Forest In Greece Research Articles

Conservation Responsibility for Priority Habitats under Future Climate Conditions: A Case Study on Juniperus drupacea Forests in Greece

Juniperus drupacea is a highly morphologically and genetically differentiated Tertiary relict, displaying a disjunct geographical range in the eastern Mediterranean. Being a thermophilous, light-demanding, and moderately drought-resistant tree, it survived the past climatic oscillations via altitudinal migration. The species has its westernmost range limit, and its only populations in the EU, in Mts Parnon and Taygetos (Greece). These populations are genetically isolated and distinct compared to their Asian counterparts. For Europe, Juniperus drupacea is categorized as an endangered species by the IUCN. Juniperus drupacea forests constitute a priority habitat for conservation in the EU. However, the species’ conservation status has never been assessed in Greece and the same applies to its climate and land-use change assessment. As Greece is already facing the short-term impacts of climate- and human-induced land-use change, studies dealing with the potential long-term climate- and land-use change effects on rare plant species distribution are urgently needed to implement efficient conservation management plans. Our research employs species distribution models, considering multiple climate scenarios and abiotic factors across different timeframes (2020s, 2050s, 2080s), factoring in the potential threat of forest fires. Additionally, we assess the species’ extinction risk at the European level, according to IUCN Criteria A and B. Study findings indicate significant habitat changes and an elevated extinction risk for Juniperus drupacea in Greece. To safeguard this priority habitat, informed conservation strategies, management plans, and policy making are recommended, based on our scientific insights.

Temporal Variations in Temperature and Moisture Soil Profiles in a Mediterranean Maquis Forest in Greece

Soil moisture (SM) and temperature (ST) are critical factors in forest eco-hydrological research. In this study, we investigated the inter- and intra-annual changes in SM and ST profiles in a mixed Mediterranean maquis forest stand together with soil and meteorological parameters. Hourly data from three field measurements points at four depths (−5, −20, −40 and −70 cm) for 6 years were interpolated using the kriging method to produce annual SM and ST profiles. The results indicate that air temperature highly affects the upper 5 cm of the mineral soil. In general, it increases with depth in winter at an average rate of 0.036 °C/cm and decreases in summer (0.035 °C/cm), presenting higher values compared to air temperature from April to August and lower ones during the rest of the period. Precipitation is the main factor driving SM variations up to a superficial soil depth of 40 cm. The upper soil layer (0–40 cm) infiltrates water faster and presents high SM variability, especially in monthly and seasonal (year to year) time steps. The maquis forest stands are likely to be strongly affected by climate change, therefore the results of this study could be useful in hydrological and climate change studies focused on maquis vegetation water management.

Pre/Post-Fire Soil Erosion and Evaluation of Check-Dams Effectiveness in Mediterranean Suburban Catchments Based on Field Measurements and Modeling

The present study was conducted in the suburban forest of Thessaloniki city (Seich Sou), which constitutes one of the most significant suburban forests in Greece. In 1997, more than the half of the forest area was destroyed by a wildfire, after which soil erosion and flood control works (check-dams) were constructed in the burned areas. The aim of the study is to estimate the annual soil erosion rate for the last 30 years (pre- and post-fire periods) applying the WaTEM/SEDEM model, in order to investigate the impact of this wildfire on soil erosion, the effectiveness of the flood- and erosion-control works and the level of forest regeneration. It is the first time that WaTEM/SEDEM was calibrated and validated in Greece, taking into account soil erosion records from the 18 check-dams that were constructed in the study area in 2001. The mean annual erosion rate was 0.0419 t/ha/year, 0.998 t/ha/year and 0.08 t/ha/year for the pre-fire period, the first 3 years and 20 years after the fire, respectively. The results showed a very low erosion rate for the pre-fire period, an expected significant increase 3 years after the wildfire and a gradual decrease in the subsequent years until 2021. However, it seems that the post-fire regeneration of the forest has not been fully achieved, since the annual soil erosion rate at the long-term post-fire period is double compared with the pre-fire period. Concerning the check-dams’ effectiveness, it was observed that after 20 years of operation, they were non-silted, and most of them retained a small amount of sediments. This fact could be attributed to multiple factors such as the very thin soil depth, fire severity and catchment geomorphology, though the main reason seems to be the time elapsed between fire occurrence and the check-dams’ construction. The results of this study advance/strengthen the knowledge concerning the pre/post-fire soil erosion processes in already degraded ecosystems, while the calibrated model could serve as a useful tool able to be applied in other Mediterranean catchments of similar characteristics.

