Fungus Leptosphaeria Maculans Research Articles

Genetic structure of a population of the fungus Leptosphaeria maculans in a disease nursery of Brassica napus in Australia

Microsatellite, minisatellite and mating type markers were used to determine the genetic structure of the fungus Leptosphaeria maculans within a disease nursery, where Brassica napus lines were screened for resistance to blackleg disease under high inoculum pressure. Fungal isolates were collected from pseudothecia in infected stubble and pycnidia within cotyledon lesions on seedlings within the nursery. Genetic diversity was high with gene diversity at H=0.700 across four polymorphic loci, and genotypic diversity at D=0.993. Among the 159 isolates analysed, 102 multilocus genotypes were identified. The even distribution of mating type idiomorphs MAT1-1 and MAT1-2 and gametic equilibrium within the population provided further evidence of random mating. Genetic diversity was distributed on a very fine scale in the disease nursery. The majority of genetic diversity (67%) was distributed among conidia within a lesion or among ascospores from a piece of stubble, while the remainder (33%) was distributed within lesions on seedlings or different stubble pieces. There were no among-group differences between samples from stubble and seedlings. This is consistent with the low level of genetic differentiation between the ascospore and conidia samples (F (ST)=0.017) indicating that all isolates of L. maculans from the disease nursery most likely belong to one population, and that ascospores form the primary inoculum in the disease nursery.

Recurring challenges from a necrotrophic fungal plant pathogen: a case study with Leptosphaeria maculans (causal agent of blackleg disease in brassicas) in Western Australia.

Blackleg disease of Brassica napus, caused by the necrotrophic fungus Leptosphaeria maculans, causes severe yield losses in Australia, Europe and Canada. In Western Australia, it nearly destroyed the oilseed rape industry in 1972 when host genotypes and conducive environmental conditions favoured severe epidemics. The introduction of cultivars with polygenic resistance and the adoption of sound cultural practices two decades later helped to manage the disease. These were abandoned by many farmers in recent years in favour of the effective but ephemeral resistance conferred by the single dominant gene-based resistance derived from B. rapa ssp. sylvestris. Recently, several cultivars carrying this gene have collapsed widely within a period of 3 years after their commercial release. An environment conducive to the disease and the association of the pathogen with susceptible hosts in Western Australia for over 80 years together have led to the proliferation of L. maculans races, amounting to half of all races delineated to date from Europe, including the United Kingdom, Canada and Australia. This review demonstrates the problems that emerge when traditional cultural practices employed, along with cultivars containing polygenic resistance to a serious necrotrophic pathogen, are discarded in preference to the exclusive deployment of effective but ephemeral single dominant gene-based resistance to the disease across Southern Australia. Single dominant gene-based resistance currently available, on its own, will not confer durable resistance to blackleg disease in oilseed rape. Return to earlier management practices, including reliance upon polygenic resistance and induced resistance, may be the best currently available options to maintain production in regions across Southern Australia predisposed to severe epidemics.

RGA- and RAPD-derived SCAR markers for a Brassica B-genome introgression conferring resistance to blackleg in oilseed rape

An introgression derived from the B genome of Brassica juncea in spring-type oilseed rape (B. napus) conferring recessively inherited cotyledon resistance against several pathotypes of the blackleg fungus Leptosphaeria maculans was mapped using PCR-based molecular markers. Resistance-associated B-genome-specific randomly amplified (RAPD) and resistance gene analog (RGA) DNA polymorphisms were converted into three sequence-specific markers (SCARs; B5-1520, C5-1000, RGALm). The flanking sequence of the RGALm locus was determined by genomic walking, leading to a 1,610-bp EcoRV fragment which showed extensive homology to known and putative resistance genes of a cluster on Arabidopsis chromosome 5. Partial sequence analysis of the genomic RAPD segment OPC-05-1700 revealed strong homology to the gibberellin 2-oxidase gene of Arabidopsis. The SCAR markers were analyzed in two segregating populations and were found to be linked in coupling to each other, and in repulsion to the resistance locus. In both populations, markers deviated significantly from a monogenic 3:1 segregation ratio, with plants lacking the markers being more frequent than expected. Although the mode of introgression is yet unknown, the recombinant individuals observed among susceptible progeny suggest homeology between the B-genome-specific segment and its B. napus counterpart. This would offer prospects for reducing the size of the introgression and further fine mapping of the resistance locus.

