Sodium Hypochlorite Research Articles

Comparison of the antibacterial activity of six medicinal plants, sodium hypochlorite, and chlorhexidine against enterococcus faecalis (In vitro study)

Enterococcus faecalis is a gram-positive, facultative anaerobic bacterium recognized for its resistance to various antimicrobial agents. This organism is associated with the failure of endodontic treatments, even when potent antimicrobial irrigants are employed. Numerous medicinal plants have demonstrated antimicrobial properties that could be potentially effective against this bacterium.To evaluate the antibacterial properties of six medicinal plants in comparison to sodium hypochlorite and chlorhexidine against E. faecalis.Antibacterial susceptibility tests against E. faecalis (ATCC 29212) were performed for 200 mg/ml ethanolic extracts of Acacia Senegal, Capparis decidua, Capparis micracantha, Acacia nilotica/ Adansonia, Dobera glabra, and Moringa oleifera by Agar Disc Diffusion method. Chlorhexidine 0.2% and Sodium hypochlorite 1% were used as positive controls, and ethanol 20% as a negative control. The diameters of the inhibition zones were measured. Acacia nilotica/adansonii leaves showed the largest inhibition zone diameter against E. faecalis. It displayed a significantly greater inhibitory effect against E. faecalis than Acacia Senegal (p-value =0.005), Capparis decidua (p-value =0.02), Capparis micracantha branches (p-value =0.000), Dobera glabra leaves (p-value =0.008), and Moringa olifera leaves (p-value =0.000).Acacia nilotica leaves displayed a similar inhibition zone diameter against E. faecalis as chlorhexidine gluconate 0.2%, but it showed no statistical significance. Acacia nilotica leaves (L) and pods (P), as well as Dobera glabra branches (B), displayed a larger inhibition zone diameter against E. faecalis than Sodium hypochlorite 1%, but with no statistical significance. The leaves of Acacia nilotica exhibit the most potent antibacterial properties against E. faecalis when compared to other plants parts. They outperform the antibacterial effectiveness of 1% sodium hypochlorite and demonstrate a similar antibacterial impact to that of 0.2% chlorhexidine. Therefore, Acacia nilotica leaves could serve as an ideal irrigant potentially substituting the chemical options.

Catalytic oxidation of Mn(II) in the co-presence of Fe(II) by free chlorine: significance of in situ formed Mn(II)-doped Fe(III) oxides

Fe(II) and Mn(II) are abundant in groundwater and require operationally simple and efficient method to remove in drinking water treatment. The rapid oxidation of Mn(II) is essential in water treatment. This study investigates the efficiency of Mn(II) oxidation by free chlorine in the presence of Fe(II). The results demonstrate that the presence of Fe(II) significantly accelerates the oxidation rate of Mn(II) by free chlorine under neutral and alkaline conditions. The rapid oxidation of Fe(II) by free chlorine and the presence of Mn(II) promote the formation of in situ Mn(II)-doped ferrihydrite. Kinetic modeling and characterization of Fe(III) oxides confirm that the heterogeneous catalytic effect of the Mn(II)-doped ferrihydrite, rather than manganese oxides or their coupled catalytic effect, is responsible for the enhanced oxidation rates. The doped Mn(II) substitutes the tetrahedral Fe(III) ions in the ferrihydrite, introducing additional negative charges at the doped sites. The increased charge enhances Mn(II) adsorption and lowers its redox potential, thereby accelerating Mn(II) oxidation rate through direct electron transfer with adjacent free chlorine. Additionally, the lepidocrocite formed by the reaction between Fe(II) and dissolved oxygen significantly impedes the catalytic performance. These findings provide new insights into the catalytic co-oxidation mechanism of Fe(II) and Mn(II), and help the optimization of water treatment engineering practices.

Development of an Effective Sterilization Protocol for Plant Tissue Culture Studies in Superfruit Aronia [Aronia melanocarpa (Michaux) Elliot

