Foliar Symptoms Research Articles

Integration of Host Resistance, Seed Treatment, and Seeding Rate for Management of Sudden Death Syndrome, a Disease of Soybean Caused by Fusarium virguliforme

Field experiments were conducted in Illinois, Indiana, Iowa, Michigan, and Wisconsin, United States, and Ontario, Canada, in 2019 and 2020 to evaluate the integrated effects of host resistance, seed treatment, and seeding rates on root rot (RR) and foliar symptoms of sudden death syndrome (foliar disease index [FDX]) and soybean yield. Seed treatments included a nontreated control and fluopyram in 2019. In 2020, commercial base treatment, base + fluopyram, and base + pydiflumetofen were tested. The base treatment included metalaxyl + pyraclostrobin + fluxapyroxad + clothianidin. The 2019 nontreated control and the 2020 base treatment were considered controls in the analysis because previous studies showed that base treatments do not provide control for sudden death syndrome. The seed treatments were tested on susceptible and moderately resistant (MR) cultivars, which were planted at three seeding rates: 272,277, 346,535, and 420,792 seeds/ha. To mitigate concern that disease pressure may impact treatment, three high disease pressure (>20% FDX) site-years out of the 15 total site-years were grouped and analyzed separately. Seed treatment with fluopyram or pydiflumetofen both reduced FDX and protected yield. Fluopyram reduced RR by about 10%, but RR was not different between pydiflumetofen and the base treatment in 2020. Both seed treatments reduced FDX, but reduction was greater for fluopyram (43.2%) than for pydiflumetofen (24.3%) based on 2020 results. Seeding rate had no effect on foliar symptoms, but the highest seeding rate showed increased RR in 2019 and greater yield both years. Performance of MR cultivars was inconsistent across both years. In 2019, MR cultivars reduced RR by 8.9%; however, in 2020, the MR cultivar had more RR than the susceptible cultivar. Additionally, FDX was only reduced in the MR cultivar in 2020. Although host resistance and seeding rate did not individually impact disease development and yield in every site-year, we showed that integrating seed treatment, host resistance, and adequate seeding rates helped maximize yield in fields with sudden death syndrome.

First Report of Mosaic Disease of Crape Myrtle Caused by Watermelon Mosaic Virus in Jiangsu Province in China

The crape myrtle ( Lagerstroemia indica) is a deciduous shrub that has become a popular landscape tree on public and private properties. However, crape myrtle is constantly subjected to multiple pathogen attacks, which severely affect the yield and quality and cause economic losses. In June 2019, foliar virus-like symptoms of chlorosis and mosaic were observed on crape myrtle in Yangzhou city, Jiangsu Province, East China. Leaf samples were collected from symptomatic plants. All samples were assayed by western blotting using a polyclonal antiserum to cucumber mosaic virus (CMV) and tobacco mosaic virus (TMV) and a double-antibody sandwich-ELISA assay for watermelon mosaic virus (WMV). The results revealed that all samples reacted positively with the WMV but negatively with CMV and TMV. RT-PCR was employed to confirm the obtained serological results. An amplicon of 288 bp was obtained from all the samples. Nucleotide BLAST analysis revealed that the sequence had 98.25 to 100% nucleotide identity to eight WMV isolate sequences available in GenBank. A pathogenicity assay was conducted using virus-free Nicotiana benthamiana seedlings inoculated with sap extracted from symptomatic crape myrtle leaves. Systemic infection of WMV was also confirmed in N. benthamiana by RT-PCR. On the basis of the data from serological and molecular analyses, the virus was identified as WMV. To our knowledge, this is the first report of WMV on crape myrtle in Jiangsu Province in China.