Determining structure and volume of the European beech (Fagus sylvatica L.) deadwood in managed stands in the Rodopi Mountain Range National Park, Greece

Abstract The multifaceted role of deadwood in forest ecosystems has been widely recognized while it is regarded as an indicator of sustainable forest management. Nevertheless, there are hardly any data on deadwood volume and structure in managed forests in Greece. The study took place in beech forests of the Western and Central part of the Rodopi Mountain Range. The objective was to determine the amount, variability and quality of deadwood and to compare it with data from managed as well as natural forests. Data were collected on 30 randomly distributed circular plots of 0.1 ha. The results showed that the average deadwood amount (13.46 m3 ha−1) was much lower compared to that recorded in other European forests and they highlighted the absence of large dead standing trees due to the management regime. The deadwood quality showed great variation in stages of decay.

Effect of climate change on fir forest communities in the mountains of South-central Greece

The endemic oro-Mediterranean fir (Abies spp.) forests in Greece are valuable ecosystems with high ecological and economic importance. In the mountains in south-central Greece, the availability of moisture plays a crucial role in the floristic composition, structure and distribution of fir forest communities. Because of the predicted adverse climate changes for the Mediterranean zone, suitability of many habitats for the growth of fir forests will change. This study aims to quantify the degree to which these forests will be affected by climate change. Current and future climatic conditions in the area studied were estimated for two periods of time (2041 – 60, 2061 – 80) and two climate change scenarios (RCP 4.5, RCP 8.5). Vegetation releves were classified and ordinated. Recursive partitioning was used to reveal the most important factor for discriminating the main plant communities and determining the ecological threshold between them. Current and future suitability of bioclimatic space for fir forest communities was identified. The effect of climate change was assessed based on predicted changes in the potential distribution, in terms of size and location, of fir forest communities. Two plant communities that reflect the differentiation of fir forests into xerophytic and mesophytic forest types are described. Among several climatic variables, spring drought was the best factor discriminating these two forest communities. The quantification of the threshold for drought in these two plant communities was used to predict their potential distribution in the area studied. Potential distribution of fir forests in south-central Greece will change in the future, due to a reduction in suitable bioclimatic space and shift to higher altitudes. The effect is expected to be greater for xerophytic forest communities, especially in the worst-case scenario (RCP 8.5) and in 2061–80.

PAR and UVA composition of global solar radiation at a high altitude Mediterranean forest site

Photosynthetically active (PAR) and ultraviolet-A (UVA) radiation have important effects on plant processes, affecting both health and ecology of the natural ecosystems. Studies dealing with the composition of global solar radiation Rs in PAR and UVA wavelengths are thus important. The present work is aimed at the investigation of the relationships of PAR, UVA with Rs, assessing the key factors that affect the corresponding ratios PAR/Rs and UVA/Rs at a high-altitude mountainous environment. The study was conducted in a protected Natura-2000 forest in Greece at a high altitude (1896 m a.s.l.) site and covers a time period of about 5 years (2014–2019). The analysis was performed on a monthly, seasonal and annual basis using hourly data. Results show that PAR/Rs and UVA/Rs present annual values 0.438 ± 0.031 and 0.034 ± 0.007, respectively with low monthly and seasonal variability. Further, sky clearness was found to have a significant effect on the composition of incident Rs, with PAR/Rs values to increase from 0.417 ± 0.013 to 0.483 ± 0.037 as sky conditions change from clear to overcast. The respective UVA/Rs values were 0.031 ± 0.002 and 0.045 ± 0.011. The hourly ratios become minimum at noon, whereas the magnitude of Rs was found to have a negative effect. In addition, PAR/Rs and UVA/Rs were increasing with relative humidity, optical thickness and relative optical air mass and decreasing with saturation vapor pressure, vapor pressure deficit, and to a less degree with air temperature. Concluding, at the high altitude Mediterranean forest site, Rs composition to PAR and UVA appears to be affected mainly by atmospheric clearness and by the geometric characteristics of the incident radiation rays, whereas atmospheric clearness was affected mainly by air humidity.

