Garden Party Research Articles

Characteristics and Background of Narrative in V. Havel’s Plays: Focus on Garden Party and Audience

Characteristics and Background of Narrative in V. Havel’s Plays: Focus on Garden Party and Audience

INM 50 Garden Party

INM 50 Garden Party

“The Garden Party” e suas diferentes leituras: algumas considerações sobre a tradução literária

Este artigo apresenta algumas considerações sobre a tradução do conto “The Garden Party”, da autora neozelandesa Katherine Mansfield. Os comentários são divididos em três seções. A primeira está relacionada ao conceito de culture-specific items, de Javier Franco Aixelá (1996), que discute a tradução de termos específicos da cultura da língua-fonte. A segunda seção lida com a variação linguística, explorando o fato de os personagens de classes pobres terem, nesse texto, sua fala marcada. Por fim, é explorada a multiplicidade de leituras possíveis para um mesmo texto, e os efeitos disso na tradução. Para isso, são analisados alguns aspectos da linguagem usada por Mansfield, conforme discutidos por diferentes ensaios a respeito do conto.

Grammar and feelings: a study of Wh-exclamatives in Katherine Mansfield’s short stories

In order to better understand the (sometimes conflicting) relation between language and feeling, I study in this paper all WH-exclamative constructions of two collections of Katherine Mansfield’s short stories, Bliss: and Other Stories (1923) and The Garden Party: and Other Stories (1923). In the light of my data analysis, I attempt to contest the widespread conceptualization of exclamatives as expressing scalar evaluation and surprise at violation of expectation. I argue that HOW exclamative constructions are speaker-oriented utterances that express some intense feeling s/he experiences; subjects of such constructions can be omitted because of their evidence in context. Frequent ellipsis of verb and subject thus results from the cognitive implication of the speaker, who tries to identify a contextually salient quale, with such obviousness paradoxically resulting in indeterminacy marker WH-; while WHAT exclamatives express social and inter-subjective judgment. Expressivity is present in the initial WH-phrase which continues into mere expression of feeling as it develops into a complete clause.

The Chinese Concept of <i>Blank</i> in Katherine Mansfield’s <i>Bliss</i> and <i>the Garden Party</i>

Katherine Mansfield is a legend in the history of the modern British literature for her implicit writing style. Most of her works concentrate on creating the inner world of the characters instead of a clear beginning or tense conflicts, so as to invite readers to explore the subtle changes of the characters’ psychological world. And this thesis tries to explore the beauty of her representative works---The Garden Party and Bliss according to the Chinese artistic concept of Blank from three main aspects, including the content, structure and themes. Findings are Blanks in content are mainly used in character depiction and dialogues as a substitute for the direct and boring introduction of background information. When it is used in structure building, it plays different roles in different developmental parts. As a matter of fact, The Blanks in content and structure are often applied to leave more space for the inference of themes.

On Characteristics of the Plots in Katherine Mansfield’s Short Stories

Katherine Mansfield is a legend in the history of the modern British literature for her implicit writing style. She was regarded as one of the most prominent innovators and pioneers of English short stories. Most of her works are carefully organized in the structure, concentrating on creating the inner world of the characters instead of a clear beginning or tense conflicts, so as to invite readers to explore the subtle changes of the characters’ psychological world. There have been a large number of studies on the subjects like feminism, modernism, dream disillusionment, narrative style and rhetorical devices of her short stories, but only a few talk about the plot structure because there seems to be no clear boundaries between the beginning and the development, and the development and the ending. This thesis intends to and generalize the structural features of her short stories, including <i>The Garden Party, Bliss, A Cup of Tea, An Ideal Family</i> and so on, mainly from the following three aspects: the stream of consciousness, shifts of occasions, and the function of objects. It is found that there are some regularities in the settings of the beginnings and endings in her stories. And from the analysis of her short stories, it may help us learn more about what is artistic beauty and about how to design the story-telling process.

Hidden in Full View: A Subliminal Reading of The Garden Party by Katherine Mansfield

ABSTRACTDespite the numerous and often contradictory readings The Garden Party has stimulated down the years, the story has two key modernist concerns which remain under-explored. The first is sexuality and sexual awakening and their conscious and unconscious manifestations in everyday life—a theme that is explicitly foregrounded in some of Mansfield’s other stories. The second is the trauma of death. Although the heroine’s encounter with a corpse is widely regarded as a pivotal moment in the story, death itself and the interplay within the text between life and death have received limited attention to date. This essay examines the text through the lens of psychoanalytical theory and in relation to the traumatic war which had ended four years before the publication of the story. Through a subliminal reading of the imagery throughout the story, it uncovers the subconscious forces so skilfully evoked within the heroine herself who is the conscious unconsciousness at the core of the text.

