FTA Cards Research Articles

Uracil-DNA-glycosylase-assisted loop-mediated isothermal amplification for detection of bacteria from urine samples with reduced contamination.

Loop-mediated isothermal amplification (LAMP) is a useful molecular biology technology for analytical applications, but it is prone to contamination because of escaped aerosols, leading to false positive results. This report establishes an integrated, rapid, and accurate method to detect bacteria in urine samples by incorporating uracil-DNA-glycosylase (UDG) into real-time loop-mediated isothermal amplification (RT-LAMP). To do this, nucleic acids from five clinically important uropathogens, including Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Proteus mirabilis, and Enterococcus faecalis, were directly captured and concentrated using Flinders Technology Associates (FTA) Elute cards. Following elution, the extracted DNAs were specifically amplified with sets of LAMP primers. The added UDG in the modified LAMP reaction excises uracils from previously amplified products or contaminants and generates apyrimidinic (AP) sites, reducing false positive rates. This UDG-assisted RT LAMP strategy was able to degrade carryover contaminants to as little as 1 femtogram (10-15 g). The assay showed a limit of detection of 104 CFU mL-1 with a sensitivity of 94.1% and a specificity of 95.0%. Both the sensitivity and specificity were improved compared to LAMP carried out without UDG. Our results indicate that the UDG-assisted RT LAMP is of great potential for rapid and precise analysis of nucleic acids in real applications.

Statistical Calculations in Case of Brother-Sister Incest

Incest is a sexual activity that happens between close family members that are not allowed to get married due to customs or law. In a case of incest between a brother and his married sister, a paternity test and astatistical analysis were performed at the laboratories of the Paternity and Kinship Division of the Medico-legal Directorate Baghdad, Iraq. Blood samples were taken from the concerned subjects in this case (newborn baby, mother, alleged father, and the husband) and placed on FTA cards. DNA extraction was done using Chelex®, then theamplification of extracted DNA was carried out using an AmpFlSTR® Identifiler kit. PCR products were run with a 3130xl Genetic Analyzer, and the data were analyzed with Gene-Mapper ID® Analysis Software V.3.2 software.The analysis of DNA profiles using 15 loci as well as the statistical analysis for calculating the paternity index confirmed the allegation of the brother-sister incest, since the baby inherited all the obligate alleles from the alleged father (suspected brother). With a 99.9998% probability of paternity, these results showed that even in the case of brother-sister incest, paternity could be proved using 15 DNA locus with a high rate of certainty.

A simple filter paper-based method for transporting and storing Enterocytozoon hepatopenaei DNA from infected Litopenaeus vannamei tissues

The microsporidian parasite Enterocytozoon hepatopenaei (EHP) causes a significant negative impact in shrimp aquaculture. A diagnostic procedure for detecting EHP in shrimp was developed, but transportation of the infected shrimp samples from the farm / hatcheries to the laboratory is burdensome and preservation of the tissues is problematic. Here, we developed a simple method of transporting nucleic acid without preservatives using the Flinders Technology Associates filter card (FTA matrix card; Whatman). DNA can be stored and extracted without the need for centrifugation and hazardous chemicals. EHP infected shrimp homogenate was spotted on a FTA matrix card and stored at room temperature. Storage stability was confirmed by analysis at different time points and we efficiently recovered DNA up to 6 months post spotting. The recovery efficiency of FTA-DNA was compared with the existing DNA extraction methods DNeasy® Blood & Tissue kit method and Guanidine hydrochloride method. The efficiency of extraction and sensitivity of the DNA in the FTA card confirmed that recovery of EHP-DNA from the FTA matrix was superior to with other methods.