Carbon mitigation in the peri urban forest of Xanthi, Greece: a GIS mapping application

The global average surface temperature is determined by the energy balance of the Earth, which is affected by, among other factors, gases that can absorb or reflect either solar radiation or the radiation from the Earth’s surface. Greenhouse gases (GHGs) in the atmosphere absorb radiation emitted from the Earth’s surface and re-emit that radiation back towards the surface, increasing the Earth’s surface temperature. In this work, the medium-term effects of three forest thinning interventions on GHG emissions from forest soil and on litterfall biomass were studied. The studied area was a peri-urban forest in Greece. Two years after the thinning interventions, the thinning was found to have significantly affected the CO2 flux from the soil, although the impact of the thinning was weak. Litterfall was also significantly decreased two years after the thinning interventions. Litterfall was reduced at all thinned sites, with the greatest reduction observed at the most intensely thinned sites. Generating carbon pool maps in a GIS environment allowed the GHG distribution and litterfall biomass to be easily visualized. Such mapping may prove useful to local policy makers when they are planning appropriate sustainable actions aimed at climate-change mitigation.

Long-Term Forest Dynamics of Oromediterranean Fir Forests in Greece

The present study illustrates the situation of the genus Abies in the Mediterranean and in Greece, focusing in detail on the oromediterranean forest of the southern Peloponnese, at Mt. Taygetos. The existing pattern of forest dynamics (mosaic cycle) and also the timberline dynamics are presented and explained. Since fir forests are highly susceptible to drought-related impacts (fire and fir dieback: insect outbreaks/ forest pathogens), the analysis of the present situation is put into perspective by looking at the role of direct human influence and the climatic fluctuations of the past, taking into consideration dendrochronological findings and archival climate records. In view of climate warming the question is whether in recent decades the fingerprints of climate change can already be observed in the Greek fir forests. The study concludes that drought periods and climatic extremes have been an essential part of Greek climate for many centuries, causing high natural forest vulnerability. Therefore, fir dieback and fires are not a new phenomenon either – but in recent decades the accumulation of fuel, caused by land abandonment, has increased the danger of large wildfires. Nevertheless, the Greek mountain forests are highly endangered by increases in aridity and/or more frequent climate extremes (heat waves), together with increased risk of wildfires. Recommendations for an active forest management (counteracting expected adverse effects of climate change, by focusing on the establishment of an Abies cephalonica Loudon /Pinus nigra J. F. Arnold mosaic cycle) and further scientific research are provided.

The fluxes and distribution of molybdenum in a mountainous fir forest in two hydrological years

<p>The distribution, stocks and fluxes of Mo were examined in a mountainous fir forest in Greece in two hydrological years. In both years, the fluxes of Mo in throughfall were lower than those in bulk deposition implying Mo retention and probably uptake by tree canopies. The Mo concentration was appreciable in soil solution but its fluxes were lower than those in throughfall. The Mo fluxes in both bulk and throughfall deposition were higher than those in litterfall, a finding that stresses the importance of the hydrological cycle for this metal. The Mo concentration in the older twigs in the standing trees were higher than the current year ones most probably due to the existence of dry deposition. The concentrations of total Mo in soils reflected the nature of the sedimentary rocks underlying the soil and increased with depth following the clay concentration gradient. The available (oxalate extractable) Mo in soils ranged from 3% to 14% of the total Mo. In terms of the stocks of Mo, the soil had by far the highest values in both total and available Mo. The needs of the fir plants for Mo uptake are covered by the available Mo in the mineral soil layers, whereas the Mo content in the organic horizon may not be adequate for this purpose.</p>

Annual Greenhouse-Gas Emissions from Forest Soil of a Peri-Urban Conifer Forest in Greece under Different Thinning Intensities and Their Climate-Change Mitigation Potential

Abstract Knowledge of the response of thinning implementation on forest soil–atmospheric greenhouse gas (GHG) (CO2, CH4, N2O) fluxes exchange system in Mediterranean region is limited because of the high heterogeneity of both soil properties and forest biomass. The novelty of this study is grounded predominantly in evaluating for the first time the response of annual GHG fluxes to thinning in a coniferous peri-urban forest soil in Greece, thus contributing significantly to the enrichment of the GHG fluxes database from the Mediterranean forest ecosystem. Results suggest that CH4 uptake increased with increasing thinning intensity. The reduction in CO2 emissions in both thinning treatments was possibly related to an indirect effect of soil heterotrophic and autotrophic respiration. Coniferous peri-urban forests in Greece can act temporally as sinks of atmospheric N2O in the coldest months and a weak source of N2O fluxes in summer. The GHG variation depended largely on soil environmental factors with soil temperature representing the dominant factor for CO2 and CH4, whereas soil moisture correlated, albeit weakly, with N2O variability. Reduction in global warming potential was observed in both thinning treatments, markedly in selective treatment, giving an initial indication that high-intensity thinning in coniferous peri-urban forests in Greece presents a high potential for global change mitigation.