Conversion of cDNA differential display results (DDRT-PCR) into quantitative transcription profiles

BackgroundGene expression studies on non-model organisms require open-end strategies for transcription profiling. Gel-based analysis of cDNA fragments allows to detect alterations in gene expression for genes which have neither been sequenced yet nor are available in cDNA libraries. Commonly used protocols for gel-based transcript profiling are cDNA differential display (DDRT-PCR) and cDNA-AFLP. Both methods have been used merely as qualitative gene discovery tools so far.ResultsWe developed procedures for the conversion of cDNA Differential Display data into quantitative transcription profiles. Amplified cDNA fragments are separated on a DNA sequencer and detector signals are converted into virtual gel images suitable for semi-automatic analysis. Data processing consists of four steps: (i) cDNA bands in lanes corresponding to samples treated with the same primer combination are matched in order to identify fragments originating from the same transcript, (ii) intensity of bands is determined by densitometry, (iii) densitometric values are normalized, and (iv) intensity ratio is calculated for each pair of corresponding bands. Transcription profiles are represented by sets of intensity ratios (control vs. treatment) for cDNA fragments defined by primer combination and DNA mobility. We demonstrated the procedure by analyzing DDRT-PCR data on the effect of secondary metabolites of oilseed rape Brassica napus on the transcriptome of the pathogenic fungus Leptosphaeria maculans.ConclusionWe developed a data processing procedure for the quantitative analysis of amplified cDNA fragments separated by electrophoresis. The system utilizes common software and provides an open-end alternative to DNA microarray analysis of the transcriptome. It is expected to work equally well with DDRT-PCR and cDNA-AFLP data and be useful particularly in reseach on organisms for which microarray analysis is not available or economical.

Saskatchewan Regional Meeting, 2004

Biological control of apple scab using Microsphaeropsis ochracea: the impact of water volume, spore concentration, and formulation. K.L. Bailey, O. Carisse, M. Leggett, G. Holloway, F. Leggett, T.M. Wolf, A. Shivpuri, J. Derby, B. Caldwell, and H.J. Geissler. Saskatoon Research Centre, Agriculture and Agri-Food Canada (AAFC), 107 Science Place, Saskatoon, SK S7N 0X2, Canada; (O.C.) Horticultural Research and Development Centre, AAFC, 430 Gouin Boulevard, Saint-Jean-sur-Richelieu, QC J3B 3E6, Canada; (F.L.) Lethbridge Research Centre, AAFC, P.O. Box 3000, Lethbridge, AB T1J 4B1, Canada; (M.L., G.H.) Philom Bios, 318–111 Research Drive, Saskatoon, SK S7N 3R2, Canada; and (A.S.) Rajasthan Agricultural University, Durgapura, Jaipur 302018, India. Screening of Brassica napus and Phaseolus vulgaris for physiological resistance to Sclerotinia sclerotiorum. L. Buchwaldt, D. Hegedus, R. Li, and R. Rimmer. Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada. Brassinin-detoxifying enzymes from the pathogenic fungus Leptosphaeria maculans isolates Laird-2 and Mayfair-2. R.S. Gadagi, M. Jha, and M.S.C. Pedras. Department of Chemistry, 110 Science Place, University of Saskatchewan, Saskatoon, SK S7N 5C9, Canada. Effect of camalexin and spirobrassinin on the rate of detoxification of the phytoalexin brassinin by Leptosphaeria maculans (Phoma lingam). M. Jha and M.S.C. Pedras. Department of Chemistry, 110 Science Place, University of Saskatchewan, Saskatoon, SK S7N 5C9, Canada. Mapping the blackleg resistance gene LepR3 using Arabidopsis–Brassica collinearity. N. Larkan, M. Nelson, F. Yu, C. Hammond, I. Parkin, W. Cowling, D. Lydiate, and R. Rimmer. School of Plant Biology, Faculty of Natural and Agricultural Sciences, The University of Western Australia, 35 Stirling Highway, Crawley, WA 6009, Australia; and (F.Y., C.H., I.P., D.L., R.R.) Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada. Brassinin oxidase — a phytoalexin-detoxifying enzyme from the phytopathogenic fungus Leptosphaeria maculans. O. Okeola, M. Jha, and M.S.C. Pedras. Department of Chemistry, 110 Science Place, University of Saskatchewan, Saskatoon, SK S7N 5C9, Canada. Preliminary population structure analysis of Plectosporium alismatis — a potential biocontrol agent for Alismataceae in Australian rice crops. W.M. Pitt, G.J. Ash, and E.J. Cother. Farrer Centre, School of Agriculture, Charles Sturt University, P.O. Box 588, Wagga Wagga, NSW 2678, Australia; and (E.J.C.) New South Wales Agriculture, Agricultural Research Institute, Forest Road, Orange, NSW 2800, Australia; (W.M.P.) present address: Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada. Phoma macrostoma — ITS sequencing provides confirmation of a unique genotype. W.M. Pitt, K.L. Bailey, Y.B. Fu, and G.W. Peterson. Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada. Putative transformation of the Alismataceae pathogen Plectosporium alismatis. W.M. Pitt, J.L. Taylor, G.J. Ash, and E.J. Cother. Farrer Centre, School of Agriculture, Charles Sturt University, P.O. Box 588, Wagga Wagga, NSW 2678, Australia; (J.L.T.) National Research Council of Canada, Plant Biotechnology Institute, 110 Gymnasium Place, Saskatoon, SK S7N 0W9, Canada; and (E.J.C.) New South Wales Agriculture, Agricultural Research Institute, Forest Road, Orange, NSW 2800, Australia; (W.M.P.) present address: Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada. Chemical investigation of phytoalexins from Brassica spp. M.G. Sarwar, M. Suchy, and M.S.C. Pedras. Department of Chemistry, 110 Science Place, University of Saskatchewan, Saskatoon, SK S7N 5C9, Canada.