PSVI-39 Molecular breeding value prediction of vaccination response against porcine reproductive and respiratory syndrome (PRRS) in replacement gilts

Abstract Porcine reproductive and respiratory syndrome (PRRS) is a viral disease that severely affects the Mexican swine industry. Vaccination of replacement gilts is mostly used to prevent PRRS; however, individual response to this protocol is highly-variable. The objective herein was to predict vaccination response against PRRS virus in gilts using molecular markers associated to rectal temperature (RT) and average daily weight gain (ADG). The study included 6-month old replacement gilts (n = 100) with a breed composition of ¾ Landrace x ¼ Yorkshire. Gilts were vaccinated with a modified live PRRS-virus (day 0) and kept inside the quarantine area on a farm where the gilts were lately exposed to PRRS. Data from RT and ADG were recorded weekly from day -7 through 35. Individual blood samples were collected at day 40, spotted onto FTA cards, and processed for genomic analyses using a 10k low-density SNP chip. Resulting genotypes were analyzed using a multi-locus mixed model, which identified 59 SNP associated with RT and ADG. These SNP were validated using a mixed-effects model which included SNP genotype and age of dam as fixed effects, and sire as random effect; then, their allele substitution effects were calculated. The additive effects for each SNP that showed a significant association (P < 0.05) with either RT or ADG were summed to calculate their corresponding molecular breeding value (MBV). The mean MBV were 0.28±0.04°C and 0.21± .05kg for RT and ADG, respectively. A reduced regression model which only included MBV was used to predict both RT and ADG. Coefficients of determination were 4.26 and 3.87% for RT and ADG, respectively (P < 0.01). These results suggest that only a small proportion of the phenotypic variance for RT and ADG was explained by SNP genotypes. We suggest additional studies to determine if the highly-variable vaccination response to PRRS is influenced by genetics.

First Report of Beet Curly Top Virus Infecting Cannabis sativa in Western Colorado

In industrial hemp (Cannabis sativa L.) fields located in North Fork Valley, Delta County, Colorado, U.S.A., plants bearing symptoms of stunted growth and yellowing leaves were observed in each growing season between 2015 and 2019. Infected plants display initially fading leaf color to pale green, starting at the leaf base and expanding toward the tips, producing a yellow-green mosaic pattern. Within 10 days, the symptoms spread to the entire plant. In plants with advanced symptoms, newly developing leaves were pale green, narrower, and curled sideways, leading to a stunted, curled plant. Infection was observed in several different hemp cultivars at different developmental stages, from the vegetative to the flowering stages. To identify the infectious agent, leaves were collected from one symptomatic hemp plant and one nonsymptomatic hemp plant on 30 July 2018 and blotted onto FTA cards (Ndunguru et al. 2005). Nucleic acids extracted from FTA cards and subjected to ribosomal RNA depletion served for library construction as previously described (Luria et al. 2019) using a ScriptSeq Complete Kit (Plant Leaf, Illumina, San Diego, CA) and were sequenced using an Illumina Hiseq 2500 at the Technion Genome Center, Israel. The obtained clean reads were searched for viral sequences using VirusDetect software version 1.7. VirusDetect software involved a pipeline combining de novo assembly with mapping to references of plant viruses from GenBank using Velvet (Zerbino and Birney 2008). This analysis revealed 31 contigs, which aligned to the entire 2,931 nucleotides of beet curly top virus (BCTV, Geminiviridae family, Curtovirus genus), sharing 96.5 and 96.4% identity with the genome sequence of isolates AY134867 and KX867020 detected in Beta vulgaris in 2002 and 2006, respectively. In order to validate the next-generation sequencing findings, the nucleic acids were used as a template for PCR analysis using several specific primer pairs designed to cover most of the BCTV genome. A selected primer set was used for diagnostics: Forward-337-5′…ATGGGACCTTTCAGAGTGGA…3′; Reverse-1,278-5′…TGTATGCCACATTGTTTGGC…3′. Seven symptomatic hemp plants and three nonsymptomatic plants were tested by PCR using the designed BCTV-specific primers. The PCR products were sequenced by Sanger method (HyLabs, Rehovot, Israel) and assembled, resulting in alignment with the majority of BCTV genomes. Importantly, sequences homologous to BCTV were present only in the leaves of the seven symptomatic hemp plants. The complete high-throughput sequencing-derived viral genome sequence was deposited in GenBank (accession no. MK803280) under the name BCTV-Can. There are several strains of BCTV that infect more than 300 plant species and many agricultural crops including beans, sugar beet, cucumber, peppers, spinach, and tomatoes (Strausbaugh et al. 2017). BCTV causes symptoms throughout the western United States, and sporadic outbreaks occur in western Colorado, where the symptomatic plants described here were located. The virus is solely transmissible by leafhopper vectors, and the only known vector of this pathogen in North America is Neoaliturus (= Circulifer) tenellus (Baker) (Hemiptera: Cicadellidae), known as the beet leafhopper (Bennett 1967). BCTV did not appear in the review of hemp diseases by McPartland et al. (2000), and to the best of our knowledge this is the first report of BCTV infecting hemp and the first report of any leafhopper-vectored pathogen affecting any C. sativa crop.

