G4 Form Research Articles

Regulated and constitutive secretion of distinct molecular forms of acetylcholinesterase from PC12 cells.

PC12 cells secrete the enzyme acetylcholinesterase (AChE) while at rest, and increase the overall rate of this secretion 2-fold upon depolarization. This behavior is different from the release of other markers by the constitutive or regulated secretory pathways in PC12 cells. Both the resting and stimulated release of AChE are unchanged after treatment with a membrane-impermeable esterase inhibitor, demonstrating that it represents true secretion and not shedding from the cell surface. The stimulation release of AChE is Ca(2+)-dependent, while the unstimulated release is not. Analysis of the molecular forms of AChE secreted by PC12 cells indicates that the release of AChE actually involves two concurrent but independent secretory processes, and that the G4 form of the enzyme is secreted constitutively, while both the G2 and G4 forms are secreted in a regulated manner, presumably from regulated secretory vesicles. Compared with other regulated secretory proteins, a much smaller fraction of cellular AChE is secreted, and the intracellular localization of this enzyme differs from that of other regulated secretory proteins. The demonstration that a cell line that exhibits regulated secretion of acetylcholine (ACh) is also capable of regulated secretion of AChE provides additional evidence for the existence of multiple regulated secretory pathways within a single cell. Moreover, there appears to be a selective packaging of different molecular forms of AChE into the regulated versus the constitutive secretory pathway. Both the specificity of sorting of AChE and the regulation of its secretion suggest that AChE may play a more dynamic role in synaptic function than has been recognized previously.

The activity of S.pombe DSC-1-like factor is cell cycle regulated and dependent on the activity of p34cdc2.

In the eukaryotic cell cycle, there are major control points in late G2 to determine the timing of the initiation of mitosis, and in late G1, regulating entry into S phase. In yeasts, this latter control is called start. Traverse of the start control and progression to S phase is accompanied by an increase in the expression of some of the genes whose products are required for DNA synthesis. In Saccharomyces cerevisiae, the coordinate expression of these genes in late G1 is dependent on a cis-acting sequence element called the MluI cell cycle box (MCB). A transcription factor called DSC-1 binds these elements and mediates cell cycle regulated transcription, though it is unclear whether this is by cell cycle-dependent changes in its activity. A DSC-1-like factor has also been identified in the fission yeast S.pombe. This is composed of at least the products of the cdc10 and sct1/res1 genes, and binds to the promoters of genes whose expression increases prior to S phase. We demonstrate that p85cdc10 is a nuclear protein and that the activity of the S.pombe DSC-1 factor varies through the cell cycle; it is high in cells that have passed start, decreases at the time of anaphase, remains low during the pre-start phase of G1 and increases at the time of the next S phase. We also show that the reactivation in late G1 is dependent on the G1 form of p34cdc2.

Amphiphilic and hydrophilic forms of acetyl- and butyrylcholinesterase in human brain.

Human brain acetylcholinesterase (AChE) and butyrylcholinesterase (BuChE) were sequentially extracted, first with a Tris-saline buffer (S1) and then with 1% (w/v) Triton X-100 (S2). About 20 and 30% of the AChE and BuChE activities were recovered in S1 and most of the remaining enzymes in S2. Main molecular forms of about 10.5 S and 12.0 S, G4 forms of AChE and BuChE, and smaller amounts of 4.5 S and 5.5 S forms, G1 species of AChE and BuChE, were measured in S1. Application of Triton X-114 phase partitioning and affinity chromatography on phenyl-agarose to S1 revealed that 25% of the AChE and none of the BuChE molecules displayed amphiphilic properties. Analysis of the enzyme activity retained by the phenyl-agarose showed that G1 AChE constituted the bulk of the amphiphilic molecules released without detergent. Main G4 forms of AChE and BuChE were found in the S2 extract. Eighty and 45% of the AChE and BuChE activities in S2 were measured in the detergent-rich phase by Triton X-114 phase partitioning. Thus, most of the AChE and about half of the BuChE molecules in S2 displayed amphiphilic properties. The main peak of BuChE, a 12.0 S form in gradients made with Triton X-100, splits into two peaks of 9.5 S and 12.5 S in Brij 96-containing gradients. This suggests that hydrophilic G4 BuChE forms are predominant in S1 and that hydrophilic and amphiphilic isoforms coexist in S2.

