Food Crops Research Articles

Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.

Effect of warehouse storage on the alteration, cooking and organoleptic characteristics of Kponan yam (Dioscorea cayenensis-rotundata) of Côte d'Ivoire

Yam holds the top position in food crop production, and Kponan yam is highly prized by Ivorians. However, storage deterioration poses economic challenges for wholesalers and producers. This study assesses Kponan yam quality in warehouse storage, considering its geographical origin. To achieve this, yams from the Bondoukou, Bouna, and Kouassi-Kouassikro regions were kept at a warehouse in Abidjan, allowing an assessment of alterations, cooking properties, and organoleptic characteristics over a 3-month storage period. Kponan yam tubers were placed on boards at the warehouse's temperature (27.98 °C) and relative humidity (85.61 %). Temperature and humidity levels were recorded three times per week and four times daily at 08:00, 12:00, 16:00, and 20:00. Physical, cooking, and sensory characteristics were checked at harvest and during each month. The results showed that the main damage observed during storage at the warehouse was rotting and dehydration of the tubers. Rot rates were 47.53 % for yams grown in Bondoukou, 51.96 % for those grown in Bouna and 60.65 % for those grown in Kouassi-Kouassikro. Dehydrated tubers rates were 17.88 %, 25.04 % and 29.20 % for yams from Bondoukou, Bouna and Kouassi-Kouassikro, respectively. The browning indices of Kponan yams decrease (P < 0.05) during storage, with a much more marked effect for yams grown in Bouna (23.43-18.56) and Bondoukou (24.73-18.11), in contrast to those grown in Kouassi-Kouassikro (26.09–22.96). Hardness also dropped for Kponan yams grown in Bouna, Bondoukou and Kouassi-Kouassikro (38.94–25.19 N, 39.39–26.52 N and 35.59–26.66 N respectively). Sensory analysis showed that yams from Bouna stored for three months were rated highest in taste (score = 4). The storage quality of Kponan yams was influenced by the cultivation region. Organic production of Kponan yams benefits the environment and human health, while increasing shelf life.

Mycotoxins in Food: Cancer Risks and Strategies for Control.

Mycotoxins are toxic compounds produced by fungi such as Aspergillus, Penicillium, and Fusarium, contaminating various food crops and posing severe risks to food safety and human health. This review discusses mycotoxins' origins, significance, and impact, particularly in relation to cancer risk. Major mycotoxins like aflatoxins, ochratoxins, fumonisins, zearalenone, and patulin are examined, along with their sources and affected foods. The carcinogenic mechanisms of these toxins, including their biochemical and molecular interactions, are explored, as well as epidemiological evidence linking mycotoxin exposure to cancer in high-risk populations. The review also highlights critical methodologies for mycotoxin detection, including HPLC, GC-MS, MS, and ELISA, and the sample preparation techniques critical for accurate analysis. Strategies for controlling mycotoxin contamination, both pre- and post-harvest, are discussed, along with regulations from organizations like the FAO and WHO. Current challenges in detection sensitivity, cost, and control effectiveness are noted. Future research is needed to develop innovative analytical techniques, improve control strategies, and address the influence of climate change on mycotoxin production. Finally, global collaboration and emerging technologies are essential for advancing mycotoxin control and enhancing food safety.

Unveiling the influences of P fertilization on bioactive compounds and antioxidant activity in grains of four sorghum cultivars.