Temperature, wetness period and inoculum concentration influence infection of canola (Brassica napus) by pycnidiospores ofLeptosphaeria maculans

Infection of canola (Brassica napus) by pycnidiospores of the blackleg fungus (Leptosphaeria maculans) and subsequent development of leaf and stem infection were influenced by temperature, wetness period and inoculum concentration. On cv. Hyola 42, as temperature decreased the latent period for leaf infection increased exponentially. The greatest number of leaf lesions developed on plants exposed to a day/night temperature of 18/15°C with a 96 h wetness period. Incidence of stem infection was greatest at 23/20°C with a 48–72 h wetness period, whereas no stem infection occurred 42 days after inoculation when plants were incubated at 8/6°C. This is the first report of the effect of temperature and wetness period on infection by pycnidiospores. The number of leaf lesions and incidence of stem cankers were greatest when plants were inoculated with 106 or 107 pycnidiospores/mL, respectively, the highest concentrations used in the experiments. The susceptible cv. Q2 developed significantly more leafand stem lesions than the less susceptible cw. Monty and Dunkeld when inoculated with 107 pycnidiospores/mL, but not at the lower concentrations. The moderately resistant cv. Dunkeld developed significantly fewer stem cankers than the other cultivars when inoculated with pycnidiospores at concentrations greater than 104/mL.

Sulphur Deficiency Causes a Reduction in Antimicrobial Potential and Leads to Increased Disease Susceptibility of Oilseed Rape

AbstractThe reduction of atmospheric sulphur dioxide pollution is causing increasing problems of sulphur deficiency in sulphur‐demanding crop plants in northern Europe. Elemental sulphur and many sulphur containing compounds such as cysteine‐rich antifungal proteins, glucosinolates (GSL) and phytoalexins play important roles in plant disease resistance. The aim of this work was to analyse the effect of inadequate sulphur supply on disease resistance of oilseed rape (Brassica napus). Compared with fertilized oilseed rape, healthy looking S‐deficient plants showed increased susceptibility to the blackleg fungus Leptosphaeria maculans, to the generalist necrotroph Botrytis cinerea and to the oomycete Phytophthora brassicae. To analyse possible causes of the increased disease susceptibility of S‐deficient plants, protein extracts and methanolic extracts of secondary metabolites of plants grown with and without adequate sulphur supply were tested for antimicrobial activity. None of the protein extracts showed antimicrobial activity. However, extracts containing secondary metabolites from normally grown plants showed a strong antimicrobial activity in in vitro tests with various fungal and bacterial pathogens. This activity was almost totally lost in extracts derived from S‐deficient plants. The antimicrobial activity did not appear to be based on the activity of phytoalexins because it was present in healthy plants and was not increased by a previous inoculation with Botrytis cinerea. The loss of antifungal activity in S‐deficient plants correlated with a strong reduction of various GSL, thus suggesting a reduced level of GSL as a possible cause of the reduced antimicrobial potential. However, limited tests of commercially available GSL or their degradation products did not demonstrate a causal link. Our results show that S‐deficiency of oilseed rape negatively affects disease resistance and suggest that this effect is at least partially caused by a reduction of sulphur‐dependent phytoanticipins.

