Fusiform Conidia Research Articles

Two new species of Nectriaceae (Hypocreales, Sordariomycetes) from Yunnan, China.

Nectriaceae is a highly diverse family, and members have a worldwide distribution, particularly in warm temperate to tropical regions. During the survey of fungal diversity in different habitats in Yunnan province, China, two new species isolated from soil and air respectively, namely Atractiumyunnanense sp. nov. and Nalanthamalaxishuangbannaensis sp. nov., were proposed based on morphological comparisons and the multi-gene phylogenetic analyses of combined ITS, LSU, rpb2, and tub2 sequence data. Phylogenetically, both species clustered in a monophyletic clade within Nectriaceae with strong support. A.yunnanense is characterized by synnematous conidiophores, pale olivaceous-green, clavate to oblong-ellipsoidal, multi-septate conidia, and pale olivaceous-green chlamydospores. N.xishuangbannaensis has acremonium-like or penicillium-like conidiophores and either obovate or ellipsoidal, cylindrical or fusiform conidia. Full descriptions, illustrations, and a phylogenetic tree showing the phylogenetic position of the two new species were provided.

First report of Colletotrichum siamense causing anthracnose in Oenocarpus bacaba in Brazil.

Bacaba (Oenocarpus bacaba Mart.) is a native palm tree from Brazilian Amazon and Cerrado biomes. This tree produces a small, rounded fruit with dark skin and approximately 1.5 mm thick pulp, extensively utilized for palm heart extraction, juices, and jellies (De Cól et al. 2021). However, several diseases can adversely impact fruit yield and quality. During the 2021 growing season, anthracnose symptoms were observed in Bacaba fruits, with a disease incidence of 58% in fruits collected from the Abreulândia (9°37'15″ S, 49°9'3″ W) and Gurupi (12°25'46" S; 49°16'42" W) municipalities in Tocantins state, Brazil. A total of 198 fruits exhibiting anthracnose symptoms, characterized by deep necrotic spots, were collected. In the laboratory, symptomatic fruits had their external surfaces sterilized for 30 seconds in 70% ethanol, 1 min in 1.5% NaOCl, and then rinsed with sterile distilled water. Sterilized pieces of the fruit tissue were transferred to PDA medium and incubated for 7 days at 28 ºC with a 12 h photoperiod. After this period, two isolates were obtained from the colonies and were identified both macroscopically and microscopically as Colletotrichum sp. The colonies grown at PDA showed a white to grey cottony mycelia, with straight and fusiform conidia, ranging from 14.0 to 21.0 (mean value of 15.8 ± 1.8) µm in length and 4.0 to 7.0 (mean value of 5.5 ± 0.7) µm in width, (n = 50). For species identification, the intergenic spacer between DNA lyase, mating-type locus MAT1-2-1 (APN2/MAT-IGS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), glutamine synthetase (GS), and β-tubulin (TUB) loci were amplified and sequenced. Resulting sequences were deposited in GenBank (OR333843, OR333844, OR333845 and OR333846). BLAST analysis of the partial APN2/MAT-IGS (99%), GAPDH (99,48%), GS (99,32%) and TUB (99,48%) sequences showed highly similarity to C. siamense isolates (IIFT223 and CBS130147). Maximum likelihood multilocus analysis placed the isolate UFTC16 within the C. siamense clade with 98% bootstrap support, clearly assigning the isolate to this species. Morphological features were consistent with the description of C. siamense (Prihastuti et al., 2009). Inoculation of Bacaba fruits and seedlings was conducted to confirm pathogenicity. The surface of uninjured Bacaba fruits was inoculated with two drops (20 μL) of conidial suspension (106 conidia mL-1). The same methodology was adopted to placed healthy leaves of 35-day-old seedlings grown in plastic tubes. Two drops of sterile distilled water were inoculated on nonwounded healthy fruits and seedlings as a negative control. The fruits and seedlings were incubated for five days in a controlled chamber at 28 °C, 70-80% humidity and a "12-h photoperiod". The experiment was conducted with five replicates (five fruits and five seedlings inoculated per isolate) and repeated once. Typical symptoms of anthracnose were observed in the fruits and leaves of Bacaba seedlings five days after inoculation. No symptoms were observed in the negative control. The pathogen was reisolated from symptomatic fruits and leaves, showing similar morphological characteristics as the original isolate, fulfilling Koch's postulates. The identification of C. siamense as the causal agent of Bacaba anthracnose helps in the diagnosis and disease control strategies of the disease. Colletotrichum siamense is a cosmopolitan species and easily found in cultivated and non-cultivated species (Batista et al. 2023). However, to the best of our knowledge, this is the first report of C. siamense causing anthracnose on Bacaba.

First Report of Leaf Blight Caused by Botryosphaeria dothidea on Aucuba japonica in Zhejiang Province, China.