Phosphorus is a critical nutrient in agriculture, influencing plant growth and nutritional quality. This study, uniquely designed to investigate the effects of phosphorus (P) fertilization levels, sorghum cultivars, and growing locations on phytochemical content and antioxidant activity in sorghum grains, employed four sorghum cultivars (Hakeka, P954063, Tabat, and Tetron) grown under three P levels (0P, 1P, 2P) in two locations (Gezira and White Nile) in Sudan. In this study, four sorghum cultivars were grown in two distinct locations in Sudan, employing a split-plot design with three (P) fertilization levels. P was applied as triple super phosphate directly with the seeds, and additional fertilization included urea applied in two split doses. At physiological maturity, representative sorghum panicles were harvested, processed, and analyzed for bioactive compounds and antioxidant activities using standard extraction and quantification techniques such as Folin-Ciocalteu for phenolics and colorimetric flavonoid assays. Antioxidant activities were assessed through various assays, including DPPH and FRAP. Statistical analyses were performed using a three-way ANOVA to examine the effects of cultivar, P level, and location on the measured parameters, supplemented by multivariate analysis to further elucidate the interactions between these factors. Significant interactions (p<0.001) were observed among cultivars, P levels, and locations for total phenolic content (TPC), total flavonoid content (TFC), carotenoids, tannins, and various antioxidant activity measures (DPPH, FRAP, ABTS, TRP, H2O2). P fertilization significantly increased all measured phytochemicals and antioxidant activities compared to non-treated cultivars, except for H2O2, which decreased with P application. Among cultivars, Hakeka consistently exhibited the highest TFC, carotenoid content, and antioxidant activities (DPPH, FRAP, TRP, ABTS), particularly at the 2P level. P954063 showed the highest TPC and tannin concentrations. Tetron generally had the lowest phytochemical and antioxidant levels. White Nile showed higher TPC, carotenoids, DPPH, FRAP, TRP, and ABTS levels, while Gezira had higher TFC, tannins, and H2O2 concentrations. The impact of phosphorus fertilization often varies between locations. Strong positive correlations were found between TPC and all antioxidant assays (r = 0.68-0.90) and total carotenoids and antioxidant activities (r = 0.73-0.93). This study recommended cultivating the Tabat variety with 2P doses in Gezira. In addition, the Hakeka cultivar showed the highest increases in total flavonoid content, carotenoids, and antioxidant activities, particularly under the highest P level (2P). The findings highlight that P plays a critical role in enhancing sorghum's nutritional and health-promoting qualities, which are essential for leveraging this staple crop for food and nutrition security strategies in semi-arid regions.

Test Application for Growth Promoting Rhizobacteria (PGPR) and Planting Media to Grow the Growth and Yield of Shallot Plants (Allium ascalonicum L.) Varieties of Bauji

The main commodity of food crops is rice which has a strategic function, namely as a staple food for the people of Indonesia. Maintaining the health and quality of soil biologically by reducing dependence on synthetic fertilizers. Swamp Inbred Paddy (Inpara) are superior varieties of paddy that are well cultivated in swamp land conditions, resistant to immersion, and adaptability to acidic soil conditions. This study investigates the combination of biological and synthetic fertilizers on the growth of flood-tolerant Inpara rice using a strip plot/split block design. The treatments used were 6 combinations of biological fertilizers-synthetic fertilizers and 3 paddy varieties with 3 replications. The results obtained from the analysis of variance then conducted a further test of BNJ to determine the performance of each variable. Correlation test is performed to determine the interactions and relationships between observational variables. Soil analysis is also carried out to determine the mineral content in the soil. The effect of the combination of synthetic and biological fertilizer doses with 3 Inpara paddy varieties interacted significantly on several observational variables resulting in significantly different performance. The combination treatment with 75% synthetic fertilizer and 25% biological fertilizer showed several parameters that were higher than the treatment with 100% synthetic fertilizer so that the use of synthetic fertilizer can be reduced.