Effects of Peganum harmala extracts and synthetic chemical fungicides on controlling early blight of tomato in the central shaanxi plain of China

Peganum harmala, also known as wild rue, is a perennial herbaceous plant that occurs in semi-arid parts of Asia, the coastal Mediterranean region, Mexico, and the southern United States. Extracts from P. harmala are toxic to aphids and mites, and also possess antifungal activity. P. harmala extracts and four systemic commercial fungicides were initially investigated for their in vitro toxicity to Alternaria solani, the fungal pathogen of early blight of tomato. The P. harmala extracts inhibited mycelial growth and conidial germination of A. solani, but inhibition was less than for the commercial fungicides prothioconazole and iprodione. Tests in a commercial greenhouse near Jingyang County, Shaanxi Province, China, during 2020, 2021, and 2022 compared efficacy of P. harmala, alone and in combination with commercial fungicides, for suppression of early blight on tomato cv. Provence. Three applications of iprodione or prothioconazole at 7- to 10-day intervals resulted in <10% incidence of foliar symptoms on naturally inoculated plants. When a spray of P. harmala extract + prothioconazole was followed at 15-day intervals by P. harmala extract + iprodione and P. harmala extract alone incidence of foliar symptoms remained <10%. These results indicate that alternating tank mixes of prothioconazole or iprodione with P. harmala, followed by the extract alone, can extend the interval between sprays by 7–10 days and reduce dependency on synthetic chemical pesticides for control of early blight in greenhouse-grown tomatoes.

Boeremia Exigua Leaf Spot: A New Emerging Threat to Gossypium hirsutum L. in Pakistan

Cotton is grown all over the world including Asian countries. Severe foliar disease symptoms were observed on cotton in fields from different districts of cotton zone of the province of Punjab, Pakistan. Infected plant leaves were sampled from various areas and processed for the isolation of the causal organism. Fungal isolates were identified morphologically. The conidia of the fungus were observed oblong to ellipsoid, hyaline, and aseptate, but occasionally 1-septate with dimensions ranging from 2.7 to 7.8 × 1.6 to 3.5 μm. A total of two isolates were characterized further for genetic diversity. Both the isolates showed moderate reactions to the NaOH test for E metabolite. The pathogen was morphologically identified as Boeremia exigua. Further, the internal transcribed spacer region (ITS) and TUB gene of the fungal isolates were amplified and analyzed. The sequence of partial ITS and TUB showed 99% homology with the isolates of B. exigua. The pathogenicity test was performed on three months old cotton plants by using two isolates of B. exigua. After 15 days of inoculation, necrotic spots started developing on the leaves that were very similar to those observed in the field. The fungal pathogen was re-isolated from the leaves of all the inoculated plants, identified morphologically following Koch's postulates. This disease might be a potential threat to cotton production in Pakistan in the future. However, further studies are required to know the virulence, behavior, alternate hosts, and spreading nature of the pathogen.

First report of black pepper (Piper nigrum L.) anthracnose caused by Colletotrichum siamense in north-east India.

Black pepper (Piper nigrum L.) has been commonly cultivated as a spice crop in northeast India. In August 2021, anthracnose leaf spot was observed on black pepper vines with 50 to 60% of disease incidence in Assam Agricultural University, Jorhat (26.7509° N, 94.2037° E), Assam, India. On average, 80% of the leaves per individual vine were affected by this disease. Foliar symptoms initially appeared as chlorotic circular spots, which then coalesced into larger irregular lesions. The centers of the spots were brown, papery in texture, and surrounded by a yellow halo. Numerous acervuli at the center of the spots were observed. Ten vines from the orchard were sampled to identify the causal agent. Symptomatic leaves along with some healthy portion were cut (3 to 4.5 mm2), surface-sterilized in 70% ethanol for 30 s, rinsed in sterile distilled water twice, dried on sterilized filter paper, aseptically plated on potato dextrose agar (PDA) amended with Streptomycin sulphate (30 mg/L), and then incubated at 25°C for four days. Two Colletotrichum isolates were recovered from infected tissues and purified by the hyphal tip method. Fungal colonies on PDA were cottony, dense, white to gray in color, and with salmon pink conidial masses. Conidia (n = 50) were 13.6 to 19.8 × 4.2 to 6.4 μm, cylindrical, hyaline, single-celled, smooth-walled, and with rounded ends. Conidiophores were aseptate, hyaline, short and branched. Based on morphological features, the isolates were identified in the Colletotrichum gloeosporioides species complex (Weir et al. 2012). For accurate identification of two isolates, the DNA was extracted from pure culture. The internal transcribed spacer (ITS) region, actin (ACT), β-tubulin 2 (TUB2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were amplified by polymerase chain reaction (Weir et al. 2012) and sequenced. The sequences were deposited in the GenBank database (ITS: OP297054 and OP296876; ACT: OP327082 and OP327081; TUB2; OP327086 and OP327085; GAPDH: OP327084 and OP327083). A BLAST analysis of ITS, ACT, TUB2 and GAPDH sequences revealed 99.5-100%, 99.9-100%, 99.9-100% and 99.8-100% similarity respectively to C. siamense for both isolates in NCBI database. The pathogenicity tests were carried out on potted four months old vine cuttings of P. nigrum L., which were kept in a greenhouse. Ten healthy plants were sprayed with 50 µl of conidial suspension of each isolate (107 conidia ml-1, 10 ml/plant). Five control plants were sprayed with sterile distilled water. The plants were covered with sterilized plastic bags after inoculation to maintain humidity and kept in a greenhouse at day/night temperatures of 25 ± 2°C and 17 ± 2°C (Zhang et al., 2021). Within eight days, all the inoculated plants showed symptoms similar to those observed in the field, whereas control plants were asymptomatic. The pathogenicity test was repeated twice. C. siamense was consistently reisolated from the lesions and was confirmed by morphological characterization and molecular assays as described above in this note, whereas no fungus was isolated from control leaves. To our knowledge this is the first report of C. siamense causing black pepper anthracnose in northeast India. The pathogen has significant potential for causing high losses in black pepper production. These data will help researchers to develop effective management strategies for this disease.