Effective sterilization protocols are crucial for a successful tissue culture study in Aronia. These protocols directly influence contamination rates, shoot health, and root development. In this context, the aim of the study is to develop an effective sterilization protocol for plant tissue culture studies in Aronia [Aronia melanocarpa (Michaux) Elliot], commonly known as the "superfruit." In study, shoot tips of the Nero Aronia variety were used as material. The sterilized shoot tips were transferred to the respective plant tissue culture media in a randomized parcels trial pattern with three replicates, each containing three explants per replicate. Various concentrations and combinations of sterilizing agents, such as sodium hypochlorite (NaOCl), hydrogen peroxide (H2O2), mercuric chloride (HgCl2), and ethanol (C2H5OH), were evaluated to determine their effectiveness in maintaining tissue health and reducing contamination. A total of twelve protocols were developed, incorporating different concentrations of these chemicals. The results showed that the combination of 5% NaOCl and 3% H2O2 provided the lowest average contamination rate (5%) and the highest average number of healthy (uncontaminated) explants (9.00 piece), demonstrating the sterilization efficiency of this combination. On the other hand, protocols containing HgCl2, especially at higher concentrations, resulted in impaired root development. High ethanol concentrations also contributed to effective sterilization, with the combination of 7% NaOCl and 80% ethanol yielding a low contamination rate (8%) and preserving tissue health. This study emphasizes the need to balance sterilization protocols between effective contamination control and tissue viability. The findings are expected to benefit the improvement and development of tissue culture techniques for Aronia and similar species, providing a basis for further research on effective sterilization practices, which are currently limited in Aronia tissue culture.

Post-Space Disinfectants With Sodium Hypochlorite and Methylene Blue Loaded in Silver and Quartz Nanoparticles Activated by Photodynamic Therapy. A SEM Analysis.

Post-space disinfectants methylene blue loaded with silver (Ag) and Quartz nanoparticles (NPs) and MB alone activated by photodynamic therapy (PDT) on the survival of Enterococcus faecalis, smear layer (SL) removal efficacy, and extrusion bond strength (EBS) of fiber posts to canal dentin. Hundred mandibular premolars underwent root canal treatment using the rotary ProTaper system. The canals were obturated and post-space was prepared up to a length of 8 mm, maintaining a 5 mm seal. To assess antibacterial efficacy E. faecalis were inoculated in the canal (n = 20). The samples were then randomly allocated into four groups according to the canal disinfectant used to sterilize the canals. Group 1: 2.5% NaOCl+17% EDTA, Group 2: MB-PDT, Group 3: MB@QP-PDT, and Group 4: MB@AgNP-PDT (n = 25). SEM analysis was conducted on five samples from each disinfectant group to assess the removal of the SL. Survival rates were calculated (n = 5 from each group). Glass fiber post (GFP) was cemented to the root dentin of the remaining samples followed by artificial aging. Sectioning of the specimens was performed in all three-thirds of the canals. PBS was assessed followed by failure evaluation. ANOVA and Tukey post hoc test were used to compare the E. faecalis survival rate and PBS of fiber post among different investigated groups. Group 4 (MB@AgNP-PDT) treated canals exhibited the minimum survival rate (0.30 ± 0.04 CFU/mL) of E. faecalis and maximum PBS. However, the highest survival rate and minimum bond strength of GFP were observed in Group 1 (NaOCl+17% EDTA) and Group 2 (MB-PDT) treated teeth respectively. The highest SL removal was recorded in the coronal section of the samples of Group-4 disinfected with MB@AgNP-PDT. The lowest removal of SL was recorded in Group 2 samples sterilized with MB-PDT at apical one-third. Silver nanoparticles when utilized as nano-carriers to enhance the efficiency of MB activated by PDT, have been shown to exhibit the highest antimicrobial potency, improved capacity for SL removal and improved PBS.

Activation mechanism of persulfate by Fe3C-based materials for efficient benzo-a-pyrene abatement in wastewater: The reversed direct electron transfer from persulfate to contaminants

Herein, an unusual reserved direct electron transfer (r-DET) process from persulfate (PS) to contaminants was observed on the surface of Fe3C with N-doped C shell supported on carbon nanotubes (Fe3C@CN-CNTs). The Fe3C-based materials were synthesized via a facile sol–gel method employing melamine, glucose, FeCl3, and commercial multi-walled CNTs. The activation mechanisms were fully explored with a comparison of Fe3C@CN-CNTs and other Fe3C-based materials for the effective abatement of benzo-a-pyrene (BaP), a typical persistent organic pollutant in industrial wastewater. Electrochemical measurements, zeta potential monitoring, and Mössbauer spectroscopy indicated that the lack of CN shell result the relatively large particle size of Fe3C on Fe3C-CNTs, leading to more negatively charged surface and abundant OH during PS activation. Nevertheless, the superparamagnetic fraction with a fine particle size on the surface of Fe3C@CN and Fe3C@CN-CNTs potentially leads to a more positively charged surface, enhancing the zeta potential of surface adsorbed BaP and benefiting the r-DET. Through r-DET, oxidized PS and reduced BaP formed as intermediates, accelerating the overall degradation of BaP in Fe3C@CN-CNTs/PS. The degradation pathways, cytotoxicity, and operation conditions of BaP degradation by Fe3C@CN-CNTs/PS were thoroughly investigated. Additionally, Fe3C@CN-CNTs were found to promote the nucleophilic reaction between Cl− and PS, producing free chlorine and enhancing BaP degradation efficiency in chloride-containing wastewater. Overall, this study presents a new insight for the PS-based r-DET process and offers a promising approach for treating organically-contaminated wastewater.

