated by 1D/2D NMR, HR-ESI-MS, and other spectroscopic technologies. Finally, these compounds bioactivity were assay, including anti-inflammatory and anti-β aggregation. Eighteen marine fungi were preliminarily screened for alkaloids production by in situ colony assay using Dragendorff reagent as dye, and nine of them turned orange, which indicated abundant alkaloids. By thin-layer chromatography (TLC), LC-MS/MS, and multiple approaches assisted Feature-Based Molecular Networking (FBMN) analysis of fermentation extracts, a strain ACD-5 (Penicillium mallochii with GenBank accession number OM368350) from sea cucumber gut was selected for its diverse alkaloids profiles especially azaphilones. In bioassays, the crude extracts of ACD-5 in Czapek-dox broth and brown rice medium showed moderate antioxidant, acetylcholinesterase inhibitory, anti-neuroinflammatory, and anti-β aggregation activities. Three chlorinated azaphilone alkaloids, compounds 1-3 (sclerotioramine, isochromophilone VI, and isochromophilone IX, respectively), were isolated from the fermentation products of ACD-5 in brown rice medium guided by bioactivities and mass spectrometry analysis. Compound 1 had shown remarkable anti-neuroinflammatory activity in liposaccharide induced BV-2 cells. In summary, in situ colony screening together with LC-MS/MS, multi-approach assisted FBMN can act as an efficient screening method for strains with potential in alkaloids production.

A new genus and species of micro-pagurid hermit crab (Crustacea, Decapoda, Paguridae) from the rariphotic reef zone in Curaçao, Lesser Antilles, Caribbean Sea.

During field investigations of deep-reefs off the coast of Curaçao in the Lesser Antilles, Caribbean Sea, a female specimen was collected of an undescribed micro-pagurid crab with striking dorso-ventral flattening of the right cheliped. It was further characterized by a reduced branchial formula, fourth pereopods with grasping-like spines instead of typically pagurid rasp-like scales, nearly symmetrical uropods and telson, and a minute pair of first pleopods (gonopods). The single specimen was discovered in samples from the rariphotic zone (~130-309 m) obtained using a suction sampler operated from the manned submersible R/V Curasub over cryptic habitats and surfaces populated by communities of sessile macro-organisms. As the specimen does not fit any known pagurid taxon, we regard it to represent a new monotypic genus. We fully describe this new micro-pagurid as Raripagurus roseangelae n. gen., n. sp. and also provide photographs of its live coloration. The CO1 barcode for the holotype in the Barcode of Life Database and GenBank accession number are included as part of the description for any future phylogenetic investigations.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Optimization, partial purification, and characterization of a novel high molecular weight alkaline protease produced by Halobacillus sp. HAL1 using fish wastes as a substrate

BackgroundHydrolytic enzymes from halophilic microorganisms have a wide range of industrial applications. Herein, we report the isolation of Halobacillus sp. HAL1, a moderately halophilic bacterium that produces a novel high molecular weight extracellular alkaline protease when grown in fish processing wastes as a substrate. ResultsResults showed that the isolated strain belonged to the genus Halobacillus, and it was designated as Halobacillus sp. HAL1 with the GenBank accession number OK001470. The strain secreted an extracellular alkaline protease, and the highest yield was obtained when it was grown in a medium with fish wastes substrate as the sole nutritional source (10 g/L) and incubated at 25 °C under shaking conditions. The enzyme was partially purified by Sephadex G-100 column chromatography. Zymographic analysis showed two casein degrading bands of about 190 and 250 KDa. The optimum enzyme activity was at a temperature of 50 °C at pH 8. The proteolytic activity was enhanced in the presence of metal ions (Ca2+, Mg2+, and Mn2+), surfactants (Tween 80, SDS, and Triton-X100), H2O2, and EDTA. ConclusionOur study indicates that Haobacillus sp. HAL1 is a moderately halophilic strain and secrets a novel high molecular wight alkaline protease that is suitable for detergent formulation.

First report of citrus leaf blotch virus 2 in mandarin (Citrus reticulata) in Jeju Island, Korea.