Interactions of the Fungal Community in the Complex Patho-System of Esca, a Grapevine Trunk Disease.

Worldwide, Esca is a complex and devastating Grapevine Trunk Disease (GTD), characterized by inconstant foliar symptoms and internal wood degradation. A large range of fungal taxa have been reported as causal agents. We applied both culture-dependent and culture-independent methods (Illumina Technology and q-PCR) to investigate this concerning disease. Woods from vines with asymptomatic leaves and vines with leaf Esca symptoms were compared. Internally, different types of wood were found, from healthy wood with black necrosis to wood with white rot. A combination of leaf and wood Esca symptoms resulted in four experimental categories. Although there was no relation with symptoms, culture-independent mycobiome composition revealed Phaeomoniella chlamydospora, a GTD pathogen, as the most abundant species (detected in 85.4% of wood samples, with 14.8% relative abundance). Using TaqMan q-PCR, P. chlamydospora DNA was detected in 60.4% of samples (far from the 18.8% of positive results in the culture-dependent approach). There was a predominance of saprotrophs, even if their abundance was not affected by Esca symptoms. Concerning pathotrophs, the white rot development within grapevines was linked to the abundance of fungi belonging to the Hymenochaetaceae family. The Botryosphaeriaceae family was identified as an indicator for expression of Esca foliar symptoms. Lastly, the Aureobasidiaceae family was found to be a potential biocontrol agent for Esca, since it was most abundant in the control asymptomatic plants.

Recovery after curettage of grapevines with esca leaf symptoms

Grapevine curettage was re-introduced in France in the early 2000s, and is important for facilitating recovery of plants from esca disease. This surgical practice involves removal of deadwood of vines with leaf symptoms, focusing on white rot generally observed at the centres of grapevine trunks. Assessment of the efficacy of this practice was initiated in the Bordeaux region in 2014. One ‘Sauvignon Blanc’ vineyard severely affected by esca was initially surveyed in the summer of 2014, to identify and treat vines with esca foliar symptoms. Annually thereafter, from 2014 to 2018, selected vine stocks were curetted. Two other ‘Sauvignon Blanc’ vineyards also displaying high levels of esca damage were added to the study in 2015 and 2016. Curettage treatments ceased in 2018, resulting in 11 trials (vineyard × year combinations). In total, 856 vines (422 curetted and 434 control vines) were then surveyed annually up to 2021, for assessments and comparisons of esca development. At each site, plants with esca symptoms recovered well after curettage: on average 85% of all curetted vines became asymptomatic the year immediately after the treatment. Six years after treatment, for curettage campaigns carried out in 2014 and 2015, more than half of the curetted vines were symptom-free, whereas &lt;12% of the control vines were asymptomatic, and gradual loss of efficacy was observed at each site. The mean annual proportion of efficacy erosion was approx. 8% per year. This study highlights the possible short- and mid-term benefits of trunk surgery to enable recovery of esca-affected vines, and for them to recover and remain leaf-asymptomatic for several years.