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.

Cloning and expression of a rat acetylcholinesterase subunit: generation of multiple molecular forms and complementarity with a Torpedo collagenic subunit.

We obtained a cDNA clone encoding one type of catalytic subunit of acetylcholinesterase (AChE) from rat brain (T subunit). The coding sequence shows a high frequency of (G+C) at the third position of the codons (66%), as already noted for several AChEs, in contrast with mammalian butyrylcholinesterase. The predicted primary sequence of rat AChE presents only 11 amino acid differences, including one in the signal peptide, from that of the mouse T subunit. In particular, four alanines in the mouse sequence are replaced by serine or threonine. In northern blots, a rat AChE probe indicates the presence of major 3.2- and 2.4-kb mRNAs, expressed in the CNS as well as in some peripheral tissues, including muscle and spleen. In vivo, we found that the proportions of G1, G2, and G4 forms are highly variable in different brain areas. We did not observe any glycolipid-anchored G2 form, which would be derived from an H subunit. We expressed the cloned rat AChE in COS cells: The transfected cells produce principally an amphiphilic G1a form, together with amphiphilic G2a and G4a forms, and a nonamphiphilic G4na form. The amphiphilic G1a and G2a forms correspond to type II forms, which are predominant in muscle and brain of higher vertebrates. The cells also release G4na, G2a, and G1a in the culture medium. These experiments show that all the forms observed in the CNS in vivo may be obtained from the T subunit. By co-transfecting COS cells with the rat T subunit and the Torpedo collagenic subunit, we obtained chimeric collagen-tailed forms. This cross-species complementarity demonstrates that the interaction domains of the catalytic and structural subunits are highly conserved during evolution.

Amphiphilic forms of butyrylcholinesterase in mucosal cells of rat intestine.

The properties of a cholinesterase from mucosal cells of rat intestine have been characterized. The enzyme was identified as butyrylcholinesterase because it was more sensitive to iso-OMPA (IC50 = 1.0 x 10(-6) M) than to BW284C51 (IC50 = 5.5 x 10(-5) M) and was not inhibited by substrate excess. It displayed a higher affinity for acetylthiocholine than for butyrylthiocholine. A major molecular form was observed sedimenting at 5.9 S. Two other minor molecular forms were identified as a hydrophilic tetramer (G4, sedimenting at 10.5 S) and a monomer (G1, sedimenting at 4.3 S). The 5.9 S component was referred to as "G" form (G for globular) and not "G2" as usual dimers for the following reasons: (i) the G form was unaffected by the reducing agents, beta-mercaptoethanol and dithiothreitol, which converted disulfide-linked dimers of acetylcholinesterase into monomers, (ii) the G form was shifted from 5.9 to 3.4 S when the sucrose gradient contained Triton X-100. This value of 3.4 S (in Triton X-100) appeared too low for a typical G2 form. The shift in the S value was partly reversible: the 3.4 S form resedimented at 5.2 S in the absence of detergent. The behavior of the G form in sucrose gradients indicated that it was amphiphilic. This was confirmed in nondenaturing electrophoreses and also by quantitative binding of the G form to octyl-Sepharose. The hydrophobic domain of the G form was not a glycolipid, as shown by its insensitivity to Bacillus thuringiensis phosphatidylinositol-specific phospholipase C and its nonaggregating properties in the absence of nondenaturing detergent.(ABSTRACT TRUNCATED AT 250 WORDS)

Acetylcholinesterases of the nematode Steinernema carpocapsae. Characterization of two types of amphiphilic forms differing in their mode of membrane association.

We analyzed the molecular forms of acetylcholinesterase (AChE) in the nematode Steinernema carpocapsae. Two major AChEs are involved in acetylcholine hydrolysis. The first class of AChE is highly sensitive to eserine (IC50 = 0.05 microM). The corresponding molecular forms are: an amphiphilic 14S form converted into a hydrophilic 14.5S form by mild proteolysis and two hydrophilic 12S and 7S forms. Reduction of the amphiphilic 14S form with 10 mM dithiothreitol produces hydrophilic 7S and 4S forms, indicating that it is an oligomer of hydrophilic catalytic subunits linked by disulfide bond(s) to a hydrophobic structural element that confers the amphiphilicity to the complex. Sedimentation coefficients suggest that 4S, 7S, 12S forms correspond to hydrophilic monomer, dimer, tetramer and that the 14S form is also a tetramer linked to one structural element. The second class of AChE is less sensitive to eserine (IC50 = 0.1 mM). Corresponding molecular forms are hydrophilic and amphiphilic 4S forms (monomers) and a major amphiphilic 7S form converted into a hydrophilic dimer by Bacillus thuringiensis phosphatidylinositol-specific phospholipase C. This amphiphilic 7S form thus possesses a glycolipid anchor. It appears that Steinernema (a very primitive invertebrate) presents AChEs with two types of membrane association that closely resemble those described for amphiphilic G2 and G4 forms of AChE in more evolved animals.