Citrus reticulata (mandarin) is an economically important fruit in Korea, with Jeju Island accounting for over 90% of the local production (Park et al. 2019). In July 2021, one leaf each from 12 individual mandarin (Citrus reticulata) tree presenting viral disease-like symptoms (chlorotic blotching, yellowing and mosaic) were collected from Namwon-eup, Seogwipo-si, Jeju Island to determine the presence and severity of infection. Based on different symptoms on collected 12 leaves, three samples (samples #1, #6 and #7) were selected for high throughput sequencing (HTS) analysis. Total RNA was extracted from each sample using the NucleoSpin RNA Plant Kit (Macherey-Nagel, Düren, Germany) according to the standard protocol. The Illumina TruSeq Stranded mRNA Library Preparation protocol was followed to generate cDNA libraries. HTS was performed using the Illumina Novaseq 6000 platform by Macrogen Inc. (Seoul, South Korea). A total of 106,072,022 (sample #1), 109,761,956 (sample #6) and 132,284,268 (sample #7) raw reads (average length 101 bp) were generated by HTS. The HTS data was analyzed using the "trim reads" and "map reads to reference" tools built in CLC Genomics Workbench software (Qiagen Bioinformatics, Hilden, Germany). All the virus related sequence reads were mapped to the citrus tristeza virus (CTV), citrus leaf blotch virus (CLBV) and citrus leaf blotch virus 2 (CLBV 2). CTV and CLBV was detected in all the three samples. However, CLBV 2 was detected only in sample #6, which showed symptoms of chlorotic blotching in leaves. A total of 1,677,131 reads were identified for CLBV 2. CLBV 2 was first reported in Haruka (C. junos × C. grandis) in China (Cao et al. 2018). A viral genome sequence was assembled by mapping the Illumina reads to the Reference Viral DataBase (RVDB) (June 2021) (Goodacre at al., 2018). The resultant CLBV 2 (GenBank accession number OL871235) was 8,692 nt long and shared more than 99% nucleotide and amino acid identity to CLBV 2 CN-2 isolate (MH558590). RT-PCR was used for further validation with 12 collected samples. Viral RNA was extracted using the Viral Gene-spin™ Viral DNA/RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea). Two primer pairs, namely CLBV2-1-F (5'-TCATCCAGAAGGGTATCTCGGA-3')/CLBV2-1-R (5'-CCCTCCTCACCTTCCCCATA-3') and CLBV2-2-F (5'-GGGTCAAGAAGCACGTCAGA-3')/CLBV2-2-R(5'-CGTTCCACATCCATTGAAGGAC-3'), were designed based on the previously assembled sequence (OL871235), and a 588 bp fragment encoding a partial replicase protein and a 780 bp fragment encoding a partial coat protein were successfully amplified from sample #6. The amplification products were cloned into the pGEM-T Easy vector (Promega, Madison, WI, USA), plasmid DNA was isolated and sequenced in both direction by Macrogen Inc. The obtained sequences shared 99.87-100% identity with HTS assembled sequence and 99.15-99.49% identity with CLBV 2 CN-2 (MH558590). However, CLBV 2 was not identified in the remaining 11 samples. To the best of our knowledge, this is the first report of CLBV 2 in Korea in mandarin in mixed infection with CTV and CLBV.

First report of Ludwigia yellow vein Vietnam virus causing leaf curling on tobacco plants in Hainan province, China.