Ratio of photosynthetically active to total incoming radiation above a Mediterranean deciduous oak forest

Photosynthetically active radiation (PAR) is an important parameter in ecological research. However, it is not routinely measured and often is estimated as a constant ratio of the incoming solar shortwave radiation (Rs). There are only few reported PAR/Rs values worldwide concerning the Mediterranean climate and even fewer from rural or forest areas, especially at higher altitudes. Hourly PAR and Rs flux densities were measured above a deciduous oak forest in Greece from 1999 to 2005, and their relationship was investigated under various conditions. Results show that the annual mean hourly PAR/Rs is 0.454, ranging from 0.443 in spring to 0.478 in autumn, with intermediate values in summer (0.454) and winter (0.459). The ratio increases with dew point temperature but decreases as solar elevation angle or Rs increases. Atmospheric clearness index, Kt, and actual water vapor pressure, ea, are the key factors determining the ratio; however, relative humidity (RH) also seems to have an indirect effect by affecting Kt and ea values. PAR/Rs changes from 0.468 to 0.455 as sky conditions change from clear to overcast and appears to increase with ea. However, Kt affects the ratio when RH is lower than 60%, while ea has a more obvious effect at more saturated atmospheric conditions.

Fuel Treatments and Potential Fire Behavior in Peri-Urban Forests in Northern Greece

The peri-urban and urban forests in Greece occupy a total area of 105.353 ha. In these vulnerable ecosystems, fire constitutes a natural disaster presenting particular challenges and specific difficulties. These include the high number of visitors as well as the forest characteristics, such as the presence of particularly flammable tree species and the high accumulation of combustible biomass, that make the on-start of fires more likely. The main purpose of the current research is to identify the optimum combination of silvicultural treatments to efficiently reduce potential severity of forest fires and to facilitate their successful suppression by firefighting crews. In order to simulate the basic fire environment of urban forests, two main experimental plots were established and several tree and topographical characteristics were measured. Additionally, a crown fire hazard modelling system (NEXUS) was used to simulate forest fire potential behavior before and after the adoption of the silvicultural treatments that altered critical characteristics of the forest fire environment. The results clearly show that specific silvicultural prescriptions altered the type of forest fire spreading potential, revealing the overall efficiency of preventing actions during forest management.

Lichens ofPicea abiesForests in Greece

Christensen, S. N. 2018. Lichens of Picea abies forests in Greece. – Herzogia 31: 219–230.Twenty-six epiphytic and 12 epigeic species are reported from oroboreal Picea abies forests in the Rodopi Mountains, northern Greece. All species except Usnea intermedia also occur in the boreal zone of northern Europe and most inhabit a broad range of climatic zones. Conservation aspects of the forests are briefly discussed. Six taxa, Bryoria nadvornikiana, Cladonia subulata, Fellhanera subtilis, Peltigera hymenina, Ramalina obtusata and R. thrausta, are new to Greece, and two, Usnea intermedia and U. subfloridana, are new to Macedonia.

Carbon fluxes above a deciduous forest in Greece

Photosynthetic production in forest ecosystems occurs through the absorption of light and CO 2 . The present work deals with CO 2 and carbon flux densities above a deciduous forest in Greece, the southernmost monitoring site in Europe. Results show annual net carbon absorption of 7.6 t C ha –1 y –1 , indicating that this forest is a strong carbon sink compared to other European sites. However, absorbance may be reduced by 1 μmol m –2 s –1 for every 1.5 oC above-canopy air temperature increase or 0.015 cm3 cm–3 active root-zone moisture depletion, beyond estimated optimum values. The forest acts as a carbon sink from late April to early November and as a source of carbon in the remaining period of the year. The highest CO 2 net absorption flux occurs during June-July (approximately 200 g C m –2 month –1 ).

Predicting species dominance shifts across elevation gradients in mountain forests in Greece under a warmer and drier climate

The Mediterranean Basin is expected to face warmer and drier conditions in the future, following projected increases in temperature and declines in precipitation. The aim of this study is to explore how forests dominated by Abies borisii-regis, Abies cephalonica, Fagus sylvatica, Pinus nigra and Quercus frainetto will respond under such conditions. We combined an individual-based model (GREFOS), with a novel tree ring data set in order to constrain tree diameter growth and to account for inter- and intraspecific growth variability. We used wood density data to infer tree longevity, taking into account inter- and intraspecific variability. The model was applied at three 500-m-wide elevation gradients at Taygetos in Peloponnese, at Agrafa on Southern Pindos and at Valia Kalda on Northern Pindos in Greece. Simulations adequately represented species distribution and abundance across the elevation gradients under current climate. We subsequently used the model to estimate species and functional trait shifts under warmer and drier future conditions based on the IPCC A1B scenario. In all three sites, a retreat of less drought-tolerant species and an upward shift of more drought-tolerant species were simulated. These shifts were also associated with changes in two key functional traits, in particular maximum radial growth rate and wood density. Drought-tolerant species presented an increase in their average maximal growth and decrease in their average wood density, in contrast to less drought-tolerant species.