Evaluation of honey-baited FTA cards in combination with different mosquito traps in an area of low arbovirus prevalence

BackgroundThe threat of mosquito-borne diseases is increasing in continental Europe as demonstrated by several autochthonous chikungunya, dengue and West Nile virus outbreaks. In Switzerland, despite the presence of competent vectors, routine surveillance of arboviruses in mosquitoes is not being carried out, mainly due to the high costs associated with the need of a constant cold chain and laborious processing of thousands of mosquitoes. An alternative approach is using honey-baited nucleic acid preserving cards (FTA cards) to collect mosquito saliva that may be analysed for arboviruses. Here, we evaluate whether FTA cards could be used to detect potentially emerging viruses in an area of low virus prevalence in combination with an effective mosquito trap.MethodsIn a field trial in southern Switzerland we measured side-by-side the efficacy of the BG-Sentinel 2, the BG-GAT and the Box gravid trap to catch Aedes and Culex mosquitoes in combination with honey-baited FTA cards during 80 trapping sessions of 48 hours. We then screened both the mosquitoes and the FTA cards for the presence of arboviruses using reverse-transcription PCR. The efficacy of the compared trap types was evaluated using generalized linear mixed models.ResultsThe Box gravid trap collected over 11 times more mosquitoes than the BG-GAT and BG-Sentinel 2 trap. On average 75.9% of the specimens fed on the honey-bait with no significant difference in feeding rates between the three trap types. From the total of 1401 collected mosquitoes, we screened 507 Aedes and 500 Culex females for the presence of arboviruses. A pool of six Cx. pipiens/Cx. torrentium mosquitoes and also the FTA card from the same Box gravid trap were positive for Usutu virus. Remarkably, only two of the six Culex mosquitoes fed on the honey-bait, emphasising the high sensitivity of the method. In addition, two Ae. albopictus collections but no FTA cards were positive for mosquito-only flaviviruses.ConclusionsBased on our results we conclude that honey-baited FTA cards, in combination with the Box gravid trap, are an effective method for arbovirus surveillance in areas of low prevalence, particularly where resources are limited for preservation and screening of individual mosquitoes.

High prevalence of Schistosoma haematobium × Schistosoma bovis hybrids in schoolchildren in Côte d'Ivoire.