Three-Dimensional Planimetry Assessment of Dental Plaque-Covered Area Reduction after Rinsing with 0.2% Sodium Hypochlorite Solution as Part of a Guided Biofilm Therapy® Protocol-Pilot Longitudinal Study.

Background/Objectives: Less often employed as a rinsing solution for controlling oral biofilms, NaOCL was used in oral rinses at various concentrations in steps 1 and 4 of periodontal therapy. The aim of this study was to quantitatively evaluate the biofilm-disruptive properties of a 0.2% NaOCl solution in standardized oral rinses using dedicated plaque-disclosing agents and 3D scanning methods in patients undergoing the regular Guided Biofilm Therapy® protocol. Methods: Eight patients with at least 20 teeth present evenly distributed between the two arches were included. After 24 h of refraining from oral hygiene, dental arches were stained with a disclosing agent, the subjects rinsed for 20 s, clinical photographs and 3D scans were performed, subjects rinsed again for 20 s, photographs and 3D scans were performed again, and then the GBT® protocol was resumed as usual. Data representing areas covered with dental plaque were acquired using the "Medit Scan for Clinics" software and then underwent a post-processing and rendering process. The outcome variable was the percent reduction in the plaque-covered areas. Results: For the upper jaw, the estimated mean percent reduction in the biofilm-covered area was 39.65%, while for the mandible, it was 38.26%. The analysis of individual photographs revealed changes in the plaque-covered areas and reductions in the color intensity of the residual plaque-covered areas under identical lighting conditions. Conclusions: When analyzed using 3D intraoral scanning, the 0.2% NaOCl rinsing solution seems to be a clinically efficient disruptor/dissolvent of the oral biofilm, both when integrated into modern protocols of periodontal therapy like GBT® and for home self-care.

The investigation of endodontic irrigants and polyhexanide-based solution action on smear layer

AIM. The effect of irrigants on the smear layer on the intracanalicular dentin surface is one of the important issues in endodontics. The objective of this article is to determine the effect of different concentrations of polyhexanide-based solutions and standard irrigants on the smear layer using scanning electron microscopy (SEM).MATERIALS AND METHODS. The present study was conducted on 42 extracted teeth (third molars, first and second premolars) with formed apices that had been extracted for orthodontic indications. The teeth were decoronated and samples were prepared. In order to create a smear layer, the lumen of the canals was instrumented with H-file #40 throughout. A simulation of root canal irrigation was conducted by immersing the specimens in a 5-ml container filled with the proper solution for 1 hour: group 1 – no treatment (n = 6); group 2 – saline (n = 6); group 3 – 2% chlorhexidine (n = 6); group 4 – 3% sodium hypochlorite (n = 6); group 5 – 17% EDTA; group 6 – polyhexanide 0.1% (n = 6); group 7 – polyhexanide 0.2% (n = 6). A ~30 nm thick platinum film was sputtered onto the surface of each sample using a magnetron deposition technique. SEM microphotos were acquired on a Vega3 TESCAN scanning electron microscope (SEM) with an SE secondary electron detector, which enables imaging with high topographic contrast. The initial detector (incamera) was employed for image acquisition, with an electron energy of 30 keV. Images were acquired at magnifications of x20 (overview image), x150, x250, x500, x1000, x2500, x7500 for each sample.RESULTS. The samples from groups 1 and 5 demonstrated the absence of a smear layer on the dentin surface and the absence of smear plugs in the dentinal tubules. Groups 2 and 3 are distinguished by the deposition of a pronounced amorphous smear layer and the obturation of all dentinal tubules. Groups 4, 6, and 7 are distinguished by the deposition of a smaller volume of smear layer on the dentin surface, as well as the presence of semi-open or completely open entrances to the dentinal tubules.CONCLUSION. The data obtained indicates that antiseptic compositions based on polyhexanide in concentrations of 0.1 and 0.2% do not have a pronounced effect on the smear layer. However, in visual evaluation of SEM micrographs, their effect is comparable to that of 3% sodium hypochlorite. In instances where enhanced dissolution of the smear layer and smear plugs from the tubules is necessary to facilitate decontamination of the wall dentin, the combination of antiseptics with chelate compounds, such as 17% EDTA, may be employed.