Risk Management of Green Bean Farming Production in Gluranploso Village, Gresik District

Green beans are the most important food crop in Indonesia and production continues to increase to meet domestic demand. However, production is still insufficient due to several risks faced by farmers. This research analyzes the risk management of green bean production in Gluranploso Village using the Coefficient of Variation (KV) and Failure Mode and Effect Analysis (FMEA) methods. The results showed that yield variation was relatively low with a KV value of 17%, indicating good yield stability. The FMEA analysis identified four main sources of risk affecting production: seed aspect with an RPN value of 5.808, weather with an RPN value of 7.04, pests and diseases with an RPN value of 12.936, and technical aspects with an RPN value of 47.88, particularly delays in pest and disease control spraying. In addition, the market aspect is also a source of risk with the largest value in the increase in production input prices at 12.288. These sources require special attention in risk management. The study concludes that the implementation of appropriate risk management strategies, focusing on the identified key risk sources, can help farmers improve yield stability and farm profitability. These strategies include improving seed quality, mitigating weather risks, controlling pests and diseases, and improving technical procedures in cultivation and market risks. Thus, effective risk management can be key in increasing the productivity and sustainability of green bean farming in Gluranploso village.

Genome-Wide Association Study of Sweet Potato Storage Root Traits Using GWASpoly, a Gene Dosage-Sensitive Model.

Sweet potato (Ipomoea batatas) is an important food crop that plays a pivotal role in preserving worldwide food security. Due to its polyploid genome, high heterogeneity, and phenotypic plasticity, sweet potato genetic characterization and breeding is challenging. Genome-wide association studies (GWASs) can provide important resources for breeders to improve breeding efficiency and effectiveness. GWASpoly was used to identify 28 single nucleotide polymorphisms (SNPs), comprising 21 unique genetic loci, associated with sweet potato storage root traits including dry matter (4 loci), subjective flesh color (5 loci), flesh hue angle (3 loci), and subjective skin color and skin hue angle (9 loci), in 384 accessions from the USDA sweet potato germplasm collection. The I. batatas 'Beauregard' and I. trifida reference genomes were utilized to identify candidate genes located within 100 kb from the SNPs that may affect the storage traits of dry matter, flesh color, and skin color. These candidate genes include transcription factors (especially Myb, bHLH, and WRKY family members), metabolite transporters, and metabolic enzymes and associated proteins involved in starch, carotenoid, and anthocyanin synthesis. A greater understanding of the genetic loci underlying sweet potato storage root traits will enable marker-assisted breeding of new varieties with desired traits. This study not only reinforces previous research findings on genes associated with dry matter and β-carotene content but also introduces novel genetic loci linked to these traits as well as other root characteristics.

Important Crop Pollinators Respond Less Negatively to Anthropogenic Land Use Than Other Animals.

Animal-mediated pollination is a key ecosystem service required to some extent by almost three-quarters of the leading human food crops in global food production. Anthropogenic pressures such as habitat loss and land-use intensification are causing shifts in ecological community composition, potentially resulting in declines in pollination services and impacting crop production. Previous research has often overlooked interspecific differences in pollination contribution, yet such differences mean that biodiversity declines will not necessarily negatively impact pollination. Here, we use a novel species-level ecosystem service contribution matrix along with mixed-effects models to explore how groups of terrestrial species who contribute differently to crop pollination respond globally to land-use type, land-use intensity, and availability of natural habitats in the surrounding landscape. We find that the species whose contribution to crop pollination is higher generally respond less negatively (and in some cases positively) to human disturbance of land, compared to species that contribute less or not at all to pollination. This result may be due to these high-contribution species being less sensitive to anthropogenic land conversions, which has led humans to being more reliant on them for crop pollination. However, it also suggests that there is potential for crop pollination to be resilient in the face of anthropogenic land conversions. With such a high proportion of food crops requiring animal-mediated pollination to some extent, understanding how anthropogenic landscapes impact ecological communities and the consequences for pollination is critical for ensuring food security.