Cigar tobacco (Nicotiana tabacum L.) has been recently introduced into China for various industrial applications. From March 2022, certain symptoms of begomovirus infection, including leaf curling and thickening of veins, were sporadically (disease incidence was approximately 0.2%) observed in several cigar tobacco plantations in numerous counties in Hainan Province, China (Figure 1A). These typical symptoms of begomovirus infection were similar to those caused by the sida leaf curl virus-Hainan (SiLCV-HN) begomovirus and its associated betasatellite, as reported in our previous study on cigar tobacco plants in the same region (Wang et al. 2022). In order to determine whether these symptoms were caused by SiLCV-HN or other begomoviruses, samples of leaves were collected from the diseased tobacco plants for DNA extraction, and the total DNA was extracted for viral metagenomics using an Illumina Sequencing platform at Tiangen Biotech, Beijing. A total of 65711396 filtered reads were obtained, of which 65362322 (99.47%) reads matched to the genome of tobacco. The remaining unmapped 349074 (0.53%) reads were analyzed by BLASTn against the virus Refseq Database of GenBank and subsequently assembled. A total of 8 (5+2+1) enriched contigs of the complete sequence of ludwigia yellow vein Vietnam virus (LuYVVNV) and 9 (8+1) contigs of ludwigia yellow vein virus-associated DNA beta (LuYVB) were finally obtained (Table 1). LuYVVNV belongs to the Begomovirus genus that infects various weeds, including Ludwigia octovalvis and Impatiens balsamina. As far as we know, it was reported earliest on weed in Vietnam (Ha et al. 2008). GenBank contains data pertaining to previously identified isolates of LuYVVNV, and the data revealed that the virus was discovered in Vietnam and the Yunnan province of China currently. However, there are no reports on the infection of crops by LuYVVNV to date. The findings of the present study indicated that LuYVVNV and LuYVB could be responsible for the aforementioned symptoms observed on cigar tobacco. The complete genomes of LuYVVNV and LuYVB were amplified using primer pairs designed based on sequence assembly for viral metagenomics (Table 2). Indeed, two DNA bands with length 2763 bp of LuYVVNV genome and 1348 bp of LuYVB were amplified from leaf samples of diseased tobacco (Figure 1B). The products of polymerase chain reaction (PCR) amplification were analyzed by Sanger sequencing, and the complete nucleotide sequences of LuYVVNV and its associated betasatellite were obtained. Analysis with the BLASTn tool of NCBI revealed that the genome sequence of LuYVVNV isolated from the Hainan province of China had the highest identity of 96.9% to a different isolate of LuYVVNV (GenBank accession number: MN210347.1). These two isolates belong to the same strain, according to the latest revision of Begomovirus taxonomy (Brown et al. 2015). The isolate of LuYVVNV identified in this study was designated as LuYVVNV, Hainan isolate (LuYVVNV-HN, GenBank accession number: OP948731). BLASTn analysis further revealed that the associated betasatellite had the highest sequence identity of 96.9% with an LuYVB (GenBank accession number: AJ965541.1) of a different viral isolate, according to the classification and nomenclature of DNA betasatellites of begomoviruses (Briddon et al. 2008). The sequence of LuYVB obtained herein was therefore designated as LuYVB, Hainan isolate (LuYVB-HN, GenBank accession number: OP948732). The pathogenicity of LuYVVNV-HN and LuYVB-HN was determined using infectious clones that were constructed by ligating two fragments of LuYVVNV-HN or LuYVB-HN to a binary pCAMBIA1300 expression vector, as previously described (Wang et al. 2019). Infectious clones of LuYVVNV-HN, LuYVB-HN, and LuYVVNV-HN plus LuYVB-HN were separately agroinfiltrated into N. benthamiana for determining viral pathogenicity. The typical symptoms of begomovirus infection were observed in N. benthamiana plants inoculated with LuYVVNV-HN alone or LuYVVNV-HN plus LuYVB-HN, and the emerging leaves were mildly or severely down-curled, respectively, at 7 days post inoculation (dpi), with 100% disease incidence (6/6) (Figure 1C). Positive PCR products of the AV1 gene of LuYVVNV-HN were obtained from N. benthamiana plants inoculated with LuYVVNV-HN alone or LuYVVNV-HN plus LuYVB-HN. The βC1 gene of LuYVB-HN was only obtained from N. benthamiana plants co-infected with LuYVVNV-HN and LuYVB-HN (Figure 1D). No symptoms of viral infection were observed in plants individually inoculated with LuYVB-HN, and the results of PCR were negative (Figure 1C and 1D). These findings indicated that the N. benthamiana plants had been successfully inoculated with LuYVVNV-HN, and that LuYVB-HN was incapable of causing infections on its own, but functioned as a helper and enhanced viral pathogenicity. This report is the first to identify isolates of LuYVVNV and LuYVB from cigar tobacco, which is an economically important crop plant. The findings provide insights into the epidemic threat of begomovirus reservoirs in weeds to crop plants, and emphasize the need for monitoring and controlling whitefly-transmitted viral diseases in tobacco plantations worldwide (Ye et al. 2021).

Establishment of reverse genetics for genotype VII Newcastle disease virus and altering the cell tropism by inserting TMPRSS2 into the viral genome.

Newcastle disease (ND) is the most important infectious disease in poultry, which is caused by avian orthoavulavirus type 1 (AOAV-1), previously known as Newcastle disease virus (NDV). In this study, an NDV strain SD19 (GenBank accession number OP797800) was isolated, and phylogenetic analysis suggested the virus belongs to the class II genotype VII. After generating wild-type rescued SD19 (rSD19), the attenuating strain (raSD19) was generated by mutating the F protein cleavage site. To explore the potential role of the transmembrane protease, serine S1 member 2 (TMPRSS2), the TMPRSS2 gene was inserted into the region between the P and M genes of raSD19 to generate raSD19-TMPRSS2. Besides, the coding sequence of the enhanced green fluorescent protein (EGFP) gene was inserted in the same region as a control (rSD19-EGFP and raSD19-EGFP). The Western blot, indirect immunofluorescence assay (IFA), and real-time quantitative PCR were employed to determine the replication activity of these constructs. The results reveal that all the rescued viruses can replicate in chicken embryo fibroblast (DF-1) cells; however, the proliferation of raSD19 and raSD19-EGFP needs additional trypsin. We next evaluated the virulence of these constructs, and our results reveal that the SD19, rSD19, and rSD19-EGFP are velogenic; the raSD19 and raSD19-EGFP are lentogenic; and the raSD19-TMPRSS2 are mesogenic. Moreover, due to the enzymatic hydrolysis of serine protease, the raSD19-TMPRSS2 can support itself to proliferate in the DF-1 cells without adding exogenous trypsin. These results may provide a new method for the NDV cell culture and contribute to ND's vaccine development.