Size and charge isomers of acetylcholinesterase in the cerebral cortex of young and aged rats

Previous studies in this laboratory showed an age-related decline of acetylcholinesterase (AChE) activity in the cerebral cortex of rats. In the present study the age-related differences in enzymatic activity were evaluated in terms of individual molecular forms. Extracts containing total, soluble and membrane-bound AChE were analyzed both by ultracentrifugation in sucrose gradient and by non-denaturing gradient polyacrylamide gel electrophoresis. By ultracentrifugation two molecular forms, namely 10S and 4S (corresponding to tetrameric-G4 and monomeric-G1 forms, respectively) were separated in extracts of total and soluble AChE, while only 10S forms were present in extracts of membrane-bound AChE. Electrophoresis of soluble AChE extracts revealed slowly- and fast-migrating bands, grouped in two clusters of at least three bands each; membrane-bound AChE contained only a single slowly-migrating band. Electrophoresis of the single forms isolated by ultracentrifugation showed that slowly- and fast-migrating bands corresponded to G4 and G1 forms, respectively. Therefore, in soluble AChE no one-to-one relationship between charge- and size-isomers was observed; on the contrary, such relationship has been shown for membrane-bound AChE. This implies that soluble G4 forms and membrane-bound-G4 forms are electrophoretically different, being heterogeneous the former and homogeneous the latter. The age-related decline of total AChE, accompanied by a decrease of G4/G1 ratio, depended mainly on a decrease of membrane-bound AChE while soluble AChE and its G4/G1 ratio was unchanged. The qualitative pattern of charge isomers was not modified by aging.

The monoclonal antibody 2G8 is carbohydrate‐specific and distinguishes between different forms of vertebrate cholinesterases

The monoclonal antibody (mAb) 2G8 (subclass IgG2a) raised against acetylcholinesterase (AChE, EC 3.1.1.7) from electric organ of Torpedo nacline timilei crossreacted with AChE from Torpedo marmorata, electric eel (Electrophorus electricus), flounder (Platichthys flesus) body muscle, rat brain, bovine brain, and human brain, this suggests that the epitope to which mAb 2G8 bound had been highly conserved during evolution. No crossreaction was found with AChE from human and bovine erythrocytes, nor with butyrylcholinesterase (BtChE, EC 3.1.1.8) from human serum. Binding of mAb 2G8 to the globular G2 form of AChE from T. marmorata strongly decreased enzyme activity, while no significant inhibition was found with either collagen-tailed, asymmetric forms, or with the enzymes from flounder body muscle or mammalian sources. The possibility that mAb 2G8 bound to anionic sites of AChE could be excluded since neither edrophonium chloride nor decamethonium bromide influenced the binding of 2G8 to the enzymes. Enzyme-linked immunosorbent assay and Western blot showed that heat-denatured, diisopropylfluorophosphate-treated, CNBr- and trypsin-digested AChE from T. marmorata still reacted with mAb 2G8; this indicates that the epitope to which 2G8 bound, at least partially, belonged to a continuous determinant. Treatment of cholinesterases with N-glycosidase F abolished crossreaction with 2G8, showing that an essential part of the epitope consisted of N-linked carbohydrates.