First report of root and crown rot caused by Armillaria gallica on Cannabis sativa in California, U.S.A.

In October 2018, symptoms of leaf necrosis, wilted shoots, and stunted growth were observed on the upper portion of the 7-month-old cannabis (Cannabis sativa L.) plants in Mendocino County, California, U.S.A. Foliar symptoms were followed by a rapid death of the plants within 24 hours. Out of 200 affected plants, 80% (160/200) were symptomatic. All affected plants were grown in non-woven polypropylene containers (Smart pots, Oklahoma, USA) set directly on the ground approximately 3 m apart outdoors, surrounded by native forest (Quercus spp., Pseudotsuga menzeisii). Closer examination of the C. sativa plants revealed diagnostic signs of Armillaria root disease: white mycelial fans at the base of the woody stem (root collar) and abundant rhizomorphs on the roots and root collar (Supplementary Fig 1A). Also, both woody roots and the root collar exhibited severely rotted wood. Rotted wood, mycelial fans, and rhizomorphs (n=20) were surface sterilized with 0.6% sodium hypochlorite, rinsed with sterile water, and plated on PDA amended with tetracycline (1 mg/L). Sixteen cultures with morphological characters of Armillaria sp. (regular colony margin, no spore structures, no clamp connections) were recovered (Baumgartner et al., 2011). Species identity was confirmed by sequencing the internal transcribed spacer (ITS) region of rDNA and the translation elongation factor subunit 1-alpha (TEF1a) loci (White et al. 1990, Baumgartner et al 2010). Sequences (GenBank nos. MT248417 and MT259788) were compared with those in the NCBI GenBank database using a BLAST search, revealing 876/881bp matching with Armillaria gallica ITS sequence, GenBank no KP960553, and 146/150bp matching with TEF1a sequence from a North America A. gallica isolate, GenBank no. JF895844 (Brazee et al., 2011). Pathogenicity tests were conducted twice using two A. gallica isolates (15389-1 and 15389-2) by inoculating sterile, 1-month old, rooted tissue-cultured cannabis plants of 'Wedding Cake' with 7.5 ml of homogenized A. gallica liquid inoculum (Baumgartner et al., 2010), added aseptically to the surface of the vermiculite, near the plant stem (Ford et al., 2017). Eight plants were inoculated and two (using sterile water instead of inoculum) were used as negative controls. Plants were incubated at 21-26 °C under 40 to 80 μmol·m-2·s-1 from full spectrum light source with an 18/6 photoperiod to support vegetative growth. Plants were watered with 25 ml sterile nutrient solution (Cutting Edge Solutions, Santa Rosa, CA, U.S.A.) at 1 to 2-week intervals, according to the plant's need. At eight weeks post inoculation, all eight inoculated plants showed symptoms of yellowing and wilting. Uptake of the nutrient solution and water had also stopped by this time. The two non-inoculated plants, however, remained healthy throughout the 8-week period (Supplementary Fig 1B). At the end of the experiment, samples were taken aseptically from the crowns and roots of each plant and plated on water agar amended with streptomycin (100 μg/ml) and benomyl (4 μg/ml). Hyphae were subcultured to 0.5X PDA to confirm species identity through ITS and TEF1a. A. gallica was reisolated from affected crowns and stems. This is the first report of A. gallica causing root and crown rot of C. sativa. Considering the expanding cultivation area of Cannabis crops due to legalization of the industry in many U.S. states, A. gallica root and crown rot may become a serious issue affecting the industry, even for plants maintained in non-woven polypropylene containers in direct contact with soil.

First report of Grapevine Algerian latent virus in carnation in New Zealand.