Long-Term Storage Stability of Neutral Electrolyzed Water by Two-Stage Electrolysis: Optimal Storage Conditions for Intraoral Use

Electrolyzed water mainly containing hypochlorous acid is widely used because of its strong microbicidal effects, biosafety, and eco-friendliness. For frequent use in intraoral treatments, we focused on neutral electrolyzed water (NW) produced using two-stage electrolysis and investigated its storage stability. For standard-concentration NW preparations with a free available chlorine concentration (ACC) of 25, 35, and 50 mg/L and high-concentration NW preparations (100, 200, 300, 500, and 1000 mg/L), the changes in the pH, oxidation reduction potential, and ACC during a 126-day storage period and the bactericidal efficacies after storage were examined. Storage under non-shaded conditions at room temperature (LRT) and a higher ACC substantially altered the properties of the NW. NW (≤300 mg/L) had a pH of 5.9–7.3 even after storage under LRT; however, NW with a higher ACC (500 and 1000 mg/L) had a pH ˂ 5.5, critical for human enamel, even under shaded and refrigerated conditions (SLW). Only NW (25 mg/L) stored under LRT decreased the bactericidal effect (removal rate: 99.8%). When stored for use in intraoral treatments, NW should be prepared with an ACC of 25–300 mg/L and stored in SLW. It is suggested that stored NW, especially when diluting it, should be checked to ensure it maintains the properties appropriate for every intended purpose.

Stevia rebaudiana Is a New Host of Stagonosporopsis pogostemonis Associated with Leaf Spot Disease in China.

Stevia rebaudiana is a promising medicinal and edible plant, widely cultivated in China. In 2022-2023, a new leaf spot disease occurred in S. rebaudiana in Hongxing country (32°34'55″N, 118°2'12″E), Dingyuan city, Anhui province. Symptoms were observed on 10 to 15% of plants in three S. rebaudiana nursery beds (0.1 ha in total). The typical symptoms included dark brown spots on the leaves and foliar wilting, the development of brown stems with dieback of top buds, and occasional plant death (Fig. 1a). To identify the pathogen, twenty diseased leaves were collected, cut into small pieces, surface sterilized with 75% ethanol for 30 s, in 0.5% sodium hypochlorite for 2 min, washed three times in sterile water, placed on PDA, and incubated at 25℃ for 5 days. Pure cultures were prepared by subculturing hyphal tips. Twenty-five Stagonosporopsis-like isolates with similar morphology were obtained. After 7 days growth on PDA, colonies had a regular margin, were cottony, and formed concentric circles on the surface that were gray-green. The reverse side of the culture was dark brown with a creme-orange and white, margin. The growth rate was 9.5 mm/day on PDA. Pycnidia were mostly solitary, globose or subglobose, pale to dark brown, thin-walled, glabrous, ostiolate, 95.735~250.851×90.93~266.32 μm (n=50). Conidia were oblong, cylindrical to ellipsoidal, smooth-walled, aseptate, with rounded ends and two polar guttules and measured 3.41 to 5.83 × 1.78 to 3.07 μm (n = 50) (Fig.1 b-d). For molecular identification, the internal transcribed spacer (ITS) rDNA, large ribosomal subunit (LSU) gene, β-tubulin (TUB2) gene and RNA polymerase II (RPB2) gene sequences of two representative isolates (TYJ-SP1 and TYJ-SP2) were amplified by PCR (Woudenberg et al. 2009; Dong et al. 2021). The sequences were deposited in GenBank (accession nos.: OR506193 and OR506194 for ITS, OR533526 and OR533527 for LSU, OR545221and OR545222 for TUB; OR545223 and OR545224 for RPB2) and showed 99.60% to 99.2% similarity to ITS (502/504 bp and 507/511 bp; MZ156571), 100% similarity to LSU (857/857 bp and 857/857 bp; MZ191532), 98.67% to 99.3% similarity to TUB2 (296/300 bp and 298/300 bp; MZ203132) and 99.78% (888/890 bp and 868/870 bp; MZ203135) of S. pogostemonis strain ZHKUCC 21-0001. A maximum likelihood phylogenetic analysis based on the concatenated sequences of ITS, LSU, TUB2 and RPB2 using MEGA 11.0 showed the strains TYJ-SP1 and TYJ-SP2 formed a clade with S. pogostemonis (Fig. 2). Thus, the strains were identified as S. pogostemonis (Dong et al. 2021). To test pathogenicity, the strain TYJ-SP1 was inoculated onto 30-day-old S. rebaudiana seedlings which were surface sterilized with 70% alcohol and washed 3 times with water and air dried prior to inoculation. Ten seedlings were sprayed with a conidial suspension (105 conidia/mL) and ten seedlings were sprayed with sterile water to serve as the negative control. All seedlings were maintained in a growth chamber (25°C, 90% relative humidity) with a 16 h photoperiod. Brown spots were first observed on inoculated leaves 48 h after inoculation; typical symptoms appeared by 7 days post inoculation. All inoculated plants developed symptoms similar to naturally infected plants in the nursery beds, and the disease incidence reached 100% while control plants remained symptom free (Fig. 1 e-f). The same Stagonosporopsis isolates were reisolated from the inoculated plants and identified based on morphological and phylogenetic analyses. S. pogostemonis has been reported to cause leaf spot in Pogostemon cablin and Brassica oleracea var. botrytis (Dong et al. 2021; Habib et al. 2024). To our knowledge, this is the first report of S. pogostemonis causing leaf spot on S. rebaudiana in China. As a medicinal and economic plant, S. rebaudiana is widely planted in China and other Asian countries. The occurrence of this leaf spot disease seriously affects its medicinal and economic value. Therefore, it is crucial to establish and implement effective disease management practices to reduce the impact of the disease.