Biomorphic garden party.

My work changed drastically in 2010 when I found myself creating surreal organic environments. Although I started from a place of abstraction, they became filled with strange hybrids of flowers, cells, and symbols that appeared like organisms from another planet. It was only later that I found out I had a disease crawling through my body at an alarming rate. When my oncologist showed me the MRI and close-ups of the cells under a microscope, it looked almost identical to what I had been painting—tentacles and all.

KATHERINE MANSFIELD’IN “BAHÇE PARTİSİ” ADLI ÖYKÜSÜNDE SINIF AYRIMI VE TOPLUMSAL CİNSİYET ROLLERİ KONUSUNDAKİ İKİLİ KARŞITLIKLARIN YIKILMASI

Katherine Mansfield’s contribution to the development of short story genre in English literature is based on her use of narrative techniques, especially that of focalization. In her short story “The Garden Party” which recounts the story of the upper-class Sheridan family’s garden party preparations, Mansfield challenges issues related to class and gender from the main character Laura’s focalisation. In this initiation story, Laura starts questioning the roles attributed to an upper-class woman right after she meets the workers who come to make the preparations for the party. Her dilemma about her class comes to a climactic point when she learns the death of a working class neighbour, Mr. Scott, and visits his funeral home. Through the juxtaposition of these two classes from the viewpoint of a female adolescent, Mansfield not only criticises the hypocrisy of the bourgeoisie, but also roles expected from a woman. The aim of this article, then, is to discuss Mansfield’s “The Garden Party” with respect to the theory of deconstruction to show how the writer problematizes logocentrism by subverting the binary oppositions based on class and gender. Keywords: Katherine Mansfield, “The Garden Party”, Deconstruction, Narrative Techniques.

Looking Glass Worlds: The Queen and the Mirror

Looking Glass Worlds: The Queen and the Mirror

ПОБЕГООБРАЗОВАТЕЛЬНАЯ СПОСОБНОСТЬ САДОВЫХ РОЗ АНГЛИЙСКОЙ ГРУППЫ ПРИ ИНТРОДУКЦИИ В УСЛОВИЯХ БОТАНИЧЕСКОГО САДА СГУ

ПОБЕГООБРАЗОВАТЕЛЬНАЯ СПОСОБНОСТЬ САДОВЫХ РОЗ АНГЛИЙСКОЙ ГРУППЫ ПРИ ИНТРОДУКЦИИ В УСЛОВИЯХ БОТАНИЧЕСКОГО САДА СГУ

City Profile: Wellington: Where Words Are Waiting

WORLDLIT.ORG 7 Like a beautiful, moody lover, Wellington doesn’t need to treat you kindly. Friends may sometimes wonder what you see in it, but when the city is good to you with its days of almost painful gorgeousness and clarity, you can forgive its bluster, its temper tantrums and cold shoulder. You may be clutching a lamppost, but at least you know you’re alive. – Kate Camp Wellington has been named “the coolest little capital of the world” and one of the top ten places to escape to. Affectionately known as Wellywood, New Zealand’s hipster capital is a city of film, sculpture, and creatives. Yet its literary credentials extend far beyond Tolkien. Katherine Mansfield casts a long shadow . In stories such as “Prelude,” “The Garden Party,” and “At the Bay.” In the restored Katherine Mansfield House and Garden where she spent her early years. In Woman of Words, the three-meter-high sculpture laser-cut with her words and phrases, depicting her striding along Lambton Quay. In her featured words, among those of twenty-three writers on the Wellington Writers Walk. From the landmark Wellington Central Library with its nikau palm columns, walk through Civic Square over the sculptural city to Sea Bridge. Scattered along the waterfront, often in the most unexpected places, lie concrete and metal inlaid quotations from some of New Zealand’s bestknown writers. Everywhere good words are waiting to be found. In independent bookstores with their helpful, knowledgeable staff: Unity, with its excellent range of intelligent New Zealand and international titles, its launches and readings; Kelburn’s Vic Books and Ekor with their superb coffee and food; Thorndon’s Millwood Gallery, which also sells artwork; Marsden in Karori; and the Children’s Bookshop in Kilbirnie. In secondhand bookstores: Arty Bees, with over one hundred thousand books; Pegasus, with its great readings; and The Ferret. But hide your books as you pass nearby Cuba Mall’s quirky bucket fountain. It’s designed to splash. The International Institute of Modern Letters organizes lunchtime Writers on Mondays at the national museum, Te Papa, and produces the online Best New Zealand Poems and literary journal Turbine. Wellington ’s many literary journals include two of the country’s best—Sport and the only one exclusively dedicated to reviewing the nation’s books, New Zealand Books. Bursting with literary activity, Wellington hosts the internationally star-studded biennial New Zealand Writers and Readers Week, the hugely popular LitCrawl, National Poetry Day events, poetry slams, and monthly poetry readings in the inner city and up the coast. What’s not to love in the world’s windiest city? Find a sheltered spot with a craft beer or one of the world’s best flat whites. Look out at the hills, the harbor, the sea. The city opens like a well-loved book. Alison Wong’s historical novel, As the Earth Turns Silver, is set in Wellington. To read a story and poem by Alison Wong, turn to page 28. Her Wellington reading list appears in the Takeaway at the end of this issue. photo : flickr . com / people / feefoxfotos Notebook city profile Wellington Where Words Are Waiting by Alison Wong ...