Carnation (Dianthus caryophyllus) is a popular ornamental plant widely used as a cut flower and in landscaping. In New Zealand, several viruses are known to infect plants of the genus Dianthus: arabis mosaic virus, carnation etched ring virus (CERV), carnation latent virus, carnation mottle virus, carnation necrotic fleck virus, carnation ringspot virus, carnation vein mottle virus and cucumber mosaic virus (Veerakone et al. 2015). In October 2020, a carnation sample with leaf chlorotic spots and distortion from a home garden in Auckland, New Zealand was submitted to the Plant Health and Environment Laboratory (PHEL) for virus testing. Leaf tissue of the sample was mechanically inoculated onto a range of herbaceous species using the method described in Tang et al. (2013). Chenopodium amaranticolor and C. quinoa plants developed local necrotic pinpoint spots while Nicotiana benthamiana, N. clevelandii, and N. occidentalis plants exhibited systemic leaf mosaic symptoms 7 days post-inoculation. The carnation plant and all five symptomatic indicator species tested positive for tombusviruses using an in-house designed generic RT-qPCR (available on request). Direct sequencing of the ~140 bp PCR product revealed the presence of grapevine Algerian latent virus (GALV). To further characterise the detected sequence, forward (5'-GTAGCGATGTATTGGGATAAGGA-3') and reverse (5'-TGCCGACACCCCGAAAGGT-3') primers were designed based on an alignment of the conserved region in the coat protein (CP) of 19 GALV isolates deposited in GenBank. Products of the expected size of 406 bp were amplified from all infected plants and their sequences found to be identical (GenBank accession No. OM891837). BLAST searches showed that the CP region of the sequence shared 97.0% (nucleotide) and 97.8% (amino acid) identity to the type isolate of GALV (GenBank accession no. NC_011535). GALV was first reported in Italy from a symptomless Algerian grapevine (Vitis vinifera) (Gallitelli et al., 1989), and is the only report of GALV in Vitis in the world. Since then, GALV has been reported in Germany, the Netherlands and Japan in several ornamental plant species including Alstroemeria sp. (Tomitaka et al., 2016), Gypsophila paniculata, Limonium sinuatum (Koenig et al., 2004, Fujinaga et al., 2009) and Solanum mammosum (Ohki et al., 2006). These infected ornamental host plants were reported to show various types of foliar symptoms, including chlorotic leaf spots. The GALV-infected carnation plant in this study was tested by PCR for all viruses that are known to infect D. caryophyllus in New Zealand, and CERV was identified. It is therefore unclear if the observed symptoms were induced by either GALV or CERV, or if they were the results of a synergistic interaction between GALV and CERV. Samples from a further 11 plants, comprised of nine symptomatic Dianthus spp. and two asymptomatic Alstroemeria spp. were collected from the same address and tested individually using the GALV-specific RT-PCR. GALV (along with CERV) was detected from all Dianthus plants while the Alstroemeria samples were negative. To our knowledge, this is the first report of GALV in New Zealand, and the first report in the host Dianthus in the world. Given the GALV-infected carnation plants were purchased from a local garden centre between 2007-2020, and plants from this garden centre have been widely distributed over this period of time to various customers, the virus is very likely to have spread throughout the country.

Epidemiological Analysis of Cassava Mosaic and Brown Streak Diseases, and Bemisia tabaci in the Comoros Islands.

A comprehensive assessment of cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) was carried out in Comoros where cassava yield (5.7 t/ha) is significantly below the African average (8.6 t/ha) largely due to virus diseases. Observations from 66 sites across the Comoros Islands of Mwali, Ngazidja, and Ndzwani revealed that 83.3% of cassava fields had foliar symptoms of CBSD compared with 95.5% for CMD. Molecular diagnostics confirmed the presence of both cassava brown streak ipomoviruses (CBSIs) and cassava mosaic begomoviruses (CMBs). Although real-time RT-PCR only detected the presence of one CBSI species (Cassava brown streak virus, CBSV) the second species (Ugandan cassava brown streak virus, UCBSV) was identified using next-generation high-throughput sequencing. Both PCR and HTS detected the presence of East African cassava mosaic virus (EACMV). African cassava mosaic virus was not detected in any of the samples. Four whitefly species were identified from a sample of 131 specimens: Bemisia tabaci, B. afer, Aleurodicus dispersus, and Paraleyrodes bondari. Cassava B. tabaci comprised two mitotypes: SSA1-SG2 (89%) and SSA1-SG3 (11%). KASP SNP genotyping categorized 82% of cassava B. tabaci as haplogroup SSA-ESA. This knowledge will provide an important base for developing and deploying effective management strategies for cassava viruses and their vectors.