First report of Sclerotinia minor causing soft rot of Scabiosa atropurpurea in California.

In May of 2019, Scabiosa atropurpurea samples with brown discoloration, soft rot of the crown and lower stem, with presence of white mycelium and black sclerotia (Supp. Fig. 1A, B) were collected from a 0.10 ha open field diversified cut flower production in San Luis Obispo County, CA. Approximately 30 to 40% of the scabiosa crop planted in a quarter of the field, exhibited symptoms. Symptomatic crowns and lower stems from five plants were surface disinfested by rinsing in 0.1% Tween 20, soaking in 70% ethanol for 30 s, 1% sodium hypochlorite for 2 min and sterile water. Disinfested tissue was placed in 1/10 potato dextrose agar (PDA) and incubated at 20°C (12 h photoperiod). Resulting colonies (n = 5) formed abundant white mycelia, with black sclerotia formed on the outer edge of the plates after two weeks (Suppl. Fig. 1C). Sclerotia (n = 50) had an average size of 1.6 (± 0.19) mm in diameter. Morphological identification resulted in Sclerotinia sp. (Hao et al., 2003). The pathogen was further identified by DNA extraction of two hyphal tipped isolates, followed by amplification and sequencing of the rDNA internal transcribed spacer (ITS) region, ITS1/ITS4 (White et al. 1990), calmodulin (CaM), CAL-228F/CAL-737R (Carbone and Kohn, 1999), and DNA replication licensing factor Mcm7 Mcm7-709for/Mcm7-1348rev (Schmitt et al., 2009). NCBI BLAST searches with consensus sequences for each maker revealed 99 to 100% identity with S. minor ex-types for all loci (Supp. Table 1). A maximum parsimony multilocus phylogenetic analysis clustered Californian isolates with reference strains of S. minor (Supp. Fig. 1F). Sequences were deposited in GenBank (Supp. Table 1). Pathogenicity tests were conducted with isolate CS435, which was transferred onto PDA plates and incubated at 20°C for one week. Inoculum consisted of CS435 infested PDA plugs (1 cm3). In the greenhouse, the experiment was set as a complete randomized design and observed for six weeks. Fourteen-week-old scabiosa 'Merlot Red' grown in 3.78 L pots (n = 6), were inoculated by wounding plants at 0.5 cm above the crowns with a 1 mm probe. Inoculum was placed directly on top of the wound and was secured with parafilm. Negative control plants (n = 6) were wounded as above and inoculated with PDA plugs. In experiment 1(19.4 (± 3) °C, RH 46.9), 83% of plants exhibited yellowing of the lower leaves and wilting at one week post inoculation (wpi). Symptoms progressed over time until wilting, major leaf and stem necrosis, was observed in all inoculated plants (Supp. Fig 1E, D). Plant mortality incidence at five wpi was 83%. Pathogen signs including white mycelia and black sclerotia were also observed. In experiment 2 (20.0 (± 10) °C, RH 39.6), 66% of the total plants were symptomatic at five wpi: 33% exhibited yellowing of the lower leaves and wilting, and 33% of plants died. Disease did not develop in non-inoculated plants in either experiment. S. minor was successfully reisolated from surface disinfested tissue of at least 50% (Exp. 1) and 100% (Exp. 2) of inoculated plants, yielding identical sequences to those of the inoculated isolate. S. minor is a soil-borne pathogen that infects tomato, lettuce, brassica, and sunflower crops in California. This study stablishes S. minor as a new soil-borne pathogen of Scabiosa in California. Soil-borne pathogens are a recurrent issue in the cut flower industry, characterizing new pathogens in these crops can inform crop advisors and disease diagnostician to improve disease management in the ornamental industry.

Does achieving apical patency increase postoperative pain during endodontics?