Schistosomiasis is a neglected tropical disease, though it is highly prevalent in many parts of sub-Saharan Africa. While Schistosoma haematobium-bovis hybrids have been reported in West Africa, no data about Schistosoma hybrids in humans are available from Côte d'Ivoire. This study aimed to identify and quantify S. haematobium-bovis hybrids among schoolchildren in four localities of Côte d'Ivoire. Urine samples were collected and examined by filtration to detect Schistosoma eggs. Eggs were hatched and 503 miracidia were individually collected and stored on Whatman® FTA cards for molecular analysis. Individual miracidia were molecularly characterized by analysis of mitochondrial cox1 and nuclear internal transcribed spacer 2 (ITS 2) DNA regions. A mitochondrial cox1-based diagnostic polymerase chain reaction was performed on 459 miracidia, with 239 (52.1%) exhibiting the typical band for S. haematobium and 220 (47.9%) the S. bovis band. The cox1 and ITS 2 amplicons were Sanger sequenced from 40 randomly selected miracidia to confirm species and hybrids status. Among the 33 cox1 sequences analysed, we identified 15 S. haematobium sequences (45.5%) belonging to seven haplotypes and 18 S. bovis sequences (54.5%) belonging to 12 haplotypes. Of 40 ITS 2 sequences analysed, 31 (77.5%) were assigned to pure S. haematobium, four (10.0%) to pure S. bovis and five (12.5%) to S. haematobium-bovis hybrids. Our findings suggest that S. haematobium-bovis hybrids are common in Côte d'Ivoire. Hence, intense prospection of domestic and wild animals is warranted to determine whether zoonotic transmission occurs.

Application of Whatman FTA Card Method in Oil Palm DNA Extraction and PCR Analysis

Polymerase Chain Reaction (PCR) analysis in the study of oil palm DNA generally carried out by using DNA template obtained from grinding of leaf samples in liquid nitrogen followed by hexadecyltrimethylammonium bromide (CTAB) protocol. The present study explores the FTA card as a method to retrieve PCR-amplifiable oil palm DNA. Oil palm leaves were cut and crushed before deposited onto the FTA card. An attempt was made by amplifying the EgSHP gene using a punch of FTA card as a DNA template. The successful outcome of PCR was measured by the presence of PCR amplicons on 1% agarose gel electrophoresis, indicate the genotype of oil palm fruit form. This present study demonstrates that the FTA card provides a versatile alternative to the study of oil palm genetics.

Variations in mitochondrial DNA control region among Malay and Chinese subpopulations (sequence 16000–16200)

DNA variations are alterations found in DNA sequence, occurring in both nuclear DNA and mitochondrial DNA. Variations might differ in individual following population, respectively. The aim of this study was to find variations in target sequence of mtDNA (16000–16200) to be used as marker in Malay and Chinese population. A total of 30 buccal swab samples from 20 Malay and 10 Chinese subjects were collected and preserved on FTA card. The FTA card that contained DNA sample was punched to be included into polymerase chain reaction mixture. Amplification was carried out and the products were sequenced. Sequence variations were found in both Malay and Chinese populations. A total of nine variations (16129, 16108, 16162, 16172, 16148, 16127, 16173, 16099 and 16100) were found in Malay population while a total of seven variations (16129, 16104, 16111, 16109, 16164, 16170 and 16136) were found in Chinese population. Nucleotide position 16129 was found as variation in both Malay and Chinese populations. This study implies that np 16129 can be used as a marker for Malaysian population. For further investigation, the length of the target sequence may be increased to obtain more variations that can be used as markers. This will increase the discrimination power of Malaysian population.

On the long term storage of forensic DNA in water

A rectrospective study was conducted on the effect of the long term storage of 122 DNA samples resuspended in water, one of the elution media still suggested by well established protocols. These DNA samples come from four different kinds of forensically relevant samples (saliva swabs, FTA card bloodstains, nails and II° World War bones) extracted in 2008–2018 and stored at – 20°C (n=113 of groups #1-#5) and at +4°C (n=9 of the group #6), respectively. At the time of the present study (2019), quantitative PCR (qPCR) was employed as tool for assessing the degradation of the samples. The employment of the Human Quantifiler Kit showed that the median loss of DNA ranged from 17.8% to 66.6% in groups #1-#5 while it was 85.0% in group #6. However, it is likely that these values represent an underestimation due to the shortness of the qPCR probe (62 bp). Noteworthy, the DNA loss was statistically significant in each of the six groups (p values ≤ 0.0167). Thus, in agreement with the data on spontaneous DNA decay, no forensic DNA sample should be stored in water for long term periods. In conclusion, the results of this technical note warn against the use of water for this purpose.