Aucuba japonica var. variegata Dombrain is a common evergreen cultivated ornamental in China (Li et al. 2016). In December 2022, severe leaf blight on A. japonica was observed next to the Meishiyuan of Zhejiang Normal University (29°8'4″N, 119°37'54″E) in Jinhua City, Zhejiang Province, China. There were seven plants in the surveyed area, and over 50% of leaves were affected. The early symptoms were small gray spot parts with brown borders on the tip of the leaves. Then the grey parts gradually expanded and became brownish black. In severe cases, the whole leaves became black and blighted. To identify the pathogen, 5 symptomatic leaves were randomly collected from 5 plants and cut into small pieces (5 mm × 5 mm), surface disinfected in 1% sodium hypochlorite solution for 3 min, followed by 75% alcohol for 30 s, then rinsed in sterile distilled water thrice. Tissues were cultured on potato dextrose agar (PDA) and incubated at 28°C for 7 days. Pure cultures were obtained by the single-spore method. Thirteen strains were isolates from the tissues, and nine of them showed similar morphological characteristics. Colonies were white initially, then became gray. The undersides of the colonies became black gradually. Hyaline, fusiform conidia (n = 30) were 17.1 to 24.76 µm (average 20.39 ± 1.906 µm) in length and 5.4 to 6.61 µm (average 6.19 ± 0.434 µm) in width. The DNA of nine isolates were extracted by Ezup Column Bacteria Genomic DNA Purification Kit, and their sequences were identical, so they were named QM1. The internal transcribed spacer (ITS) region, translation elongation factor 1-α (TEF1), and β-tubulin (TUB2) genes were amplified with primer pairs ITS1/ITS4, TEF1-728F/TEF1-986R and βt2a/βt2b (Slippers et al. 2004), respectively. The BLAST analysis indicated that ITS (OR215464), TEF1 (OR243689), and TUB2 (OR243688) of the isolate QM1 were 99 to 100% identical to those of Botryosphaeria dothidea (GenBank accession nos. MH329646 for ITS sequences; OL891702 for TEF1 sequences; MK511445 for TUB2 sequences). In addition, the phylogenetic tree based on sequences from ITS, TEF1 and TUB2 was constructed with MEGA 11 by use of the maximum likelihood method with 1,000 bootstrapping iterations. Based on the multi-locus phylogeny and morphological features, the isolate QM1 was identified as B. dothidea. To test the Koch's postulates, ten leaves from three healthy two- to three-year-old A. japonica plants were surface disinfested with 75% ethanol for 30 s, rinsed with ddH2O three times. The leaves were wounded with a sterile needle and inoculated with 2ml drop of the isolate QM1 conidial suspension (106 spores/mL), with sterile distilled water as a control. All plants were placed in a greenhouse at 28°C, >70% relative humidity and 12 h light/day. The experiment was repeated three times. After 7 days, leaves of the inoculated group showed symptoms similar to those observed on the naturally infected leaves, while leaves of the control group remained asymptomatic. The pathogen was reisolated from inoculated leaves and was confirmed as B. dothidea based on morphological and molecular analyses. It has been reported B. dothidea cause leaf disease in a wide range of hosts in China, such as Camellia oleifera (Hao et al. 2023), Kadsura coccinea (Su et al. 2021). To our knowledge, this is the first report of Botryosphaeria dothidea causing leaf blight on Aucuba japonica in Zhejiang Province of China. B. dothidea are usually secondary invaders and are known to cause diseases in stressed plants. The results further expand the host-range of B. dothidea, and would help to establish control strategy against the disease.

Bipolaris fujianensis sp. nov., an Emerging Pathogen of Sapling Shoot Blight on Chinese Fir, and Its Sensitivity to Fungicides.

Chinese fir is an extremely important economic tree species in southern China. In recent years, 74.5% of Chinese fir saplings suffered from shoot blight in Shunchang County, Nanping City, Fujian Province, China. Seventeen isolates were collected from rotten shoots, and their pathogenicity was confirmed following Koch's postulates. The five pathogenic isolates were identified as belonging to the genus Bipolaris based on morphological characteristics, including septate and geniculate conidiophores, smooth to slightly verruculose conidiogenous nodes, dematiaceous phragmospore conidia, oblong or fusiform conidia, and slightly protruding or truncate hilum on conidia, but the number of pseudosepta (3 to 11, mostly 5 to 8) and the size of conidia ([22.81 to 116.13] × [9.16 to 26.58] μm) are different from those of the known species of Bipolaris. A phylogenetic analysis based on ITS, GAPDH, and Tef1-α sequences determined that the five strains belong to a new species of Bipolaris, and the name Bipolaris fujianensis sp. nov. is proposed. The fungicide sensitivity of the pathogen strain Cfsb3 was further evaluated using eight fungicides. Flusilazole, difenoconazole, tebuconazole, and propiconazole exhibited high toxicity to Cfsb3, and the effective concentration inhibiting 50% (EC50) of mycelial growth was 0.08, 0.20, 0.34, and 0.36 μg/ml, respectively, for these four fungicides. Flusilazole, difenoconazole, and iprodione inhibited B. fujianensis by 100% on detached Chinese fir shoots at their recommended concentrations, but azoxystrobin and thiram were ineffective. In conclusion, this study reported an emerging pathogen of Chinese fir sapling shoot blight and proposed triazole and dicarboximide fungicides for disease control.