PubMed, Scopus, Embase, Web of Science, Cochrane Library, and gray literature up to May 2023. Twelve studies were included for meta-analysis. Two authors screened databases to identify suitable studies, with a third investigator resolving disagreements. Inclusion criteria were randomized controlled trials (RCTs) involving individuals without systemic diseases, who underwent root canal treatment in a permanent tooth with or without apical patency. Outcomes included pain, number of patients with pain and analgesic use. Exclusion criteria included patients who had undergone tooth extraction, incomplete data reports and studies which were not RCTs. There were no limits on publication language. A search of PubMed, Scopus, Embase, Web of Science, Cochrane Library, and gray literature from Google Scholar, ProQuest, OpenAire, and BASE identified 92 articles until May 2023. After removing 42 duplicates, 50 article full texts were assessed. Ultimately, 12 studies were included, seven of which were new relative to previous systematic reviews. Data were analysed using RevMan 5.4 software. Dichotomous categorical data were analysed through the Cochran-Mantel-Haenszel test, with the inverse variance method used for continuous data. Following assessment of heterogeneity with the χ2 test, fixed- or random- effects modeling was used. Pain scores were reported within one week by ten studies, but three were excluded from meta-analysis due to methodological issues. Studies involving participants aged 14-65 years, with pulp necrosis, apical periodontitis, or pulpitis, were included for analysis. Irrigation solutions varied from saline to sodium hypochlorite (2.25-5.25%), EDTA, citric acid, or chlorhexidine. Types of teeth treated included molars and anterior teeth. All studies used a 10# K-file for apical patency and various hand and nickel-titanium instruments for canal preparation. Generally, there was slightly reduced post-operative pain reported through the maintenance of patency. This was evident in the initial post-operative period of 24 h (OR = 1.69, P = 0.002), 1-day (MD = -1.69, P = 0.03) and 2-days (MD = -0.85, P = 0.04), but became non-significant over the remainder of the 7-day monitoring period. There was no significant difference in analgesic use between groups (OR = 0.82, P = 0.42). Studies were classified into three groups based on quality: four high quality with low risk of bias; three moderate quality with some concerns; and five low quality with high risk of bias. Evidence quality varied; pain scores on days 1 and 2 were of low quality, with very low quality for 12 h and days 3-6. High heterogeneity and imprecision were noted, especially in pain measurements and analgesic use. The meta-analysis indicates that during the initial post-operative period, apical patency significantly reduces postoperative pain. However, the findings should be interpreted cautiously due to high heterogeneity and variable evidence quality. Given that apical patency is seen as desirable for achieving the biological aims of endodontic treatment, the fact that it also appears to reduce post-operative pain helps to align patient reported outcome measures with traditional measures indicating success.

An entropy- TOPSIS approach to find PMMA/cellulose based biocomposite with optimum mechanical and bio-degradation properties

Poly methyl methacrylate based biocomposite has been manufactured using nanocellulose as reinforcement, which has been extracted from bagasse. The biocomposites are formed by bulk polymerization using benzoyl peroxide as initiator. The composites are evaluated by FTIR, X-ray diffraction, mechanical properties, UV analysis, scanning electron microscope, polarizing light microscope and thermo-gravimetric analysis. Variation in properties is an inherent drawback of natural fibers, for which this MCDM technique is very effective to decipher, the biocomposite with optimum properties. It has been found that when the bagasse fiber is treated with 3.5 % of sodium chlorite solution, it can produce biocomposite with PMMA. It has been observed that, cellulose grafting takes place in the PMMA chain in presence of benzoyl peroxide. Further the work has been extended with loading variation of the said cellulose fibers and 1.5 % loading has been found as the best. The novelty of the work lies in the fact that these evaluations have been substantiated by Multi-Criteria Decision Making (MCDM) technique involving ENTROPY and TOPSIS approach and successfully selected 1.5 wt % loading to fabricate the optimum biocomposite. This composite exhibited around 13.5 % biodegradation within 90 days. This film can find application in packaging field.

Antimicrobial evaluation of root canal irrigants of natural sources with and without gamma radiation activation (in vitro study)

ABSTRACT Aims: The present study aimed to evaluate the antibacterial effectiveness of newly formulated root canal irrigants derived from natural sources. In particular, this study investigated how these irrigants’ antimicrobial properties were affected by gamma radiation activation. Materials and Methods: Fifty-three single-rooted extracted human teeth with straight canals were selected, fully prepared, and sterilized. The roots were then infected with Escherichia coli, Enterococcus faecalis, and Candida albicans for 21 days at 37°C. Based on the irrigating solution utilized, the roots were divided into seven groups: Group I: chitosan irrigant, Group II: chitosan irrigant gamma irradiated, Group III: curcumin irrigant, Group IV: curcumin irrigant gamma irradiated, Group V: sodium hypochlorite (NaOCl) 5% irrigant, Group VI: positive control (infected roots without treatment), and Group VII: negative control (uncontaminated roots). After cleaning and shaping, microbiological sampling was performed. The samples were then transferred to sterile centrifuge tubes containing 1 mL of saline to determine the microbial growth. Colony-forming unit counts were employed for assessing the antimicrobial action. Statistical analysis was conducted to compare the percentage reduction in the microbial count from the initial count. Results: Group V and Group IV showed significantly higher values in microbial reduction than Group III and Group I. In addition, the results showed that Group II and Group III have significantly higher values than Group I. Conclusion: Natural irrigating solutions exposed to gamma radiation exhibited promising antimicrobial activity that is comparable to that of NaOCl and may be used as effective antimicrobial agents in endodontic treatment.