Conservation agriculture and nutrient management strategies for enhancing crop performance, productivity and nutrient uptake under rice-wheat cropping system

Understanding the relationship between tillage and nutrient management strategies is crucial for maintaining the long-term sustainability of the rice-wheat cropping system (RWCS). Therefore, a field experiment was conducted from 2022 to 2024 at Dr. Rajendra Prasad Central Agricultural University in Pusa, Samastipur, Bihar to study the effect of nutrient management strategies under conservation agriculture (CA) for enhancing crop growth performance, protein content and productivity of RWCS. The experiment was conducted in a split-plot design replicated thrice with 3 different tillage and crop establishment methods [zero tillage direct seeded rice (ZTDSR)-zero tillage wheat (ZTW), puddled DSR (PDSR)-ZT with rice residue retention (ZT + RR) and puddled transplanted rice (PTR)-conventional tillage wheat (CTW)] in main plots and four nutrient management strategies [Farmer’s Fertilizer Practices (FFP), Nutrient Expert recommended dose of fertilizer (NE-RDF), RDF + spray of nanourea (NU) and Customized fertilizer (CF)] in sub plots. In both years, crop growth attributes at harvest in rice were found maximum under PDSR while in wheat it was under ZT + RR. In wheat, ZT + RR recorded maximum grain yield which was 13 % and 14.5 % higher than CTW in 2022-23 and 2023-24 respectively. A decline in rice grain yield of 8.3 % and 8.9 % was recorded under FFP over NE-RDF in 2022 and 2023 respectively. Hence, PDSR followed by ZT+RR coupled with NE-RDF can increase agronomic performance and productivity under RWCS.

The impact of pesticides: Assessing residue persistence, environmental contamination, and human health risks

The intensification of agricultural practices to meet global food demand has led to extensive pesticide use, which poses significant challenges for food safety, environmental health, and human well-being. This narrative review provides a comprehensive analysis of the global use of pesticides in agriculture, focusing on the persistence of pesticide residues in food crops, their environmental impacts, and the associated health risks. Historically, pesticides have been integral to agricultural productivity, but their adverse effects have become increasingly clear. Notably, pesticide residues in food can pose serious health risks, particularly to vulnerable populations such as children and pregnant women. This review also discusses regional disparities in pesticide-related health outcomes, with a focus on Brazil. The findings underscore the urgent need for sustainable pest management practices, including organic farming and improved regulatory measures, to mitigate the adverse effects of pesticide use. By integrating these strategies, a more balanced and sustainable agricultural system can be achieved, safeguarding both human health and environmental quality.

Research Progress on Mechanization Technology and Equipment for Cassava Field Production

Cassava is one of the world’s staple crops and an important economic and food crop for one billion people. It holds significant value in food, feed, and industrial raw materials. However, cassava production is faced with the following problems: agricultural machinery and agronomy are not integrated, work efficiency is not high, it is not suitable for large-scale planting plots, and there is a lack of large-scale equipment, automation, and intelligent cassava production equipment. This study reviews research on cassava planting agronomy and mechanized production technologies and equipment, including planting, stem–tuber separation, and harvesting, both globally and in China. The shortcomings are analyzed, and recommendations are provided for current mechanized cassava production to accelerate the development of intelligent equipment and strengthen the shortcomings. Meanwhile, we used typical and extensive Chinese planting and harvesting machines as case studies. The future trends in cassava production are forecasted, underscoring the importance of advancing global mechanized technology and equipment for cassava production to enhance its efficiency, competitiveness, and modernization.

Influence of Forest Plantation Establishment Schemes on Community Livelihoods: A Case of Makutano Forest Kericho County, Kenya

Exploitation of forest resources has been a thorny issue to many countries. In efforts to restore degraded forests, countries have resulted to establishing forest plantations. There is also need to sustain livelihoods of these populations living around forests. Kenya on its part, adopted Plantation Establishment and livelihoods Improvement scheme (PELIS) program as part of participatory Forest management (PFM). PELIS involves the planting of food crops together with tree seedlings. It is however not clear whether balance has been strike between attaining forest cover and improving community livelihoods as was the intent of the program. Consequently, this study sought to shed light on this issue by looking at the influence of forest plantation on community livelihoods. This study adopted the decentralized forest management theory. Cross-sectional research design was adopted. Quantitative and qualitative methods were employed in data collection and analysis. The target population was 1719 which included forest adjacent community (FAC) members, and community based organization (CBO) leaders. From this a sample of 212 was selected. Systematic sampling was used in selecting the households and snowball sampling in selecting the CBO leaders involved in two tire focused group discussion. Questionnaire schedules were prepared to be used among household members. The findings indicated a significant influence of PELIS on community livelihood (f = 221.642, P=0.000). Those near the forest registered to have derived more economic benefits than those far away from the forest (f= 3.127, P= 0.000). A strong relationship between the frequency of attending CFA and CBO meetings, the level of involvement in decision making and planning of forest activities (B = 3.479, P&lt; 0.05) was noted. The size of land available for cultivation was found to be statistically significant to food security among the community (f= 221.642, P= 0.000). The most important and most utilized forest products were firewood at 95%, fodder at 71% and droppers from tree pruning at 68%. Further research is needed on how more benefits from products like herbs, wild vegetables and honey cold be realized.