Moelleriella simaoensis, a new entomogenous species of Moelleriella (Clavicipitaceae, Hypocreales) from Southwestern China

A new species of Moelleriella, described as Moelleriella simaoensis from Pu’er City, Yunnan Province, was discovered during a diversity survey of entomopathogenic fungi in Southwestern China. It was characterized by producing brightly colored and thin-pulvate stromata, subglobose to ovoid perithecia, cylindrical asci, disarticulating part-spores inside the ascus, and fusiform conidia. Both anamorphic and teleomorphic states were most often found on the same stroma, and the orange conidiomata were aggregated in the center of the stroma. Conidiomata were widely open with several locules per stroma. Multigenes phylogenetic analyses based on nrLSU, tef-1α and rpb1 sequences showed that this species formed a distinct clade and was closely related to Moelleriella puerensis and Moelleriella raciborskii. The Description and illustration of the new species were provided in the present study.

First Report of Nalanthamala psidii causing wilt disease of guava in Guangdong, China.

Guava (Psidium guajava L.) is a tropical fruit with great economic value. Guangdong is one of the most important guava production areas. In November 2019, guava wilt disease (GWD) was observed in a 10.6 HA commercial orchard in NanSha district, Guangzhou, Guangdong (22°37'37.626" N, 113°35'56.089" E). Disease incidence was up to 35%. Initially, leaves on the top of some branches became purple or yellow interveinal chlorosis, later dry. Infection severely became systemic developing vascular discoloration of stem, black root rot, eventually entire trees wilted and died. The root tissues were cut into 5-mm2 pieces and surface disinfected with 70% ethanol for 30 sec, 3 % sodium hypochlorite for 4 min, rinsed by the sterile water, then plated onto potato dextrose agar and incubated for 5 days at 25°C. A total of 8 monoconidial isolates with identical colony morphology were obtained. All formed cottony, whitish to pale yellow colonies. Conidiophores were dimorphic, penicillate and acremonium-like. Penicillate conidiophores gave rise to ovoidal, one-celled conidia (4.15 to 6.55×2.28 to 4.61 μm) (n=100) with truncated ends. Cylindrical or fusiform conidia (7.02 to 15.57×2.01 to 5.30 μm) (n=100) arose in long chains on acremonium-like conidiophores. Morphological characteristics of the isolates were consistent with those of Nalanthamala psidii (syn. Myxosporium psidii) reported by Schroers (2005). The rDNA internal transcribed spacer (ITS) and partial nuclear large-subunit ribosomal DNA (LSU) of two representative isolates (GDNS02 and GDNS08) were amplified using the primers pairs ITS4/ITS5 (White et al. 1990) and V9G/LR5 (de Hoog and Gerrits van den. 1998), respectively. The obtained sequences were deposited in GenBank under the accession nos. OM278372 to 73 (ITS) and OM278377 to 78 (LSU). BLASTn analysis showed 99.81% and 100% identities with the reported sequences of N. psidii CBS 116952 (AY864836) and CBS 110507 (AY554243). Maximum likelihood analyses of combined ITS and LSU sequences indicated that these two isolates being clustered with N. psidii strains. Pathogenicity tests were performed twice using healthy seedlings (60-70 cm height, cv. pearl). Each stem of five seedlings was wounded using a 5-mm sterile cork borer, and 5-day-old mycelium plugs of isolate GDNS08 were inoculated into the holes (25-cm above the soil line) and covered with Parafilm, sterile PDA plugs were placed into the wounds of additional 5 control seedlings. All plants were kept in a greenhouse (25℃, 80% relative humidity, 16/8-h day/night). After 3 months, all inoculated plants developed purple leaf, defoliation and wilt symptoms resembling those observed in the orchards, while the controls remained asymptomatic. Nalanthamala psidii was reisolated from the roots tissue of the inoculated plants, identity was confirmed by morphological characteristics and ITS sequence analyses as described above, but not from the controls, fulfilling Koch's postulates. Nalanthamala psidii has been previously reported as the causal agent of guava wilt in Taiwan, Philippines, South Africa and Bangladesh (Hsieh et al. 1976; Opina 1995; Schoeman et al. 1997; Alam et al. 2019). To our knowledge, this is the first report of N. psidii causing guava wilt in Guangdong, China. The outbreak of GWD in South Africa in the 1980s resulted in devastating losses to guava industry (Schoeman et al. 1997). Further research is needed to develop the integrated management to constrain this disease from spreading.