STUDIES ON PHYSIOLOGICAL AND METABOLIC RESPONSES IN HORSE GRAM (DOLICHOS BIFLORUS L.) INDUCED BY CHROMIUM

&#x0D; &#x0D; &#x0D; The current investigation looks on the phyto-toxicity and accumulation of chromium (VI) in Horse gram (Dolichos biflorus L.). Horse gram plants were subjected to chromium (VI) concentrations of (0.00, 0.05, 0.10, 0.20, 0.25, and 0.30 mg/L) at various concentration levels. At higher chromium (0.30 mg/L) concentrations, the foliar toxic symptoms of older leaves included loss of turgor and chlorosis, which eventually manifested as chlorosis in middle-aged leaves after Crizotinib therapy for five days (VI). Chlorosis signs became more significant and twisted to cytotoxicity in places with tapering membrane, slender strands, or weak folding qualities later in the stage, which were characterized by tapering lamellae, thin lenticels, and weak knotting property. On horse bean, Cr (VI) toxic effects has been discovered as reduced crop production, photosynthetic capacity, physiological as well as molecular action, and metabolic dysfunction are all negatively impacted. Iron uptake and accumulation in leaves were reduced by Cr (VI) (0.30 mL/L) in comparison to the control (From 15.60 to 4.35 grammes per kilogramme of dry weight), while boosting sulphur and phosphorous uptake and deposition. When the plants were subjected to the pretreatment for 29 days, the leaves accumulated the greatest amount of Cr (92.12 grammes per kilogramme of dry weight to 10.08 grammes per kilogramme of dry weight), followed by the roots (96.50 grammes per kilogramme of dry weight to 30.20 grammes per kilogramme of dry weight). When consumed in large quantities, the toxic Cr buildup and nutritional deficits that result from the intake of Cr- containing horse gramme can be hazardous to population health, according to the World Health.&#x0D; &#x0D; &#x0D;

Curvularia verruculosa as new causal pathogen of common bean leaf spot disease in China

Common bean is extensively grown and consumed worldwide and it is considered a nutraceutical food and an important source of protein. Leaf spot is one of the most devastating diseases of common bean in tropical and subtropical production areas. In May 2021, this destructive disease was observed in the Guizhou Province of China and resulted in serious economic losses for local agricultural production. Foliar symptoms appeared as small circular tan-colored spots, which then turned dark brown and coalesced into irregular water-soaked necrotic lesions, often leading to leaf wilt or abscission. Fungal isolates were obtained from symptomatic common bean plants and a detailed morphological analysis was performed. Concatenated phylogenetic reconstruction was conducted by amplifying and sequencing the internal transcribed spacer (ITS) region, glyceraldehyde-3-phosphate dehydrogenase (gapdh) and translation elongation factor 1-alpha (tef1-α) genes. Based on morphological characters and phylogenetic analyses, the pathogen was identified as Curvularia verruculosa. In addition, the pathogenicity tests of the isolates reproduced the same symptoms as those observed in the field, and Koch's postulates were confirmed by pathogen re-isolation and identification. To our knowledge, this is the first report of C. verruculosa causing leaf spot on common bean in the world. The current study can provide a foundation for developing effective management strategies, and reducing economic losses in common bean production.

Time of Soybean Sudden Death Syndrome Foliar Symptom Onset Influences Final Disease Intensity, Yield, and Yield Components.