Livestock grazing, forest protection and law in Greece

PurposeThe purpose of this paper is to present, from a critical point of view, the current legal framework of livestock grazing in public forests in Greece, to present the implementation problems that have arisen and to suggest possible solutions.Design/methodology/approachThe authors are trying to combine and implement some of the rangeland ecology results as a tool to explain the legal status and the reform proposals.FindingsLivestock grazing is a misunderstood activity when it occurs in forests. In fact, when livestock grazing is controlled and based on the capacity of a forest area, it has been proven that it does not degrade an ecosystem; on the contrary, it contributes to biodiversity and to the prevention of forest fires. The prohibition of grazing for a long period of time, along with the establishment of a legal framework by which the forestry service is required to abide, which does not provide for alternatives or compensatory measures to farmers, has resulted in the creation of extremely unpleasant conditions for farmers.Originality/valueThere are hardly any relevant studies in Greek and international literature specifically focused on the Greek legal status of livestock grazing. The scarce contributions on this topic have been investigated and are incorporated in the justification of the study.

EFFECT OF FUEL TREATMENTS ON CROWN FIRE BEHAVIOR IN ALEPPO PINE FORESTS OF GREECE: A SIMULATION STUDY

This study models the potential effect of various fuel treatments on crown fire behavior by using two crown fire simulation models in Aleppo pine (Pinus halepensis Mill.) stands. Fuel complex characteristics that influence fire behavior were measured in a representative Aleppo pine stand in northern Greece, using standard surface and canopy fuel inventory methods. Nine different fuel treatments (control, prescribed burning, controlled grazing, thinning without slash removal, thinning with slash removal, thinning and prescribed burning with slash removal, thinning and controlled grazing with slash removal, thinning and prescribed burning without slash removal, thinning and controlled grazing without slash removal) were simulated by adjusting surface fuels (total load, load-by-size class, depth) and canopy fuels (available canopy fuel load, canopy base height, canopy bulk density) under dry and normal fuel moisture conditions. Under normal conditions, stand thinning followed by prescribed burning and/or controlled grazing with slash removal prevented crown fire initiation in most cases. Under dry fuel moisture conditions, the simulation showed that the proposed fuel treatments did not appear to be effective in averting crown fire initiation and spread. Combinations of prescribed fire and/or controlled grazing can be used to reduce wildfire hazard in Aleppo pine forests. Management of Aleppo pine forests should include an analysis of how the proposed actions (logging, thinning, etc.) may affect fuel complex properties. Fuel treatment plans should be an essential component of forest management in Aleppo pine forests in Greece, in order to reduce fire hazard.

First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

SYPYDA: A software tool for fire management in Mediterranean pine forests of Greece

The main objective of this study is the design and the development of a fire management software tool for Mediterranean pine forests of Greece. The system operates as a standalone application and allows the end users to apply various fire environment (meteorology, topography, fuel) scenarios in order to estimate the characteristics of fuel complexes in Mediterranean pine stands, to predict the expected fire behavior, as well as to implement and evaluate fuel treatments for reducing the intensity and severity of fires in such ecosystems. The system simulates fire behavior (probability of crown fire initiation, type of fire, rate of spread and fireline intensity) in different types of understory vegetation and stand overstory structure under different weather conditions using current well-tested fire behavior prediction models. All user interaction with the software is done via a friendly and modern Graphical User Interface (GUI), designed in Windows Presentation Foundation/eXtensible Application Markup Language (WPF/XAML), a framework with User Interface (UI) elements coded in C# .NET. The proposed system is expected to assist forest researchers, forest service officials and land managers to evaluate fuel hazard and assess the potential for initiation and spread of wildfires in Aleppo and Calabrian pine forests in Greece.

Climate Change, Wildfires and Fir Forests in Greece: Perceptions of Forest Managers

Climate Change, Wildfires and Fir Forests in Greece: Perceptions of Forest Managers