Morphology, phylogeny, mitogenomics and metagenomics reveal a new entomopathogenic fungus Ophiocordycepsnujiangensis (Hypocreales, Ophiocordycipitaceae) from Southwestern China.

Ophiocordyceps contains the largest number of Cordyceps sensu lato, various species of which are of great medicinal value. In this study, a new entomopathogenic fungus, Ophiocordycepsnujiangensis, from Yunnan in southwestern China, was described using morphological, phylogenetic, and mitogenomic evidence, and its fungal community composition was identified. It was morphologically characterized by a solitary, woody, and dark brown stromata, smooth-walled and septate hyphae, solitary and gradually tapering conidiogenous cells with plenty of warty protrusions, and oval or fusiform conidia (6.4-11.2 × 3.7-6.4 µm) with mucinous sheath. The phylogenetic location of O.nujiangensis was determined based on the Bayesian inference (BI) and the maximum likelihood (ML) analyses by concatenating nrSSU, nrLSU, tef-1a, rpb1, and rpb2 datasets, and ten mitochondrial protein-coding genes (PCGs) datasets (atp6, atp9, cob, cox2, nad1, nad2, nad3, nad4, nad4L, and nad5). Phylogenetic analyses revealed that O.nujiangensis belonged to the Hirsutellasinensis subclade within the Hirsutella clade of Ophiocordyceps. And O.nujiangensis was phylogenetically clustered with O.karstii, O.liangshanensis, and O.sinensis. Simultaneously, five fungal phyla and 151 fungal genera were recognized in the analysis of the fungal community of O.nujiangensis. The fungal community composition differed from that of O.sinensis, and differences in the microbial community composition of closely related species might be appropriate as further evidence for taxonomy.

Understanding the Etiology of Chilli Fruit Rot Disease in Tamil Nadu

Background: Fruit rot is an age old destructive disease of chilli caused by complex fungal pathogens resulting in severe yield losses both at pre and post-harvest stages. Hence, this study aims to investigate the occurrence of fruit rot disease in Tamil Nadu and to identify the fungal pathogens associated with fruit rot symptoms based on morpho-molecular characters. Methods: Roving survey was conducted in various districts of Tamil Nadu to determine the prevalence of fruit rot disease and to ascertain its causative agents. The pathogens were identified based on the conidial morphology, cultural characteristics and further confirmed by Polymerase chain reaction (PCR) using ITS 1 and ITS 4 primers. Result: Maximum disease severity was documented in Dharmapuri followed by Namakkal and lowest in Nagapattinam district. Ten isolates representing two genera viz., Colletotrichum and Fusarium were recovered from fruit rot infected chilli fruits and validated by pathogenicity test. Based on the morpho-cultural characters, 2 isolates were identified as Fusarium sp., with oval/ellipsoidal microconidia and straight/curved macroconidia, 6 isolates as Colletotrichum scovillei with fusiform conidia and 2 isolates as Colletotrichum truncatum with falcate conidia. The virulent isolates were further confirmed as C. scovillei based on PCR amplification of ITS region of genomic DNA.

Cordyceps yaoluopingensis sp. nov., a new entomopathogenic species from China

Entomopathogenic fungi have evolved in concert with insects for a long time and possess unique insecticidal properties and significant biological control, and medicinal potential. However, they are frequently overlooked and many previously unknown species have yet to be discovered and described. Cordyceps yaoluopingensis, a new species from Yaoluoping Nature Reserve in Anhui Province, China is defined as a new species based on morphology and molecular phylogenetic analyses. The new species has shorter synnemata, longer phialides and larger ovoid or fusiform conidia. Phylogenetic analysis using the six loci ITS, LSU, SSU, tef1-α, rpb1 and rpb2 established the uniqueness of the new species.

First Report of Neofusicoccum parvum Causing Canker on Castanea sativa in Spain.