Sex-related differences in the expression of chick enterocyte butyrylcholinesterase during embryonic and post-hatching development

The butyrylcholinesterase activity of chick enterocytes was studied from day 15 in ovo up to day 90 after hatching. The activities detected in both sexes at the level of jejuno-ileum change in a parallel manner, but the activity is always higher in the female than in the male during embryonic development. After hatching, the differences are less apparent although the study of the enzyme distribution along the intestine showed sex-related variations, mainly at the level of the anterior and middle parts of jejuno-ileum in the young adult. Analysis of butyrylcholinesterase by sucrose gradient centrifugation allowed to identify two globular soluble species (G1 and G4 forms). The G4/(G1 + G4) ratio decreases during the development but this variation in the female does not parallel that observed in the male. Besides, the molecular form distribution along the intestine, studied after hatching, differs according to the sex. Taken together our results lead to hypothesize that the ontogeny and the regulation of the chick enterocyte butyrylcholinesterase depend on hormones.

Embryonic and post-natal changes in activity and molecular forms of mucosal cell butyrylcholinesterase in chicken intestine

The mucosal cells of the chicken intestine contain a cholinesterase activity essentially due to butyrylcholinesterase. The enzyme is present during embryonic and post-hatching development. The activity reaches a maximum value at day 19 in ovo and decreases prior to and after hatching up to day 4 ex ovo. Then the activity again rises reaching a second maximum at 2-3 weeks. Beyond this stage, the activity slowly decreases leveling off to the value determined in adult chicken. The enzyme exists as two globular forms (G1 and G4) soluble at low-ionic strengths. The G4 form is predominant in ovo up to day 19. From this stage and after hatching the G1 form is the main one. This change in the form proportion differentiates the mucosal cell butyrylcholinesterase from butyrylcholinesterase of other origins such as the chicken plasma enzyme which always shows a predominant G4 form.

Differential association and distribution of acetyl- and butyrylcholinesterases within rat liver subcellular organelles.

Rat liver cholinesterases were found to share properties and characteristics with those expressed in cholinergic tissues. The distribution and presence of different molecular forms of cholinesterases in different subcellular organelles of rat liver were studied. The rough and smooth endoplasmic reticulum and Golgi apparatus were enriched in the G4 molecular form of acetylcholinesterase (AChE) (relative to the G2 molecular form), while the inverse was found in the plasma membrane. The interaction of these molecular forms of AChE with the Golgi membrane was studied in detail. Approximately one-half of the G4 form was free within the lumen while the remainder was an intrinsic membrane protein; all the G2 molecular form was anchored to the membrane via phosphatidylinositol. Only the G1 and G2 molecular forms of butyrylcholinesterase (BuChE) were found in the above subcellular organelles; both molecular forms were soluble within the lumen of Golgi vesicles. These results indicate that rat liver expresses several molecular forms of AChE which have multiple interactions with membranes and that liver is unlikely to be the source of the G4 form of BuChE present in high concentration in the plasma.

Molecular forms of acetylcholinesterase in two sublines of human erythroleukemia K562 cells

Acetylcholinesterase (AChE) in K562 cells exists in two molecular forms. The major form, an amphiphilic dimer (G2a) which sediments at 5.3 S, and the minor form, an amphiphilic monomer (G1a) which sediments at 3.5 S. Extraction in the presence of the sulfhydryl alkylating agent N-ethylmaleimide was required to preserve the G2a form. In Triton X-100 extracts of the subline K562-243, phosphatidylinositol-specific phospholipase C (PtdIns-PLC) from Bacillus thuringiensis converted most of the G2a AChE into a hydrophilic dimer (G2h), indicating that the G2a form possessed a hydrophobic glycoinositol phospholipid that mediated its attachment to the membrane. Treatment of intact K562-243 cells with PtdIns-PLC released approximately 60% of the total AChE activity and provided an estimate of the externally exposed AChE. The direct conversion from an amphiphilic to a hydrophilic dimeric form by PtdIns-PLC was not obtained in extracts or intact cells of the subline K562-48. Instead, pretreatment with alkaline hydroxylamine was necessary to render the amphiphilic G2 form of this subline susceptible to digestion by the phospholipase. In this respect, the amphiphilic dimer of K562-48 AChE resembles the G2a form of human erythrocyte AChE, which is resistant to PtdIns-PLC because of the direct palmitoylation of an inositol hydroxyl group in the anchor [Roberts et al. (1988) J. Biol. Chem. 263, 18766-18775]. Release of this acyl chain by hydroxylamine renders the enzyme susceptible to PtdIns-PLC [Toutant et al. (1989) Eur. J. Biochem. 180, 503-508]. In both K562 sublines, sialidase decreased the migration of the G2a form but not of the G1a form of AChE. G1a forms thus appear to represent an intracellular pool of newly synthesized molecules residing in a compartment proximal to the trans-Golgi apparatus. The sialidase-resistant G1a molecules were also resistant to PtdIns-PLC digestion; possible explanations for this resistance are presented.