Assessment of Lepidopteran Pest Dynamics in Maize: Dominance of Spodoptera frugiperda and Implications for Targeted Management in Himachal Pradesh, India

Maize (Zea mays L.) plays a crucial role in the agricultural economy of India, particularly in Himachal Pradesh, where it serves as a vital crop for food, feed, and fodder. This study assessed the distribution, and relative abundance of lepidopteran pests infesting maize during the kharif, 2022-23 across two agro-climatic zones of Himachal Pradesh. Surveys identified five key lepidopteran pests: Spodoptera frugiperda, Chilo partellus, Mythimna separata, Agrotis ipsilon, and Euproctis spp. Among all, S. frugiperda is the only pest occurring among the major three crop stages of maize. The findings revealed that S. frugiperda was the most dominant pest, with relative abundance values of 19.57 per cent in Zone I and 18.94 per cent in Zone II during the seedling stage, increasing to 30.87 per cent and 30.40 per cent during the vegetative stage, respectively. In contrast, other pests like C. partellus, M. separata, A. ipsilon, and Euproctis spp. exhibited variable distribution patterns, with some showing limited occurrence. In conclusion, this study underscores the necessity for targeted pest management strategies to address dominant and subdominant lepidopteran pests in maize cultivation in Himachal Pradesh. The results offer valuable insights that can inform focused pest control efforts, with the potential to significantly enhance sustainable maize production, crop resilience and overall productivity in the region.

Aplikasi Pupuk Branglai (Brangkasan Kedelai) dalam Upaya Peningkatan Pertumbuhan dan Produksi Beberapa Varietas Tanaman Kedelai (Glycine max L.)

Soybean (Glycine max L.), which is widely grown in Indonesia, is a popular food crop because of its high protein content. This plant plays an important role in increasing protein intake for the community, because it is a safe and economically affordable source of vegetable protein. To increase the productivity of soybean plants, it is not only important to choose quality seed varieties, but also to implement appropriate cultivation practices. One of the main techniques is to use superior seed varieties. Apart from that, increasing the quality and yield of soybean production can be achieved by providing fertilizer that meets the nutritional needs of plants. This research used a Randomized Block Design (RAK) with 2 factors and 2 replications to obtain 24 research plots. Factor I of Branglai Fertilizer (B) which consists of 4 levels,namely: B0=0ml/liter.air/plant, B1=20ml/liter.air /polybag, B2=40 ml/liter.air/polybag, B3 = 60 ml/ liter. water/polybag. Factor II Soybean Variety (V) which consists of 3 levels, namely: V1 = Dega 1 Variety, V2 = Ring 1 Variety, V3 = Devon 1 Variety. The research procedure consists of making fertilizer, land preparation, filling polybags, planting, fertilizer application branglai (soybean stover), determination of sample plants, maintenance and harvest. Keywords: soybean, branglai fertilizer, soybean variety

Temporal and Spatial Dynamics of Anthracnose (Colletotrichum sublineolum) Disease on Selected Sorghum Genotypes at Assosa Zone, Western Ethiopia