In April 2021, depressed bark with dark reddish coloration was observed on the stem of a five-year-old chestnut (Castanea sativa Mill.) plant, acquired from a commercial Galician nursery. One tissue sample was collected from the injury of this plant, surface-sterilized with 96% ethanol for 30 s and dried on sterilized tissue paper, plated on potato dextrose agar (PDA) and incubated at 25ºC. Fungal colonies were consistently isolated and after 5 days developed abundant greyish-white aerial mycelium. Two weeks later pycnidia with fusiform conidia were observed. For molecular identification, internal transcribed spacer (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTAT TGATATGC, White et al. 1990), beta-tubulin (BT2a: GGTAACCAAATCGGT GCTGCTTTC, BT2b: ACCCTCAGTGTAGTGACCCTTGGC, Glass & Donaldson 1995) and elongation factor (EF1-728F: CATCGA GAAGTTCGAGAAGG, EF1-1199R: GGGAAGTACCMGTGATCATGT, Walker et al. 2010) were amplified. BLAST analysis showed that ITS sequence of isolate LPPAF-971 (accession no. MZ314849) showed 99.63% identity with Neofusicoccum parvum isolates ACBA15 (accession no. KX244803) and mywxxq (accession no. MW767713), and 99.4% identity with isolate CMW9081T (accession no. AY230943). Beta-tubulin sequence (accession no. MZ561053) showed 100% identity with isolate GDTCMF1 (accession no. MN022786), and elongation factor sequence (accession no. MZ561054) showed 98.70% identity with isolate F7 (accession no. MN461166), all corresponding with N. parvum. Pathogenicity tests were carried out on ten five-year-old chestnut plants on which a 5mm PDA plug from the edge of an actively growing colony of the fungus was inoculated by a cut in the bark of one to three branches per plant up to a total of 16 inoculated branches and then wrapped with Parafilm©. Five plants inoculated with one plug of PDA without the fungus were used as controls. Plants were placed in a plastic tunnel with a lateral insect net, provided with drip irrigation and grown under natural conditions. Bark cankers symptoms similar to the one observed in the original sample were visible on all inoculated chestnut plants ten days after inoculation. No symptoms were observed on the controls. The assay was conducted twice. Fungal colonies morphologically identified as N. parvum were reisolated from bark cankers on inoculated chestnut plants, fulfilling Koch's postulates. C. sativa is a widely distributed multipurpose tree, with important economic, environmental, cultural, and heritage functions (Bounous & Beccaro 2019), which underlines the importance of this finding with a view on its sanitary control. In addition, N. parvum, teleomorph Botryosphaeria parva (Pennycook & Samuels) Crous, Slippers & Phillips (Crous et al. 2006), is the causal agent of cankers and dieback in many crops and trees (Phillips et al. 2013) worldwide, but until now it had not been detected in C. sativa. To the best of our knowledge, this is the first report worldwide of N. parvum causing disease on chestnut in Spain.

First Report of Fusarium Root Rot of Tobacco Caused by Fusarium sinensis in Henan Province China.

Tobacco (Nicotiana tabacum L.) is an economically important crop in China, with an estimated production of 2.2 million tons every year. In June 2018, tobacco plants within the municipality of Sanmenxia (Henan, China) showed symptoms of wilting with leaf yellowing and stunting. Diseased plants exhibited severe necrosis that advanced through the main root (Figure 1 A). The symptoms were observed in nineteen surveyed tobacco fields, 60 ha in total, and approximately 25% of the plants were symptomatic. The disease resulted in a severe loss in tobacco leaf production. Five symptomatic tobacco plants were sampled. Diseased tissues from roots were surface sterilized in 75% ethanol and placed on potato dextrose agar (PDA) medium. Eighteen of the 25 diseased tissues had cultures growing from them, and all the cultures were white colonies with abundant aerial mycelium produced scarlet pigmentation on PDA. One pure culture was obtained by single-spore culturing (SL1). A 10-day-old culture grown on CLA (carnation leaf agar) produced macroconidia that were falcate, straight or slightly curved, 3-septate, 25-35×3.5-4.5 μm (average 26.8×3.7 μm) (n=50). Two types of microconidia (napiform and fusiform) were formed on CLA that were hyaline, with one to two cells. Napiform conidia were 4.5-9.3×3.8-5.9 (average 7.3×5.0 μm) (n=50); fusiform conidia were 6.9-15.8×1.8-3.1 (average 9.9×2.5 μm). Spherical chlamydospores (7-12.5 μm) (n=50) were terminal or intercalary and produced in clumps or in chains (Figure1 B-D). Morphological characteristics of the isolate were similar to the features of Fusarium sinensis previously described by Zhao and Lu (2008). Molecular identification was performed using partial sequences of EF1-α gene (primers EF1/EF2, O'Donnell et al. 1998). Maximum parsimony and maximum likelihood-based methods were fitted using MEGA 7 (Moreira et al. 2019，Figure 2). The isolate was also sequenced for β-tubulin (primers T1/Bt-2b, O'Donnell & Cigelnik 1997)，ribosomal RNA gene (LSU, LROR/LR5 primers, Vu et al. 2019) and rDNA-ITS (ITS 1/ ITS 4 primers, White et al. 1990). Sequences were deposited in GenBank under accession numbers MT947797 (EF1-α), MW484999 (β-tubulin), MW486649 (LSU) and MT907471 (ITS). The obtained EF1-α sequence was 98.10% identity with those of F. sinensis (MG670388.1) in the GenBank database, whereas the β-tubulin, LSU and ITS sequences showed 100% identities to the corresponding DNA sequences in F. sinensis (GenBank Acc. Nos. KX880370.1, NG_067454.1 and MH863232.1, respectively). Morphological and molecular results confirmed this species as F. sinensis (Zhao and Lu 2008). Pathogenicity tests were performed on tobacco seedlings grown on an autoclaved matrix (YC/T310-2009). Healthy 6-leaf stage tobacco seedlings were inoculated by pouring a 20 mL conidial suspension (1×106 conidia/mL-1) around the stem base of each plant, 30 plant were inoculated. Thirty control seedlings received sterilized water. All treatments were maintained for 30 days under greenhouse conditions with a 12-h light/dark photoperiod at 25±0.5℃ and 70% relative humidity. The assay was conducted three times. Root rot and foliage chlorosis similar to the ones observed on infected plants in the field were observed on the inoculated tobacco seedlings, whereas the control seedlings remained asymptomatic after 30 days (Figure1 E). The pathogen isolated from the inoculated plant exhibited morphological characteristics identical to F. sinensis and was identified by a partial EF1-α gene sequence. This disease has previously been reported as the causal agent of root and crown rot of wheat in China (Zhao and Lu 2008; Xu et al. 2018). To our knowledge, this is the first report of F. sinensis causing root rot on tobacco in China. Funding: Funding was provided by the Science and Technology Project of Henan Provincial Tobacco Company (2020410000270012), Independent Innovation Project of Hennan Academy of Agricultural Sciences (2020ZC18) and Research and Development project of Henan Academy of Agricultural Sciences (2020CY010).