Sudden death syndrome (SDS), caused by Fusarium virguliforme, causes substantial yield losses in soybean. However, relationships between soybean yield and components of disease progress, including time of disease onset, are poorly understood. Individual soybean plants (2018) and quadrats (2016 to 2018) were monitored in commercial fields and experimental plots in Iowa to quantify the impact of SDS foliar symptom onset on final SDS intensity, soybean yield components, and yield. The date when SDS foliar symptoms were first detected (onset time) and progress of SDS incidence and severity were recorded weekly. Individual soybean plants and quadrats were harvested at the end of each season. Beta-regression showed that date of SDS onset had a consistent and stable effect on final disease intensity both at individual plant and quadrat levels. The slope of the relationship between date of SDS onset and final SDS severity was common across all field sites and years. Weighted linear regression revealed that SDS onset explained 60 to 83% of the variation in number of pods, number of seeds, and total seed weight in individual plants, and 94 to 97% of the variation in seed yield in quadrats. Soybean yield damage functions (slopes) indicated that for each day SDS onset was delayed, soybean yield increased by 30.5 to 31.3 kg/ha. This new quantitative information improves understanding of the impact of SDS on final disease intensity and soybean yield. Further experiments are needed to determine how this relationship is affected by site-specific factors.

Leaf trait plasticity and site-specific environmental variability modulate the severity of visible foliar ozone symptoms in Viburnum lantana.

The assessment of Visible Foliar Symptoms (VFS) is commonly adopted by forest monitoring programs to evaluate ozone impact on vegetation. The occurrence of ozone VFS may differ among individuals of the same species at the same site, and within leaves of the same individual. The aim of this study was to identify site and plant characteristics as well as functional leaf traits associated with the occurrence and severity of VFS in Viburnum lantana (an ozone-sensitive species) and at the scale of an individual site. V. lantana plants growing at one site of the ViburNeT monitoring network (Trentino, North Italy) experiencing high ozone levels were surveyed in relation to 1) sun exposure, 2) shading effect from neighbor vegetation, 3) plant height and 4) presence and severity of VFS. Leaves from three different sections of each plant were subjected to a phenotypic characterization of leaf area, dry weight, specific leaf area (SLA), chlorophyll content (ChlSPAD), percentage of VFS, and adaxial and abaxial trichome density (Tr). We showed that plants at high irradiation levels had significantly lower SLA (p<0.05), higher Tr (p<0.01) and greater ChlSPAD (p<0.01) when compared to shaded and/or west- and north-exposed plants, thus indicating a strong influence of site-specific characteristics on leaf trait plasticity. Similar differences were observed for taller vs. shorter plants and apical vs. basal branches (p<0.05). Ozone-induced VFS at leaf level were associated with lower SLA (p<0.001) and higher Tr in the abaxial leaf surface (p<0.05). Both leaf traits showed significant differences also within the south and east exposed plant category, thus suggesting the increase in leaf thickness and Tr as a potential adaptive strategy under multiple stress conditions. Our results provide evidence of a strong relationship between VFS, leaf traits and site-specific variables, offering new insights for interpreting data on the impact of ozone on vegetation.

Evaluation of plant elicitation with methyl-jasmonate, salicylic acid and benzo (1,2,3)-thiadiazole-7-carbothioic acid-S-methyl ester for the sustainable management of the pine wilt disease.

Treatment with plant elicitors can be a promising method to induce Pinus pinaster tolerance against the pinewood nematode (PWN), Bursaphelenchus xylophilus, by promoting plant antioxidant system, micronutrient accumulation and by modulating plant-associated bacterial populations. To test this hypothesis, plants were sprayed with methyl jasmonate (MeJA), salicylic acid (SA) or benzo (1,2,3)-thiadiazole-7-carbothioic acid-S-methyl ester (BTH), and evaluated until 35days after-inoculation (dai) for: i) extent of foliar symptoms; ii) nematode density inside stem tissues; iii) proxies for oxidative damage and antioxidant activity, iv) micronutrient concentration and v) bacterial diversity. Compared with non-elicited plants, plant elicitation, particularly with BTH, significantly decreased nematodes density inside stem tissues (by 0.63-fold). Concordantly, without elicitation plant mortality reached 12.5% while no mortality was observed in elicited plants. BTH-elicited plants had significantly higher concentrations of anthocyanins and carotenoids at the end of the assay than SA-elicited and MeJA-elicited plants, which possibly contributed to the lower PWN colonization and degree of foliar symptoms observed. Accordingly, MeJA and SA led to increased lipid peroxidation at 28 dai (by 2.64- and 2.52-fold, respectively) in comparison with BTH (by 1.10-fold), corroborating its higher potential in increasing plant antioxidative response during infection. Moreover, carotenoids showed a negative correlation with nematode migration, whereas polyphenols showed a positive correlation. Elicitors also induced changes in the bacterial community of infected P. pinaster plants, increasing the diversity of specific populations. Finally, elicitors induced significant changes in micronutrients accumulation in plant tissues, namely a decrease in the concentration of B, Mn and Ni in plants treated with BTH compared to those treated with the other elicitors. Altogether, results suggest that elicitation with MeJA, SA and, particularly, BTH, increases tolerance against B. xylophilus by promoting plant antioxidant system, changing the accumulation of essential micronutrients and modulating plant-associated bacterial diversity.