Alphonso Lisk-Carew: Imaging Sierra Leone through His Lens

In Freetown in Clarkson’s day—1792—the author gives two of the best contemporary views ... in the Freetown of 1894 one discovers the palpable dissimilitude between some of the pictures and the scenes they are said to represent. The author of the work before us declares that hardly anything has been done since Clarkson’s day and his word must stand, even if the sun has to be pressed into the service to give misleading photographs. Photographs never make mistakes ... but photographers may misrepresent! (Sierra Leone Weekly News 1894).

First Report of Plantago asiatica mosaic virus in Imported Asiatic and Oriental Lilies (Lilium hybrids) in the United States.

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription-polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV.

The Modernist Party as Pedagogy

“The Modernist Party” is a 30-minute simulation exercise devised by the author, in which undergraduate English students role-play modernist figures at an imaginary party held in London in 1922. The simulation takes place in the first seminar of a 22-week course on English literary modernism and is preceded by a general discussion about the nature of parties and a more specialized discussion about the functioning of parties in certain modernist texts: James Joyce’s “The Dead” (1914), Katherine Mans field’s “The Garden Party” (1922), and Virginia Woolf ’s To the Lighthouse (1927). The exercise offers the general pedagogical advantages associated with simulation (a type of role-play). It also provides topic-specific benefits: making modernist ideas more accessible to students; offering insights into specific modernist preoccupations and practices (the idea of space / place, the concept of the everyday, and the phenomenon of networking); and providing an experiential model of learning that resonates with modernist texts.

A skunk at the garden party: the Sochi Olympics, state-sponsored homophobia and prospects for human rights through mega sporting events

Mega sporting events, such as the Olympics, are sites of political struggle. Situating mega sporting events within the context of critical social theory, this article examines the potential of modern sport to serve as a vehicle for foreign policy and the promotion of international human rights. This article examines the 2014 Sochi Winter Olympic Games in light of Russian legislation that bans ‘propaganda of non-traditional relations’, resulting in what many have described as state-sponsored homophobia. Highlighting the international community's response to this legislation, such as threatened boycotts, political statements and symbolic gestures of protest, the implications of the Sochi case study reveal the potential of mega sporting events to advance human rights for lesbian, gay, bisexual and transgender citizens in Russia and perhaps elsewhere. As human rights are historically and culturally contested, this article discusses the role of identity politics and liberal internationalism within the realm of global sport diplomacy. Finally, the Sochi case study contributes to future discussions concerning efforts at balancing hosting rights, human rights and the social responsibilities associated with mega sporting events. Specific recommendations are provided.

On the Alienation in Miss Brill

Katherine Mansfield is a world famous woman master of short stories in English literature. Her stories are sensitive revelations of human behaiour in quite ordinary situations, through which we can glimpse a powerful, and sometimes cruelly pessimistic view of life. Miss Brill is one of her short stories published in her collection of stories entitled The Garden Party and Other Stories (2007), describing an afternoon in the life of a middle-aged spinster who visits the public park on a weekly basis, leading to her reassessment of her view of the world and the secular reality. Short as it is, it is really worth carful analysis and appreciation. This paper will mainly deal with the theme—alienation that the story conveys in two aspects: some obvious alienate elments in Miss Brill, in which some background information is provided; some less obvious alienation in Miss Brill, in which a detailed analysis is made into the story to reveal its alienation.