Freshwater hyphomycetes in Sordariomycetes: two new species of Tainosphaeria (Chaetosphaeriaceae, Chaetosphaeriales) from Thailand

Ongoing investigation of diversity and taxonomy of lignicolous freshwater fungi in Thailand have revealed plenty of new hyphomycetous species. In this study, Tainosphaeria aquatica sp. nov. and T. thailandense sp. nov., occurred on submerged wood in Thailand, are described and illustrated based on the evidences of morphological characters and phylogenetic analysis of combined LSU, ITS and TEF1-α dataset. Tainosphaeria aquatica is characterized by hyaline, 0–3-septate, cylindrical to long fusiform conidia with hair-like, hyaline appendages at both ends. Tainosphaeria thailandense is distinct in having laurel-green, 0–1-septate, reniform to ellipsoidal conidia with polar appendages. A synopsis of morphological characteristics of Tainosphaeria species is provided.

First Report of Botryosphaeria dothidea Causing Stem Canker on Soybean in China.

In September 2020, widespread stem canker on soybean (Glycine max) was detected in southeastern Jiangsu (Nantong municipality; 120.76° E, 32.23° N) in China. Mature plants, 14 weeks of cultivation, exhibited brown necrotic lesions and dried-up stem. The symptoms were observed in eleven soybean fields, 1.6 ha in total, and approximately 80% of the plants were symptomatic. The symptoms were consistent with those previously reported for stem canker on soybean caused by Diaporthe aspalathi, D. caulivora and D. sojae (Ghimire et al. 2019; Mena et al. 2020). Small pieces, approximately 0.4 cm2 in size, of symptomatic tissue were surface sterilized in 1.5% NaOCl for 1 min, and washed twice with sterile ddH2O. The pathogen was isolated and cultured on potato dextrose agar (PDA), containing chloramphenicol (50 µg/mL), under darkness at 28 ºC for 7 days. Amplification of internal transcribed spacer (ITS), elongation factor 1-α (EF1-α) and β-tubulin (TUB2) genes was performed using ITS1/ITS4, EF1-728F/EF1-986R and Bt2a/Bt2b primers, respectively (Jia et al. 2019). Sequences were submitted to GenBank under accession numbers MW130133 (ITS), MW147481 (EF1-α) and MW147482 (TUB2). Blast search revealed that the amplified sequences had 99.65% (ITS; B. dothidea JZB310202, MN945381), 100% (EF1-α; B. dothidea ZB-77, MH726166) and 99.75% (TUB2; B. dothidea ZB-1, MN642587) matches to multiple B. dothidea strains, whereas all reported Diaporthe strains showed no nucleotide identity to the amplified sequences. Molecular phylogenetic tree was constructed using MEGA7 to confirm the identity of the pathogen. ITS, EF1-α and TUB2 sequences were blasted separately in Muscle (https://www.ebi.ac.uk/Tools/msa/muscle/) and then combined together to make the phylogenetic tree. The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura 3-parameter model, and the tree with the highest likelihood (-4291.3981) is shown in Figure 1. Diaporthe strains found causing stem canker on soybean, some Phytophthora sojae strains (which also cause dried-up stem on soybean) (Yang et al. 2019), and B. dothidea strains found in China in other hosts were included in the phylogenetic tree. To confirm pathogenicity, a sterilized spatula was used to make wounds (3 mm diameter, 1 mm depth) on the stem of 2-week old soybean plants. Mycelial plugs from a 7 day-old culture on PDA were placed on the wounds and covered with Parafilm. Sterilized PDA plugs were used as control. Inoculated plants were maintained in a growth chamber at 28 °C and 60% relative humidity. Typical stem canker symptoms were observed 5 days after inoculation (Figure 2). Microscope observations showed the presence of septate mycelium, fusiform conidia and round conidiomata, and agreed with those previously reported for the morphology of B. dothidea strains (Phillips et al. 2013). During recent months, B. dothidea was reported to cause stem canker and leave wilt on a number of plant species in China (Huang et al. 2020; Ju et al. 2020; Wang et al. 2020a, 2020b, 2020c), confirming the expansion and host promiscuity of this pathogen. Stem canker on soybean has been thoroughly associated to Diaporthe strains; however, this is the first report of B. dothidea causing this disease. We believe that our results will help to better understand the pathogens affecting soybean production in China.