Phosphatidylinositol-specific phospholipase C solubilized G2 acetylcholinesterase from plasma membranes of chromaffin cells.

Using whole homogenates and defined subcellular fractions of bovine adrenal medulla, we investigated the properties of the dimeric G2 molecular form of acetylcholinesterase (AChE), its distribution, and the mode of attachment to chromaffin cells. Our studies indicate that a substantial fraction of the G2 form is specifically susceptible to solubilization by phosphatidylinositol-specific phospholipase C (PIPLC) from subcellular fractions enriched with plasma membrane fragments. The results suggest that the G2 form of AChE is anchored in the plasma membrane to a glycolipid domain that contains phosphatidylinositol. Since a Ca+2-dependent PIPLC has been previously described in chromaffin granules, it is possible that the adrenal AChE could be released by a system reminiscent of that involved in the case of the surface glycoprotein of Trypanosoma brucei.

Alterations in the distribution of cholinesterase molecular forms in maternal and fetal brain following diisopropyl fluorophosphate treatment of pregnant rats.

Previous work in this laboratory showed that during intoxication of rats with diisopropyl fluorophosphate at day 20 of pregnancy the recovery of ChE activity was faster in fetal than in maternal brain. In the present study the differences between recovery rats in dam and fetus brain were evaluated in terms of molecular forms and spontaneous reactivation. Using ultracentrifugation on sucrose gradient two molecular forms of ChE, namely 10S (tetrameric globular G4 form) and 4S (monomeric G1 form) were detected both in maternal and fetal brain of untreated rats. The ratios 10S/4S were about 5.0 and 0.75 for dams and 20-day fetuses, respectively. DFP administration (1.1 mg/kg sc) inducing at 90 min an about 80% inhibition of ChE in maternal brain caused a shift in its 10S/4S ratio to 1.63, and to 0.53 in fetal brain (in which overall inhibition was about 70%). This means that 10S forms were preferentially inhibited by DFP both in maternal and fetal brain. After 24 and 48 hr there was a negligible recovery of overall ChE in maternal brain with no shift in the ratio. On the other hand, complete recovery of ChE in fetal brain within 48 hr was accompanied by almost total normalization of the 10S/4S ratio. Rapid recovery of fetal ChE appeared not to depend on hydrolysis of DFP-inhibited ChE. In fact, maternal and fetal DFP-inhibited enzyme preparations following the addition of oximes (pralidoxime or obidoxime) in vitro showed similar rates of reactivation. The overall data indicate considerable differences in recovery rate of molecular forms between dams and fetuses, but not in reactivation by dephosphorylation.

Characterization of cholinesterase molecular forms in the mucosal cells along the intestine of the chicken.

The presence of a butyrylcholinesterase (BuChE, EC 3.1.1.8) in the musocal cells of the chicken intestine was demonstrated by histochemical and biochemical methods. The study of its distribution, along the intestine from duodenum to rectum, showed that the jejuno-ileum possesses the highest activity. Sucrose gradient centrifugation revealed, in all intestinal areas, two globular forms with sedimentation coefficients of 4.3 S (G1 form) and 10.8 S (G4 form). The presence of Triton X-100 in the preparations did not modify the sedimentation profiles of these two forms which can be considered as soluble BuChE. The ratio of G1/G4-forms progressively decreases along the intestine from duodenum to rectum indicating a predominance of the G4 form in the areas where the activity is low. Our results are discussed in relation to other studies of globular forms of chicken BuChE.