Efficient preservation of DNA extracted from blood in FTA cards by Chelex method

Chelex resin has been developed and widely used for extracting DNA from different forensic-type samples [1]. However, no studies have shown the conservation of the extracted samples over time in samples from buccal swabs and blood in FTA cards. For this study, we tested three DNA extraction methods: Chelex 10%-Proteinase K (CHK), Phenol Chloroform (PC) and Chelex 10%-Proteinase K purified with Phenol Chloroform (CHK + PC) in two different kind of samples: blood stored over FTA cards and buccal swab samples. Beta-Actin gene (136 bp) was amplified by PCR at 0, 4 and 8 months, STR profiles and amplification of mitochondrial DNA (1200 bp) were done at 15 months to check the DNA quality. These results suggest the importance of choosing the DNA extraction method that guarantees the conservation of reference or forensic DNA samples for further studies or forensic tests.

Development of the Investigator® 26plex QS Kit: A New multiplex PCR Kit for Global STR analysis

STR assays for forensic casework must conform to national DNA standards. QIAGEN developed the Investigator 26plex QS Kit as an assay to co-amplify 25 markers, including the current Chinese, CODIS and European standard markers in one reaction. The kit is designed for purified DNA from casework and reference samples. The new Fast Reaction Mix 3.0 ensures not only robust and fast PCR amplification with improved inhibitor resistance and easy handling, but also provides enhanced robustness towards DNA overloading and stability. Highly sensitive, yielding rapid and reliable results from trace DNA, the kit is suitable for all forensic applications and paternity testing. It can also be used for direct amplification of reference samples like blood or buccal cells on FTA cards or swabs. Furthermore, with the inclusion of Penta E and Penta D in the marker set, the Investigator 26plex QS Kit offers very high discriminatory power. The assay uses a 6-dye technology to keep the amplicon length of the markers short and to avoid marker overlap. The kit contains QIAGEN’s Quality Sensor System (QS1 and QS2) as an internal PCR control.

Evaluation of two FTA card elutions with sterile vs distilled water

DNA extraction is frequently the starting point for all the experiments in biomedical and forensic research [1]. Nowadays, there are multiple commercial kits that allow carrying out the extraction rapidly, but often with a high financial cost. With the aim of presenting an alternative to these commercial kits, we have proposed two new DNA extraction methods using water.The extractions were carried out over FTA cards impregnated with blood, and using as extraction reagent two types of water. For the essays, it was compared the efficiency of using sterile water versus distilled water, with two objectives: 1) Finding out if the extraction was possible with both types of water and 2) Knowing what kind of water provided the best results.Our first results showed that distilled water was the best reagent for DNA extraction from blood, generating more positive results (mitochondrial DNA sequences with very good quality) than sterilized water. A possible reason is that distilled water has low ion concentration, allowing a stronger interaction with the DNA attached to the matrix of the FTA card and therefore a more effective extraction. It is our intent to perform in the future a similar extraction process, but with water both sterilized and distilled.

Whole mtGenome analysis in United Arab Emirates populations

Mitochondrial DNA analysis has earned its place in the field of genetics for providing a new window into understanding population ancestry. Its ability to produce results from minimal or decayed samples where nucleus DNA profiling proves are difficult is an additional benefit to forensic genetics. A total of 150 whole blood samples were collected on FTA paper, from Arabs population in United Arab Emirates, including inhabitants from rural regions. Both extraction of whole blood samples using PrepFiler® as well as direct amplification of mtDNA control region from purified 1.2 mm disc of FTA card stained with blood were attempted in this study. Quantity of the amplified control region was estimated using gel electrophoresis. Three sets of primers were used afterward to sequence purified products of amplified control region of mtDNA using Sanger sequencing method. 150 mtGenome sequences were obtained for UAE Arabs population, generated using MPS technology – Ion™ 5S. Concordance with control region sequences obtained using Sanger Sequencing approach was investigated. Resulted haplotypes were compared against worldwide mtDNA database (EMPOP) and estimated haplotypes frequency is shown in this study. As a forensic lab, non-probative challenging bone samples were tested to highlight the potentials value of using MPS technology – Ion™ 5S. This study shows the first mtGenome data generated for UAE Arabs population which helps extending the current available mtDNA control region database. As a result, this study shows great value of implementing MPS in the routine work in forensic genetics at Dubai Police.