Efficacité de 6 scénarios de décontamination de bras de fauteuils contaminés volontairement au cyclophosphamide

The arms of chairs in outpatient oncology clinics are frequently contaminated with cyclophosphamide. To evaluate the effectiveness of decontamination scenarios. This was a descriptive simulation-type study of 6 decontamination scenarios of a silicone fabric surface contaminated with 10 μg of cyclophosphamide. The decontamination products tested (quaternary ammonium, 0.5% hydrogen peroxide, 0.005% detergent, and sodium hypochlorite 0.5%) were applied with microfibre wipes. Residual contamination was measured using an ultra-performance liquid chromatography-tandem mass spectrometry system with identical cyclophosphamide detection and quantification limits (0.0006 ng/cm2). Among the 59 samples, 3 blanks were negative, 5 allowed measurement of the recovery rate (93.7% [standard deviation 4.6%]), and 51 were experimental. The average efficiency of the agents was greater than or equal to 99.79%. Regardless of the agent used, effectiveness was 99.30% (SD 1.20%) after 1 cleanse (n = 18), 99.90% (SD 0.15%) after 2 cleanses (n = 18), and 99.95% (SD 0.06%) after 3 cleanses (n = 15). The 6 decontamination scenarios were effective. Repeated cleaning marginally increased the effectiveness of decontamination.

Evaluation of the Safe Water Optimization Tool to Provide Evidence-Based Chlorination Targets in Surface Waters: Lessons from a Refugee Setting in Uganda.

The Safe Water Optimization Tool (SWOT) generates evidence-based point-of-distribution free residual chlorine (FRC) targets to adjust chlorine dosing by operators and ensure water quality at point-of-consumption. To investigate SWOT effectiveness in surface waters, we conducted two before-and-after mixed-method evaluations in a Uganda refugee settlement served by piped and trucked surface water systems. We surveyed 888 users on water knowledge, attitudes, and practices; collected 2768 water samples to evaluate FRC,Escherichia coli, and disinfection by-products (DBPs) concentrations; and conducted nine key-informant interviews with system operators about SWOT implementation. After baseline data collection, SWOT chlorination targets were generated, increasing point-of-distribution FRC targets from 0.2 to 0.7-0.8 mg/L and from 0.3 to 0.9 mg/L for piped and trucked systems, respectively. At endline, household point-of-consumption FRC ≥ 0.2 mg/L increased from 23 to 35% and from 8 to 42% in the two systems. With these increases, we did not observe increased chlorinated water rejection or DBPs concentrations exceeding international guidelines. Informants reported that SWOT implementation increased knowledge and capacity and improved operations. Overall, SWOT-generated chlorination targets increased chlorine dosage, which improved household water quality in surface waters although less than previously documented with groundwater sources. Additional operator support on prechlorination water treatment processes is needed to ensure maximally effective SWOT implementation for surface water sources.

A Novel Approach for Real-Time Determination of 15N-Enriched Hydroxylamine.

Hydroxylamine (NH2OH) is a critical precursor of nitrous oxide (N2O) and key intermediate in the nitrogen cycle. However, the conversion of NH2OH is very fast, and the lack of real-time 15N analytical methods for NH2OH hinders the on-time capture of its biochemical signals in the N cycle. To bridge this gap, we developed a novel approach for real-time determination of 15N-enriched NH2OH. In this approach, an automated sample inlet unit was coupled to a membrane-inlet mass spectrometer, and NH2OH was converted to N2O by sodium hypochlorite for analysis. The interference of carbon dioxide was successfully removed by an ascarite trap, and the N2O signal showed good linearity over the targeted NH2OH concentrations. The limit of detection and limit of quantification of this approach were 0.38 and 1.28 μM, respectively, and 15N enrichment can be accurately detected when the 15N enrichment is higher than 5 atom %. This approach provides a first online analytical tool to capture real-time NH2OH transforming signals using the 15N tracing technique, which will advance mechanism studies of the N cycle.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

Extraction of cellulose nanofibers from sugarcane bagasse at different hydrolysis conditions