Reduced Axonal Transport of the G4 Molecular Form of Acetylcholinesterase in the Rat Sciatic Nerve During Aging

Aging in the sciatic nerve of the rat is characterized by various alterations, mainly cytoskeletal impairment, the presence of residual bodies and glycogen deposits, and axonal dystrophies. These alterations could form a mechanical blockade in the axoplasm and disturb the axoplasmic transports. However, morphometric studies on the fiber distribution indicate that the increase of the axoplasmic compartment during aging could obviate this mechanical blockade. Analysis of the axoplasmic transport, using acetylcholinesterase (AChE) molecular forms as markers, demonstrates a reduction in the total AChE flow rate, which is entirely accounted for by a significant bidirectional 40-60% decrease in the rapid axonal transport of the G4 molecular form. However, the slow axoplasmic flow of G1 + G2 forms, as well as the rapid transport of the A12 form of AChE, remain unchanged. Our results support the hypothesis that the alterations observed in aged nerves might be related either to the impairment in the rapid transport of specific factor(s) or to modified exchanges between rapidly transported and stationary material along the nerves, rather than to a general defect in the axonal transport mechanisms themselves.

Maintenance by glycyl-L-glutamine in vivo of molecular forms of acetylcholinesterase in the preganglionically denervated superior cervical ganglion of the cat.

The 24-hr intracarotid infusion of plasma-treated glycyl-L-glutamine (3 microM) produced significant enhancement of the monomeric G1 and tetrameric G4 forms of acetylcholinesterase of the cat superior cervical ganglion 48 hr after denervation, in comparison with denervated, noninfused controls. No significant effect of glycyl-L-glutamine could be demonstrated 4 or 6 days after denervation. These findings are consistent with the conclusion, drawn from a previous in vitro study, that glycyl-L-glutamine acts at a stage prior to the aggregation of the G1 form into higher polymers to maintain the acetylcholinesterase content of denervated ganglia. It is proposed that the dipeptide may regulate the transcription of the DNA for acetylcholinesterase to its corresponding mRNA.

Cartilage proteoglycans. Assembly with hyaluronate and link protein as studied by electron microscopy.

Aggregates formed by the interaction of cartilage proteoglycan monomers and fragments thereof with hyaluronate were studied by electron microscopy by use of rotary shadowing [Wiedemann, Paulsson, Timpl, Engel & Heinegård (1984) Biochem. J. 224, 331-333]. The differences in shape and packing of the proteins bound along the hyaluronate strand in aggregates formed in the presence and in the absence of link protein were examined in detail. The high resolution of the method allowed examination of the involvement in hyaluronate binding of the globular core-protein domains G1, G2 and G3 [Wiedemann, Paulsson, Timpl, Engel & Heinegård (1984) Biochem. J. 224, 331-333; Paulsson, Mörgelin, Wiedemann, Beardmore-Gray, Dunham, Hardingham, Heinegård, Timpl & Engel (1987) Biochem. J. 245, 763-772]. Fragments comprising the globular hyaluronate-binding region G1 form complexes with hyaluronate with an appearance of necklace-like structures, statistically interspaced by free hyaluronate strands. The closest centre-to-centre distance found between adjacent G1 domains was 12 nm. Another fragment comprising the binding region G1 and the adjacent second globular domain G2 attaches to hyaluronate only by one globule. Also, the core protein obtained by chondroitinase digestion of proteoglycan monomer binds only by domain G1, with domain G3 furthest removed from the hyaluronate. Globule G1 shows a statistical distribution along the hyaluronate strands. In contrast, when link protein is added, binding is no longer random, but instead uninterrupted densely packed aggregates are formed.

Effects of glycyl-L-glutamine in vitro on the molecular forms of acetylcholinesterase in the preganglionically denervated superior cervical ganglion of the cat.

Normal and preganglionically denervated cat superior cervical ganglia were sectioned and cultured for 24 or 48 hr, with or without preliminary inactivation of acetylcholinesterase, and in the presence or absence of 10(-5) M glycyl-L-glutamine. They were then homogenized, and the molecular forms of acetylcholinesterase were analyzed by sucrose gradient sedimentation. We observed an increased proportion of the globular monomeric G1 form, and to a lesser extent of the dimeric G2 and tetrameric membranous G4 forms, of acetylcholinesterase in the glycyl-L-glutamine-treated compared with the control cultures. There was only a small increase in the total acetylcholinesterase activity and no significant variation in the activity of the metabolic enzyme lactate dehydrogenase. It therefore seems likely that glycyl-L-glutamine, or the endogenous neurotrophic factor, maintains acetylcholinesterase in the preganglionically denervated ganglia in vivo by specifically increasing the biosynthesis of the monomeric G1 form, but not that of other proteins; these trophic factors do not seem to promote the polymerization of G1 into the more complex G2 and G4 forms.