Tree inhabiting gnomoniaceous species from China, with Cryphogonomonia gen. nov. proposed.

Species of Gnomoniaceae are commonly associated with leaf spot diseases of a wide range of plant hosts worldwide. During our investigation of fungi associated with tree diseases in China, several gnomoniaceous isolates were recovered from symptomatic branches and leaves on different woody plants in the Fagaceae, Pinaceae, and Salicaceae families. These isolates were studied by applying a polyphasic approach including morphological, cultural data, and phylogenetic analyses of partial ITS, LSU, tef1, rpb2 and tub2 gene sequences. As a result, three species were identified with characters fitting into the family Gnomoniaceae. One of these species is described herein as Cryphognomonia pinigen. et sp. nov., characterized by developed pseudostromata and ascospores with obvious hyaline sheath; Gnomoniopsis xunwuensissp. nov. is illustrated showing sympodially branched conidiophore, oval or fusiform conidia; and one known species, Plagiostoma populinum. The current study improves the understanding of gnomoniaceous species causing diebacks and leaf spot on ecological and economic forest trees.

Emendation of Kiliophora (Xylariales incertae sedis), a new species and a new combination

Kiliophora is a hyphomycete genus whose species are involved in leaf litter decomposition. It was originally described with polytretic conidiogenesis. Based on observation of fresh specimens collected in Brazil and bibliographic revision, an emended description is proposed in order to rectify the mode of conidial production. The presence of minute polar extensions at both ends of conidia is stated as a diagnostic generic character. A new species, Kiliophora clavatophora, and a new combination, Kiliophora aseptata, are proposed. The new species is characterized by its conidiophores with clavate apical cell, its ellipsoidal conidiogenous cell and fusiform conidia. A table for comparison of all accepted species is also included.

First Report of Neoscytalidium dimidiatum Causing Root Rot in Sweet Potato in Brazil

In January 2018, a large number of tuberous roots of sweet potato were lost in a production field in Jaiba, State of Minas Gerais, Brazil. Immediately after harvest, the roots showed dark spots on the surface, extending to the center, causing an internal, brown to black necrosis. Two symptomatic roots (cultivar Canadense) from different parts of the field were subjected to fungus isolation by removal of fragments between symptomatic and healthy tissue, followed by surface sterilization in 70% ethanol and then in sodium hypochlorite (1%) for 1 and 3 min, respectively, rinsing in sterile water, and incubation in PDA plates for 25°C in the dark. A gray to black, fast-growing fungus with abundant arthroconidia in aerial mycelia was isolated from all samples after 4 days of incubation. Hyphal tips were excised and transferred to new PDA plates, and two pure cultures (isolates) were obtained. Based on these characteristics, the fungus was identified as Neoscytalidium. For morphological analysis, culture sporulation was induced as described by Machado et al. (2014). Microscopic examination of the fungal structures identified arthroconidia with one to two septa, released by hyphal fragmentation, 4.2 to 9.5 × 3.2 to 5.3 μm, and a pycnidial synanamorph with hyaline, ellipsoid to nearly fusiform conidia, 7.4 to 12.7 × 4.2 to 6.3 μm. The morphological characteristics were similar to Neoscytalidium dimidiatum (Phillips et al. 2013). To confirm species identification, genomic DNA was extracted, and sequences of the internal transcribed spacer of the rDNA and translation elongation factor 1-α (TEF1-α) were obtained (Machado et al. 2014) and deposited in GenBank (accession nos. MH636327, MH636328, MH349427, and MH349428, respectively). According to a BLAST search, the TEF1-α sequences showed 99% identity with N. dimidiatum (accession no. KF553902). A combined phylogenetic tree obtained by Bayesian inference using MrBayes version 3.1.1 (Ronquist and Huelsenbeck 2003) grouped the isolates within the N. dimidiatum clade, confirming the species identification. One representative isolate (URM 7888) was deposited in the culture collection “Micoteca URM Profa. Maria Auxiliadora Cavalcanti” at the Universidade Federal de Pernambuco (Recife, Brazil). The pathogenicity test was performed by inoculating asymptomatic roots (cultivar Canadense), previously sterilized on the surface with 0.5% sodium hypochlorite and unwounded or wounded with a sterile scalpel at two equidistant points, with conidia suspension. Arthroconidia suspension (20 μl, 2.4 × 10⁶ conidia/ml) obtained from 7-day-old colonies was pipetted onto the inoculation sites. Sterile distilled water was used for the control instead of inoculum. Five roots were used for each treatment. The inoculated roots were maintained in plastic boxes containing moistened paper towels at approximately 25°C for 15 days. After 7 days, it was possible to observe initial symptoms of internal brown to black rot, which increased in size after 15 days. The fungus was reisolated, and pathogenicity was confirmed. The control and unwounded roots remained asymptomatic. In Brazil, N. dimidiatum has been reported causing collar and root rot in physic nut (Machado et al. 2012), black root rot in cassava (Machado et. al., 2014), and dieback in mango (Marques et al. 2013). To our knowledge, this is the first report of N. dimidiatum causing root rot of sweet potato in Brazil.