This study investigated the effect of alkaline treatment and various acid hydrolysis conditions on the extraction of cellulose nanofibers from sugarcane bagasse. Alkaline treatments were conducted using sodium hydroxide and sodium hypochlorite solutions. After the alkaline treatment, acid hydrolysis was performed in solutions containing 60, 64, and 68% wt. of sulfuric acid at temperatures of 30 ± 1 °C and 45 ± 1 °C. The effectiveness of the alkaline treatment in removing non-cellulosic components was assessed by infrared spectrometry and scanning electron microscopy, which demonstrated satisfactory results in eliminating non-cellulosic components. Transmission electron microscopy revealed the impact of temperature on the dimensions of the extracted cellulose nanofibers, with acid hydrolysis at 45 °C yielding smaller nanofibers compared to hydrolysis at 30 °C. X-ray diffraction analysis showed a higher percentage of crystallinity for hydrolysis at 45 °C, which can be attributed to the removal of a substantial amount of amorphous cellulose content.

Using Artificial Neural Networks to Predict Operational Parameters of a Drinking Water Treatment Plant (DWTP)

The scope of the present study is the estimation of key operational parameters of a drinking water treatment plant (DWTP), particularly the dosages of treatment chemicals, using artificial neural networks (ANNs) based on measurable in situ data. The case study consists of the Aposelemis DWTP, where the plant operator had an estimation of the ANN output parameters for the required dosages of water treatment chemicals based on observed water quality and other operational parameters at the time. The estimated DWTP main operational parameters included residual ozone (O3) and dosages of the chemicals used: anionic polyelectrolyte (ANPE), poly-aluminum chloride hydroxide sulfate (PACl), and chlorine gas (Cl2(g)). Daily measurable results of water sample analysis and recordings from the DWTP Supervisory Control and Data Acquisition System (SCADA), covering a period of 38 months, were used as input parameters for the artificial neural network (1188 values for each of the 14 measurable parameters). These input parameters included: raw water supply (Q), raw water turbidity (T1), treated water turbidity (T2), treated water residual free chlorine (Cl2), treated water concentration of residual aluminum (Al), filtration bed inlet water turbidity (T3), daily difference in water height in reservoir (∆H), raw water pH (pH1), treated water pH (pH2), and daily consumption of DWTP electricity (El). Output/target parameters were: residual O3 after ozonation (O3), anionic polyelectrolyte (ANPE), poly-aluminum chloride hydroxide sulfate (PACl), and chlorine gas supply (Cl2(g)). A total of 304 different ANN models were tested, based on the best test performance (tperf) indicator. The one with the optimum performance indicator was selected. The scenario finally chosen was the one with 100 neural networks, 100 nodes, 42 hidden nodes, 10 inputs, and 4 outputs. This ANN model achieved excellent simulation results based on the best testing performance indicator, which suggests that ANNs are potentially useful tools for the prediction of a DWTP’s main operational parameters. Further research could explore the prediction of water chemicals used in a DWTP by using ANNs with a smaller number of operational parameters to ensure greater flexibility, without prohibitively reducing the reliability of the prediction model. This could prove useful in cases with a much higher sample size, given the data-demanding nature of ANNs.

Potentially Toxic Elements in Urban-Grown Lettuce: Effectiveness of Washing Procedures, Risk Assessment, and Isotopic Fingerprint

This study investigates the presence of potentially toxic elements (PTEs) in lettuce (Lactuca sativa L.) grown in urban gardens in a highly industrialized city in Brazil and evaluates the effectiveness of different washing methods in reducing contamination. Ten elements (arsenic (As), barium (Ba), cadmium (Cd), cobalt (Co), chromium (Cr), copper (Cu), nickel (Ni), lead (Pb), vanadium (V), and zinc (Zn)) were analyzed for their concentration, and a health risk assessment was performed. The results showed that Pb concentrations in lettuce from gardens near the Capuava Petrochemical Complex reached 0.77 mg kg−1, exceeding both national and international safety limits. The most effective washing procedure involved the use of sodium hypochlorite, which reduced As by 46%, Pb by 48%, and V by 52%. However, elements such as Ba, Cd, Cr, and Ni showed limited reductions of less than 10% across all washing methods. Health risk assessments revealed a particular concern for children, with the total cancer risk (TCR) exceeding acceptable limits in some gardens. Isotopic analysis of Pb revealed that atmospheric pollution from gasoline emissions and industrial activities were the primary sources of contamination. The elevated levels of Pb, Cr, and As highlight the need for targeted health education in local communities, especially regarding the importance of proper washing techniques. Risk management strategies, including improved contamination control and public awareness, are crucial to minimize exposure to these harmful elements, particularly in vulnerable populations like children.