The sirodesmin biosynthetic gene cluster of the plant pathogenic fungus Leptosphaeria maculans.

Sirodesmin PL is a phytotoxin produced by the fungus Leptosphaeria maculans, which causes blackleg disease of canola (Brassica napus). This phytotoxin belongs to the epipolythiodioxopiperazine (ETP) class of toxins produced by fungi including mammalian and plant pathogens. We report the cloning of a cluster of genes with predicted roles in the biosynthesis of sirodesmin PL and show via gene disruption that one of these genes (encoding a two-module non-ribosomal peptide synthetase) is essential for sirodesmin PL biosynthesis. Of the nine genes in the cluster tested, all are co-regulated with the production of sirodesmin PL in culture. A similar cluster is present in the genome of the opportunistic human pathogen Aspergillus fumigatus and is most likely responsible for the production of gliotoxin, which is also an ETP. Homologues of the genes in the cluster were also identified in expressed sequence tags of the ETP producing fungus Chaetomium globosum. Two other fungi with publicly available genome sequences, Magnaporthe grisea and Fusarium graminearum, had similar gene clusters. A comparative analysis of all four clusters is presented. This is the first report of the genes responsible for the biosynthesis of an ETP.

Potential for using host resistance to reduce production of pseudothecia and ascospores of Leptosphaeria maculans, the blackleg pathogen of Brassica napus

Pseudothecial density of the blackleg fungus Leptosphaeria maculans and discharge of ascospores was measured from stubble of a range of Brassica species, including Brassica napus (canola) cultivars, with a range of blackleg resistance. Since ascospores are the primary inoculum, these parameters reflect inoculum potential for blackleg. Stubble from a representative line of each of B. carinata, B. nigra, Sinapis alba and B. napus cv. Surpass 400 (incorporates blackleg resistance from B. rapa ssp. sylvestris) had lower pseudothecial density and discharged fewer ascospores than stubble of other B. napus cultivars (Karoo, Oscar, Emblem, Dunkeld and Columbus). These latter B. napus cultivars and a representative B. juncea line had higher pseudothecial densities and discharged higher numbers of ascospores. If this trait of low blackleg inoculum from stubble could be introgressed into commercial canola cultivars, blackleg disease severity could be substantially reduced, resulting in higher and more stable canola yields. However, the trait of reduced ascospore discharge may not be stable, as demonstrated by the B. rapa ssp. sylvestris‐derived resistance already being overcome by the blackleg fungus in Australia.

Negative selection using thymidine kinase increases the efficiency of recovery of transformants with targeted genes in the filamentous fungus Leptosphaeria maculans.

A vector system was constructed that is designed to decrease the number of transformants required to be screened when looking for gene disruption events in filamentous fungi. This vector was used to mutate two genes, an ATP-binding cassette transporter ( LmABCt4) and a two-component histidine kinase gene ( LmHK1) in the ascomycete Leptosphaeria maculans. The system uses the thymidine kinase gene from the herpes simplex virus as a negative selectable marker. Thymidine kinase expression is regulated by the TrpC regulatory elements from Aspergillus nidulans and should be applicable to other ascomycetous fungi. When thymidine kinase is expressed in the presence of particular thymidine analogues, these analogues are converted to toxic compounds which kill the cell. We also report the transformation of L. maculans using Agrobacterium tumefaciens-mediated DNA delivery.