Vamsapriya yunnana, a new species of Vamsapriya (Xylariaceae, Xylariales) associated with bamboo from Yunnan, China

Vamsapriya yunnana sp. nov., collected from dead bamboo in Yunnan Province of China, is described and illustrated in this paper. The new taxon is characterized by synnematous conidiophores, with enteroblastic, monotretic conidiogenous cells and brown to dark brown, 4–9-septate, fusiform conidia with a long, apical, appendage-like region. The species differs from the type and other species in the genus in having a wider fertile region and rostrate apex of the conidia. Maximum likelihood and Bayesian inference analyses of a combined ITS, LSU and RPB2 DNA sequence dataset show that V. yunnana is a new species, belonging to the genus Vamsapriya in Xylariaceae.

Bipolaris marantae sp. nov., A Novel Helminthosporoid Species Causing Foliage Blight of the Garden Plant Maranta leuconeura in Brazil

A severe leaf spot, turning to foliage blight, was observed on leaves of Maranta leuconeura growing in a garden in Brazil (state of Rio de Janeiro) in 2015. A dematiaceous hyphomycete bearing a morphology typical of a helminthosporoid fungi was regularly found in association with diseased tissues. The fungus was isolated and pathogenicity was demonstrated through the completion of Koch’s postulates. A morphology and molecular analysis led to the conclusion that the fungus belonged to the genus Bipolaris, which is characterized by having fusiform conidia, externally thickened and truncate hila and a bipolar pattern of germination. Additionally, homology of internal transcribed spacer and GAPDH sequences with sequences of other Bipolaris species, confirmed its generic placement. A phylogenetic study also indicated clearly that the fungus on M. leuconeura is phylogenetically distinct from related species of this genus, leading to the proposal of the new species Bipolaris marantae.

Monochaetia ilexae sp. nov. (Pestalotiopsidaceae) from Yunnan Province in China

Monochaetia is a pestalotiopsis-like genus characterized by 3–5-septate hyaline to brown conidia with single apical and basal appendages. Monochaetia species exhibit diverse conidial morphology, but many species lack molecular data and thus it is not clear if the genus is monophyletic. In this paper, combined LSU and ITS sequence data and morphological traits are used to introduce a new Monochaetia species, M. ilexae from Yunnan Province, China from dead leaves of Ilex species. Monochaetia ilexae shares similar morphology with the type, M. monochaeta and M. kansensis having fusiform conidia and has a similar range of conidia. However M. ilexae differs from M. monochaeta and M. kansensis having different conidia length, apical and basal appendage lengths. Phylogeny agrees with morphological differences allowing Monochaetia ilexae as a new species that clusters with Monochaetia species, but is separated from the main clade with high support.

Phylogenetic assessment and taxonomic revision of Mariannaea

Four new species of Mariannaea were described in this paper, namely M. chlamydospora, M. cinerea, M. fusiformis, and M. lignicola. Mariannaea chlamydospora is characterized by its cream-colored, zonate colonies on PDA, smooth conidiophores, fusiform conidia, and abundant chlamydospores. Mariannaea cinerea forms grey colonies and ellipsoidal to subglobose conidia. Mariannaea fusiformis forms purple colonies and fusiform to subglobose conidia. Mariannaea lignicola has brown conidiophores and broad hyphae. The molecular phylogeny was inferred using ITS, LSU, and TUB-2 loci. The type species of Mariannaea (M. elegans) is epitypified. The variety M. elegans var. punicea is raised to species rank. Mariannaea clavispora is excluded from Mariannaea because of its cylindrical phialides, straight conidial chains and deviating phylogenetic affinity. Mariannaea nipponica did not fit well the generic concept of Mariannaea based on their morphological characters, and its generic placement remains uncertain. A key to the currently accepted 15 species of Mariannaea is provided.