Ambient temperature storage of tissue samples (bovine) in readily available media during mass fatality incidents

The possibility of using readily available media such as salt and alcohol to preserve tissue samples in non-tropical climates has been previously reported. This present study is a proof of concept trial to investigate the efficacy of salt, alcohol and FTA card for the preservation of soft tissue samples in a tropical hot and humid environment. Using bovine flesh as proxy, salt and commercial liquors such as whiskey and vodka were found to be effective in preserving the tissue samples at ambient temperatures over a 3 month period.

Liquid biopsies for omics-based analysis in sentinel mussels.

Liquid biopsy of plasma is a simple and non-invasive technology that holds great promise in biomedical research. It is based on the analysis of nucleic acid-based biomarkers with predictive potential. In the present work, we have combined this concept with the FTA technology for sentinel mussels. We found that hemocytes collected from liquid biopsies can be readily fixed on FTA cards and used for long-term transcriptome analysis. We also showed that liquid biopsy is easily adaptable for metagenomic analysis of bacterial profiles of mussels. We finally provide evidence that liquid biopsies contained circulating cell-free DNA (ccfDNA) which can be used as an easily accessible genomic reservoir. Sampling of FTA-fixed circulating nucleic acids is stable at room temperature and does not necessitate a cold-chain protection. It showed comparable performance to frozen samples and is ideally adapted for sampling in remote areas, most notably in polar regions threatened by anthropogenic activities. From an ethical point of view, this minimally-invasive and non-lethal approach further reduces incidental mortality associated with conventional tissue sampling. This liquid biopsy-based approach should thus facilitate biobanking activities and development of omics-based biomarkers in mussels to assess the quality of aquatic ecosystems.

Evaluation of DNA Extraction Methods on Individual Helminth Egg and Larval Stages for Whole-Genome Sequencing.

Whole-genome sequencing is being rapidly applied to the study of helminth genomes, including de novo genome assembly, population genetics, and diagnostic applications. Although late-stage juvenile and adult parasites typically produce sufficient DNA for molecular analyses, these parasitic stages are almost always inaccessible in the live host; immature life stages found in the environment for which samples can be collected non-invasively offer a potential alternative; however, these samples typically yield very low quantities of DNA, can be environmentally resistant, and are susceptible to contamination, often from bacterial or host DNA. Here, we have tested five low-input DNA extraction protocols together with a low-input sequencing library protocol to assess the feasibility of whole-genome sequencing of individual immature helminth samples. These approaches do not use whole-genome amplification, a common but costly approach to increase the yield of low-input samples. We first tested individual parasites from two species spotted onto FTA cards—egg and L1 stages of Haemonchus contortus and miracidia of Schistosoma mansoni—before further testing on an additional five species—Ancylostoma caninum, Ascaridia dissimilis, Dirofilaria immitis, Strongyloides stercoralis, and Trichuris muris—with an optimal protocol. A sixth species—Dracunculus medinensis—was included for comparison. Whole-genome sequencing followed by analyses to determine the proportion of on- and off-target mapping revealed successful sample preparations for six of the eight species tested with variation both between species and between different life stages from some species described. These results demonstrate the feasibility of whole-genome sequencing of individual parasites, and highlight a new avenue toward generating sensitive, specific, and information-rich data for the diagnosis and surveillance of helminths.

First Molecular Evidence of Anaplasma bovis and Anaplasma phagocytophilum in Bovine from Central Punjab, Pakistan.