Background Over 500 million people worldwide rely on sorghum as a main food crop. About 10% of the daily caloric intake of households in Ethiopia’s northwest and eastern regions, including Benishangul Gumuz, comes from sorghum. A hemi-biotrophic fungal pathogen called Colletotrichum sublineolum caused anthracnose disease is among the biotic constraints of sorghum production. Methods Ten selected sorghum genotypes were assessed for sorghum anthracnose severity and its temporal and spatial dynamics on field plots in the districts of Assosa and Bambasi. The performance of the chosen sorghum genotypes was assessed using the following metrics: AUDPC, disease progress rate, yield-related trait, sorghum grain yield, and mean severity index. Anthracnose severity was evaluated using a 1–5 disease rating scale and assessments conducted at seven consecutive time points. Results Ten genotypes of sorghum were examined in the districts of Assosa and Bambasi, with mean anthracnose severity index ranging from 60-77 PSI and 53-82 PSI, respectively. AUDPC varied from 351 to 470 % days and 316 to 499 % days at Assosa and Bambasi districts, respectively. Bambasi district achieved a larger grain yield than the Assosa district. Assosa-1 demonstrated a significant level of disease pressure, yet the current investigation found that this genotype is the highest performing genotype in both locations. Conclusions There is a considerable positive link between the severity of anthracnose and the weekly total rainfall and relative humidity. At both trial sites, Mersa-1 continuously produced higher grain yields and reduced disease levels. Breeders might utilize the Baco Striga sorghum genotype as a check line in a breeding effort to resist anthracnose disease because it shown a high vulnerability to the disease at both locations.

Functional response and control potential of adult Arma chinensis on Colorado potato beetle in Xinjiang, China

AbstractPotato is an important food crop. The Colorado potato beetle (CPB) is its key pest. CPBs are now resistant to several chemical pesticides, making their control more difficult. The predatory insect, Arma chinensis, is a natural enemy of other plant pests. We studied the predation of adult A. chinensis on CPB eggs and young larvae under indoor controlled conditions and its control of CPB in cages under outdoor conditions. Adult A. chinensis effectively reduces CPB egg and larva populations, and its predatory functional response aligns with Holling’s Type II model. A. chinensis adults released within outdoor cages reduced CPB populations. Based on the predation behavior of the adults of A. chinensis to CPB eggs and young larvae, A. chinensis is an efficient and potential predator.

Peningkatan Kapasitas Petani Melalui Pelatihan Pemupukan Tanaman Padi di Provinsi Sumatera Utara

To increase farmers knowledge and skills in managing rice fertilization, the government and related institutions have implemented various fertilizer training programs. This research aims to evaluate the effectiveness of rice fertilizer training in increasing the capacity of farmers in North Sumatra Province. This research was carried out at UPT. Agricultural Training and Mechanization for the Food Security, Food Crops, and Horticulture Service of North Sumatra Province on February 20–23, 2024. This research was carried out on 30 training participants from 12 districts in North Sumatra. The data collected consists of primary data consisting of respondent characteristics and pre-test and post-test results. The data were analyzed with the Minitab applications of tware using non-parametric statistical analysis, namely the Wilcoxon Match Pairs Test with a significance level of 0.05. The increase in knowledge of farmers who took part in rice fertilization training was 32.2%. In general, attitudes and responses are classified as high, namely the benefits of the material provided are 100%, the ease of the material to be appliedis 100%, the excessprofits obtained in applying the material are 100%, the suitability of the material with farming needsis 100%, liking orinterest in the material provided was 100%, the desire to apply the material provided was 83.3%, and the plan to implement the material provided was 80%. Keywords: training, pretest, posttest, fertilizing rice plants

Characterization of high-yielding aman rice genotypes through genetic and agronomic analysis