Infection of Australian canola cultivars (Brassica napus) by Leptosphaeria maculans is influenced by cultivar and environmental conditions

Infection of canola (Brassica napus) by the blackleg fungus (Leptosphaeria maculans) and subsequent development of leaf and stem lesions was influenced by cultivar resistance and weather conditions. Cultivars Dunkeld, Hyola 42, Karoo, Monty, Pinnacle, Scoop and Mystic showed varying resistance to stem and cotyledon infection, but were susceptible to leaf infection. Fewer lesions were observed on the leaves of the highly resistant cv. Hyola 60 than on other cultivars and scanning electron microscopy revealed that pycnidiospore germination and mycelial growth were inhibited on cv. Hyola 60. Infection by natural ascospore inoculum was favoured by periods of increased rainfall, temperature and wind activity and infection was most prevalent early in the growing season, when plants were most vulnerable to leaf infection. Cultivar Hyola 60 developed very little disease and, hence, was unaffected by environmental conditions. On the intermediate cw. Hyola 42, Monty, Pinnacle and Scoop, disease incidence increased with rainfall pre-sowing, whereas this was not the case for the intermediate cw. Dunkeld, Karoo and Mystic and the susceptible cv. Q2. Disease development on all cultivars except Hyola 60 increased with decreased degree-days during leaf growth. Yield was closely correlated to incidence of stem canker on susceptible cultivars, but not resistant cultivars.

Blackleg Sporacle: A Model for Predicting Onset of Pseudothecia Maturity and Seasonal Ascospore Showers in Relation to Blackleg of Canola

ABSTRACT A simple model has been developed to predict the onset of pseudothecia maturity and seasonal ascospore showers in relation to blackleg disease in canola, caused by the fungus Leptosphaeria maculans. The model considers a combination of two weather factors, daily mean temperature and daily total rainfall, to drive progress of maturity of pseudothecia on the infested canola stubble left from past crops. Each day is categorized as suitable or not suitable for progress of the maturation process. The onset of pseudothecia maturity occurs when approximately 43 suitable days have occurred. Following the onset of maturity, ascospore showers are triggered when daily rainfall exceeds a threshold. The model satisfactorily predicted the timing of the onset of pseudothecia maturity when tested with 3 years of field observations at four locations in Western Australia, which characteristically has a Mediterranean climate. The model also agreed reasonably well with the daily pattern of ascospore release observed in two locations. Sensitivity analysis was performed to show the relative importance of the parameters that describe the onset of pseudothecia maturity.

Factors affecting production of inoculum of the blackleg fungus (Leptosphaeria maculans) in south-eastern Australia

The production of windborne ascospore inoculum of the blackleg fungus (Leptosphaeria maculans) was determined during 2000 and 2001 in 3 environments (Birchip, low rainfall; Wonwondah, medium rainfall; Lake Bolac, high rainfall) in Victoria. The weight of canola stubble (kg/ha) remaining on the soil surface in paddocks was estimated 6, 18, 30 and 42 months after harvest of the original canola crop. In all 3 environments only small amounts of stubble were present 18 months after harvest. Eighty percent of the 6-month-old stubble comprised stems and branches, with the remaining 20% being root material, while 42-month-old stubble consisted only of root material. Paddocks subjected to raking and burning contained only half the weight of stubble compared with paddocks that were harrowed. Where canola was harvested in January, even when no management strategy was used, 80% of subsequent stubble was no longer on the soil surface by July of that year. Pseudothecia from 6-month-old stubble from the high rainfall environment discharged significantly more ascospores than stubble of the same age from the medium rainfall environment, which in turn discharged more than stubble from the low rainfall environment. In all environments, paddocks containing 6-month-old canola stubble discharged 30-fold as many ascospores per hectare as older stubble paddocks.