Obligate intracellular bacteria belonging to the genus Anaplasma spp. are responsible for causing a hemolytic disease called anaplasmosis in animals, as well as in humans. This study was aimed at the molecular identification and genetic analysis of responsible causative agents of anaplasmosis beyond those already reported. A survey was performed during July and August 2018 in the Jhang District, Punjab, Pakistan. Four hundred and fifty blood samples from asymptomatic, tick-infested cattle were collected on FTA cards and tested for the Anaplasma spp. presence using nested-polymerase chain reaction (PCR) methods. The 16S ribosomal RNA gene sequences generated from the positive samples were used for genetic analysis of Anaplasma spp. The nested-PCR results showed the presence of two Anaplasma spp. with an overall prevalence rate of 10.44%, where the prevalence of A. bovis and A. phagocytophilum was 7.78% and 2.66%, respectively. The study portrayed new molecular data on the prevalence of Anaplasma spp. in the studied cattle population, indicating a potential threat to the human population as well.

Population Genetic Structure and Cryptic Species of Plasmopara viticola in Australia.

Downy mildew of grape caused by Plasmopara viticola is a global pathogen of economic importance to commercial viticulture. In contrast to populations in the northern hemisphere, few studies have investigated the population biology, genetic diversity, and origin of the pathogen in Australian production systems. DNA was extracted from 381 P. viticola samples from Vitis vinifera and alternate hosts collected via fresh and herbarium leaves from populations within Australia and Whatman FTA cards from North America, Brazil, and Uruguay. A total of 32 DNA samples were provided from a French population. The populations were genotyped using 16 polymorphic microsatellite markers. Representative samples from within Australia, Brazil, and Uruguay were also genotyped to determine which of the cryptic species (clades) within the P. viticola species complex were present. Our findings suggest the Australian and South American populations of P. viticola are more closely related to the European population than the North American population, the reported source of origin of the pathogen. The Western Australian population had similarities to the South Australian population, and the tight clustering of samples suggests a single introduction into Western Australia. P. viticola clade aestivalis was the only clade detected in Australian and South American populations. Analysis of the Western Australian population suggests that it is reproducing clonally, but additional research is required to determine the mechanism as to how this is occurring.

The importance of forensic storage support: DNA quality from 11-year-old saliva on FTA cards.

Storage conditions influence the integrity of the recoverable DNA from forensic evidence in terms of yield and quality. FTA cards are widely used in the forensic practice as their chemically treated matrix provides protection from the moment of collection to the point of analysis with current STR typing technology. In this study, we assess the recoverability and the integrity of DNA from 11-year-old saliva on FTA cards using a forensic quantitative real-time polymerase chain reaction (qPCR) commercial assay. The quality after long-term storage was investigated in order to evaluate if the FTA device could assure enough stability over time, applying some internally validated quality criteria of the STR profile. Furthermore, we used a 3D interpolation model to combine the quantitative and qualitative data from qPCR to calculate the minimum optimal DNA input (MODI) to add to the downstream PCR reaction based on the quantitative and qualitative data of a sample. According to our results, when saliva sample is properly transferred onto FTA cards and then correctly stored according to the manufacturer's instructions, it is possible to recover sufficient amounts of DNA for human identification even after more than a decade of storage at ambient temperature. Degradation affected the quality of results especially when the Degradation Index exceeds the value of 2.12, requiring modifications of the standard internal workflow to improve the genotyping quality. Above this value, the application of a "corrective factor" to the PCR normalization process was necessary in order to adjust the recommended manufacturer's PCR DNA input taking into account the degradation level. Our results demonstrated the importance to consider in predictive terms the parameters obtained with the real-time quantification assay, both in terms of quantity (DNA concentration) and of quality (DI, inhibition). Informatics predictive tools including qPCR data together with the variables of storage duration and conditions should be developed in order to optimize the DNA analysis process.