A Country Bumpkin in Cosmopolitan Shanghai

A Country Bumpkin in Cosmopolitan Shanghai

“Foreigners in Town”: Leisure, Consumption, and Cosmopolitanism in Late-Nineteenth and Early-Twentieth Century Tillsonburg, Ontario1

At the turn of the twentieth century, the small town of Tillsonburg, Ontario contained a population that was over eighty-six percent Anglo-Celtic in origin. Increasingly, however, local leisure activities began to incorporate “ethnic” food, dress, and mannerisms so that citizens could momentarily become “foreigners” and “consume” knowledge of other nations and peoples. Two of the more notable venues where participants acted out racialized identities—the “Garden Party of the Nations” and the Ladies’ Travel Club—showcase desires to consume markers of foreignness while concurrently displaying an acceptance of these cultures. Using Tillsonburg as a case study, this article examines how engaging with the “foreign” in patterns of leisure and consumption was a way for citizens (and women in particular) to convey an air of cosmopolitanism and cultural refinement in the face of critiques that small towns were insular and unsophisticated. Their cultural appropriations, however, represent grossly distorted understandings of races, ethnicities, and cultures that existed outside their Euro-Canadian one. Though efforts by Tillsonburg’s populace to appear more cosmopolitan were grounded in a desire to expand understandings of “the foreign,” this occurred only on their own terms and in controlled spaces.

Diagnosing Bias in Philosophy of Religion

AbstractWork in philosophy of religion exhibits at least four symptoms of poor health: it is too partisan, too polemical, too narrow in its focus, and too often evaluated using criteria that are theological or religious instead of philosophical. Our diagnosis is that, because of the emotional and psychosocial aspects of religion, many philosophers of religion suffer from cognitive biases and group influence. We support this diagnosis in two ways. First, we examine work in psychology on cognitive biases and their affective triggers. This work supports the view that, while cognitive biases are no doubt a problem in all inquiry and in all areas of philosophy, they are particularly damaging to inquiry in philosophy of religion. Second, we examine work in social and evolutionary psychology on religious sociality and its attendant emotions. This work establishes that the coalitional features of religion are correlated with group bias, and we contend that this bias is also harmful to inquiry in philosophy of religion. We close by offering both a prognosis and recommendations for treatment.What is the first business of philosophy? To part with self-conceit. For it is impossible for anyone to begin to learn what he thinks that he already knows.-Epictetus, Discourses, Book 2, Ch. 17I think it clearly and abundantly evident that true religion lies very much in the affections.-Jonathan Edwards, A Treatise Concerning Religious Affections, Part 31. SymptomsIt is widely believed, at least by philosophers of religion, that philosophy of religion is flourishing. It is not difficult to find evidence supporting this optimistic assessment. For example, many university students at all levels are intensely interested in the subject, and philosophy of religion gamers far more attention from people outside academia than most other areas of philosophy. Also, in terms of sheer quantity of articles, books, conferences, and specialty journals, philosophy of religion compares favorably with many other areas of philosophy. This has not always been so. Philosophers of religion today, including the two of us, owe a considerable debt of gratitude to the extraordinarily talented philosophers responsible for the growth of philosophy of religion in the second half of the twentieth century. Their own careers would not have been possible were it not for ground-breaking work by distinguished thinkers like William Alston, Nelson Pike, Alvin Plantinga, William Rowe, and Richard Swinburne, to mention just a few.Having said that, our role in this paper will be that of the proverbial skunk at the garden party. For in spite of the recent expansion of work in philosophy of religion, it exhibits at least four symptoms of poor health: it is too partisan, too polemical, too narrow in its focus, and too often evaluated using criteria that are theological or religious instead of philosophical. Before we offer any diagnosis, we describe these symptoms in more detail. We do not, however, try to prove that philosophy of religion exhibits these symptoms. Instead, we assume that most philosophers familiar with the literature in philosophy of religion will easily recognize them.Partisanship is so entrenched that most philosophers of religion, instead of being alarmed by it, just take it for granted. This manifests itself in a variety of ways. For example, for the sake of balance, editors of collections on topics in philosophy of religion usually invite both theists and nontheists to contribute, assuming that they know which side each will take on the topic of the collection, even when taking the unexpected side is perfectly compatible with the authors' theism or nontheism. A philosopher of religion who is a theist, for example, could consistently admit (and even defend the view) that horrendous evil is strong evidence against theism, so long as they think, for instance, that this evidence is outweighed by even stronger evidence (whether inferential or noninferential) on the other side. …