Sensitivity of winter rapeseed (Brassica napus L.) to isolates of the fungus Leptosphaeria maculans (Desm.) Ces. et de Not

The pure cultures of the fungus Leptosphaeria maculans were isolated from the rapeseed leaves collected in Moravia. Two isolates were collected on the basis of their ability to produce yellow colour. The isolate producing yellow colour was classified as aggressive, while the isolate without the ability to produce yellow colour was not aggressive. The sensitivity to these isolates was verified in 11 rapeseed genotypes. This test was based on the method from the document Crucifer Genetics Cooperative (information document from the Department of Plant Pathology, University of Wisconsin). This method is based on the inoculation of cruciferous leaflets with suspension from the isolate of the pathogen observed. The scale from 0 to 9 was used for evaluation (0 = no darkening around the wound, 9 = accompanied by profuse sporulation in large, more than 5 mm, lesions with diffuse margins). The infection degree of the aggressive isolate ranged in different genotypes from 1.45 to 4.5, the results of the non-aggressive isolate ranged from 1.0 to 1.5. Based on these results the aggressive isolate was used for further tests of the selected breeding lines. The tests involved selected breeding materials, registered varieties, control varieties with different sensitivity to the isolate of Leptosphaeria maculans and control varieties included in state trials. The maximal difference in the sensitivity exhibited by individual genotypes was five degrees.

Transcription of sterol Delta(5,6)-desaturase and sterol 14alpha-demethylase is induced in the plant pathogenic ascomycete, Leptosphaeria maculans, during treatment with a triazole fungicide.

Two genes whose derived amino acid sequences closely resemble the ergosterol biosynthetic enzymes, sterol Delta(5,6)-desaturase (erg3) and sterol 14alpha-demethylase (erg11), were cloned from the plant pathogenic fungus Leptosphaeria maculans. Transcript levels of both these genes increased following exposure of L. maculans to the triazole fungicide, flutriafol, which specifically inhibits the ergosterol biosynthetic pathway. This induction may be due to a decrease in ergosterol content or to abnormal levels of the ergosterol precursor, 24-methylene dihydrolanosterol.

Transcription of sterol Δ 5,6-desaturase and sterol 14α-demethylase is induced in the plant pathogenic ascomycete, Leptosphaeria maculans, during treatment with a triazole fungicide

Two genes whose derived amino acid sequences closely resemble the ergosterol biosynthetic enzymes, sterol Δ 5,6-desaturase ( erg3) and sterol 14α-demethylase ( erg11), were cloned from the plant pathogenic fungus Leptosphaeria maculans. Transcript levels of both these genes increased following exposure of L. maculans to the triazole fungicide, flutriafol, which specifically inhibits the ergosterol biosynthetic pathway. This induction may be due to a decrease in ergosterol content or to abnormal levels of the ergosterol precursor, 24-methylene dihydrolanosterol.

Isocitrate lyase is essential for pathogenicity of the fungus Leptosphaeria maculans to canola (Brassica napus).

A pathogenicity gene has been identified in Leptosphaeria maculans, the ascomycetous fungus that causes blackleg disease of canola (Brassica napus). This gene encodes isocitrate lyase, a component of the glyoxylate cycle, and is essential for the successful colonization of B. napus. It was identified by a reverse genetics approach whereby a plasmid conferring hygromycin resistance was inserted randomly into the L. maculans genome. Twelve of 516 transformants tested had reduced pathogenicity on cotyledons of B. juncea and B. napus, and 1 of these 12 had a deletion of the isocitrate lyase gene, as well as an insertion of the hygromycin resistance gene. This mutant was unable to grow on fatty acids, including monolaurate, and the isocitrate lyase transcript was not detected. When the wild-type gene was reintroduced into the mutant, growth on monolaurate was restored and pathogenicity was partially restored. L. maculans isocitrate lyase is produced during infection of B. napus cotyledons, while the plant homologue is not. When 2.5% glucose was added to the inoculum of the isocitrate lyase mutant, lesions of sizes similar to those caused by wild-type isolate M1 developed on B. napus cotyledons. These findings suggest that the glyoxylate pathway is essential for disease development by this plant-pathogenic fungus, as has been shown recently for a fungal and bacterial pathogen of animals and a bacterial pathogen of plants. Involvement of the glyoxylate pathway in pathogenesis in animals and plants presents potential drug targets for control of diseases.