ABSTRACT Rice (Oryza sativa L.) holds immense global significance, serving as a staple food crop that sustains billions of people and supports livelihoods across diverse cultures and economies, including Bangladesh. For food security in Bangladesh, there is a significant demand for high-yielding Aman rice varieties. We assessed genetic variability of 16 Aman rice genotypes, including 11 promising Aman lines and 5 established Aman cultivars in Bangladesh, with the aim of identifying high-yielding genotypes through a three-year field experiment. The examined genotypes displayed notable variations in both yield and agronomic traits contributing to yield, as evidenced by their greater range of coefficients of variance and genetic variability components. Traits such as effective tillers per hill (ET), filled grains per panicle (FG), plant height (PH) at 80 days after transplanting, and panicle length (PL) demonstrated notable correlations with grain yield (GY) throughout the three-year evaluation. Moreover, the higher broad-sense heritability (H 2) observed in ET, FG, PH, and PL traits suggested a substantial influence of genetic factors on the variability of the Aman rice genotypes. Principal component analysis based biplot and heatmap analyses revealed that the advanced lines BU acc4 and BU acc5 had higher harvest index and relatively greater GY compared to the other Aman rice varieties. These promising Aman lines could prove to be valuable materials for future multi-location yield trials or ongoing and forthcoming breeding programs aimed at enhancing high-yielding Aman rice cultivars.

ANPS: machine learning based server for identification of anti-nutritional proteins in plants.

Anti-nutrient factors are inherently present in almost all major crops, which impede the absorption of crucial vitamins and minerals upon human consumption. The commonly found anti-nutrients in food crops are saponins, tannins, lectins, and phytates etc. Currently, there is a lack of computational server for identification of proteins that encode for anti-nutritional factors in plants. Consequently, this study represents a computational approach aimed at distinguishing between proteins encoding anti-nutritional factors and those providing essential nutrients. In this work, machine learning algorithms have been employed to identify plant specific anti-nutrient factor proteins from protein sequences by using compositional features. Achieving a five-fold cross-validation training performance of 94.34% AUC-ROC and 94.13% AUC-PR with extreme gradient boosting surpasses the performance of other methods such as support vector machine, random forest, and adaptive boosting. These results suggest the proposed approach is highly reliable in predicting plant-specific anti-nutritional factor proteins. The resulting prediction models have led to the development of an online server named ANPS, freely available at https://nipb-bi.icar.gov.in .

Genetic variability, heritability, and genetic advance estimates in selected groundnut genotypes (&lt;i&gt;Arachis hypogaea&lt;/i&gt; L.) for agro-morphological and yield traits.

Groundnuts (Arachis hypogaea L.), is a crucial food and oil crop in the tropics, require genetic variability assessment for efficient breeding programs using appropriate parameters like genetic coefficient of variation, heritability estimates, association among yield related traits and genetic advance. This study aims to identify genotypes with desirable traits to improve yield and adaptability, contributing to better crop improvement strategies. The study used a randomized complete block design with three replications, consisting of fourteen selected genotypes. Quantitative traits were used to estimate genetic variability parameters, heritability, and genetic advance. The analysis of variance revealed significant differences (p &lt; 0.005) for all studied traits, indicating greater variability in genotypes. Characters exhibited different levels of variability, heritability, and genetic advance among the genotypes. The estimate of the broad-sense heritability ranged from 13.33% to 33.33% for canopy spread and days to maturity respectively. Low to high phenotypic coefficient of variation (PCV) and genotypic coefficient of variation (GCV) were recorded. The study found that traits such as number of branches, pods per plant, fresh and dry plant weight, kernel yield, pod yield, and shelling percentage showed high genotypic coefficient of variation, moderate broad sense heritability, and high genetic advance. These traits can be beneficial for groundnut improvement through effective phenotypic selection, resulting in high expected genetic gain. The study found that pod yield is significantly correlated with kernel yield, grain length, grain width, 100-seed weight, fresh and dry 100-pod weight, and number of pods per plant. Kernel yield is positively correlated with the number of branches per plant, pod per plant, fresh and dry 100-pod weight, 100-seed weight, grain length, and grain width. In addition, the first four principal components accounted for 90.37% of total variation in all morphological traits.