Symptoms of blackleg (Leptosphaeria maculans) on the roots of canola in Australia

The fungus Leptosphaeria maculans (anamorph Phoma lingam) causes blackleg in canola (Brassica napus). Infection of all above-ground parts of the plant has been described, but there are no reports of infection of roots. In a recent review West et al. (1999) described the common plant symptoms, but did not mention root infection. Canola plants at the flowering and pod-filling stages, with foliar symptoms of blackleg, were collected from commercial crops in South Australia, Victoria and New South Wales, Australia in November and December 2000. Some plants had lodged and had the basal cankers commonly described for blackleg, however, many plants had died prematurely during late pod fill. Cankers and other external symptoms were not present on the lower stems of these plants and many could be pulled easily from the ground. The lateral roots had blackened areas. Taproots had extensive internal tissue necrosis. In some plants, the pith of the stem was also necrotic, although there were no external symptoms. In another case, a distinct black band was seen around the circumference of the taproot below the crown. Samples of discoloured tissue were surface-sterilized and cultured on quarter-strength potato dextrose agar. Phoma lingam was isolated from all samples, identified as described by Punithalingham & Holliday (1972). All isolates were virulent (A-group) according to PCR-based tests carried out by the Root Disease Testing Service, South Australian Research and Development Institute (Sosnowski et al., 2001). Phytophthora and Rhizoctonia spp. were not isolated from the discoloured tissues. Pycnidiospore suspensions (106 spores mL−1) were prepared from two isolates of P. lingam (66/97 and 208/00) obtained from leaves and roots, respectively, of diseased plants. These suspensions were used to inoculate (i) lateral roots severed with surface-sterilized scissors; and (ii) hypocotyls wounded with sterile toothpicks on otherwise healthy canola seedlings in the glasshouse. Three weeks after inoculation, stem and crown cankers appeared on plants inoculated with either isolate on either roots or hypocotyls and root tissue was necrotic, whereas control plants, wounded as described above and inoculated with sterile water, remained healthy. Phoma lingam was the only pathogen isolated from diseased root tissue. This confirms the occurrence of the blackleg fungus in the roots of canola plants, and reveals its ability to infect through wounds in the roots. This is the first record of symptoms of blackleg on canola roots in Australia. However, there is anecdotal evidence that such symptoms have occurred in the past (D. Ballinger, Dovuro Pty Ltd, Horsham, Victoria, Australia, personal communication; M. Barbetti, Agriculture Western Australia, South Perth, Western Australia, Australia, personal communication). Initially it was assumed that the infection had spread from the crown into the roots, but new evidence suggests that the disease can also be soilborne. This may have important ramifications for understanding the blackleg disease cycle. This aspect will be investigated further in the current project entitled ‘Investigating resistance and management of blackleg in canola’, which is funded by the Australian Research Council, the South Australian Grains Industry Trust Fund and the South Australian Research and Development Institute.

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.

Prevalence of blackleg (Leptosphaeria maculans) on canola (Brassica napus) in Western Australia

Canola crops were monitored throughout the Western Australian wheatbelt during 1996–99 to determine the incidence and severity of crown cankers caused by the blackleg fungus (Leptosphaeria maculans). All crops surveyed had blackleg. The incidence of crown canker was 48–100%, 15–100%, 9–94% and 48–100% during 1996, 1997, 1998 and 1999, respectively. The mean incidence of crown cankers statewide was 85, 63, 55 and 85% in 1996, 1997, 1998 and 1999, respectively. The severity of crown canker (expressed as percentage disease index) ranged between 30 and 96%, 3 and 94%, 5 and 78% and 21 and 96% during 1996, 1997, 1998 and 1999, respectively. These high levels of blackleg can possibly be attributed to the accumulation of large amounts of infested canola residues. In 1999, there were effects of variety, application of the fungicide Impact, distance to last year’s canola residues and rainfall on the incidence and severity of blackleg. However, there were no effects of sowing date or region on the disease incidence or severity once the other factor effects listed above had been considered. In 1995, an additional survey of 19 sites in the central wheatbelt of Western Australia assessed the survival of the blackleg fungus on residues from crops grown in 1992–94. The residues at all sites carried blackleg. However, the extent of infection at any particular site varied from 12 to 100% of stems with the percentage of stems carrying pseudothecia containing ascospores varying between 7 and 96%. The high levels of blackleg disease found in commercial crops are indicative of significant losses in seed yields, making it imperative that management of blackleg be improved if canola is to remain a viable long-term cropping option in Western Australia.