Risk factors associated with cassava brown streak disease dissemination through seed pathways in Eastern D.R. Congo.

Vegetatively propagated crops are particularly prone to disease dissemination through their seed systems. Strict phytosanitary measures are important to limit the impact of diseases as illustrated by the potato seed system in Europe. Cassava brown streak disease (CBSD) is a devastating disease caused by two viral species collectively named cassava brown streak viruses (CBSVs). CBSD can cause substantial root yield losses of up to 100% in the worst affected areas and is easily transmitted through stem cuttings. In Eastern and Central Africa, the epidemiology of CBSVs in the local socio-economical context of production remains poorly known while a better understanding would be an asset to properly manage the disease. This lack of information explains partially the limited efficiency of current regulatory schemes in increasing the availability of quality seed to smallholders and mitigating the spread of pests and diseases. This study surveyed the epidemiology of CBSVs in Uvira territory, Eastern D.R. Congo, and its drivers using a multivariate approach combining farmer’s interview, field observation, sampling and molecular detection of CBSVs. Investigation on the epidemiology of CBSD revealed that three clusters in the study area could be identified using five most significant factors: (i) symptoms incidence, (ii) number of whiteflies, (iii) types of foliar symptoms, (iv) cutting’s pathways and (v) plant age. Among the three clusters identified, one proved to be potentially interesting for seed multiplication activities since the disease pressure was the lowest. Through risk assessment, we also identified several key socio-economic determinants on disease epidemy: (i) factors related to farmer’s knowledge and awareness (knowledge of cassava pests and diseases, knowledge of management practices, support from extension services and management strategies applied), (ii) factors related to the geographical location of farmer’s fields (proximity to borders, proximity to town, distance to acquire cuttings), as well as (iii) the pathways used to acquire cuttings.

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

Ozone stress responsive gene database (OSRGD ver. 1.1): A literature curated database for insight into plants' response to ozone stress

Ozone (O3) is a major abiotic stress which severely affects the growth and development of plants. In order to cope up with ozone stress, plants exhibit a plethora of morphological, physiological and molecular changes. Various molecular studies have been performed and a variety of genes exhibiting expression in response to ozone stress have been identified. However, no existing database has been designed yet to present information on ozone stress responsive genes differentially expressed across different plant species. The lack of a curated database limits the research potential in the area and therefore a cohesive database should be designed as a data repository of the ozone responsive genes. OSRGD ver. 1.1 is a user-friendly web interface to explore ozone stress specific transcriptomic and microarray dataset of different plant species. It allows users to retrieve the ozone stress responsive gene data by keyword-based search. Each entry upon keyword query contains detailed information about the specific species, its foliar injury symptoms, pattern of gene expression, and platform used for gene expression analysis with reference literature. This comprehensive bio-curation will offer researchers a better biological insight into plants' response to ozone stress which will focus on development of climate smart crops through crop breeding. The web interface is freely accessible at http://www.osrgd.com.

Grapevine Leafroll-Associated Virus 3 Genotype Influences Foliar Symptom Development in New Zealand Vineyards.

Grapevine leafroll disease (GLD) constrains wine production worldwide. In New Zealand, the main causal agent of GLD is grapevine leafroll-associated virus 3 (GLRaV-3). To control GLD, an integrated management program is used and includes removing (roguing) GLRaV-3-infected vines from the vineyard. The classical foliar symptoms from virus-infected red-berry cultivars are leaves with dark red intervein, green veins, and downward rolling of margins. Growers use these phenotypic cues to undertake visual symptom identification (VSI) for GLD. However, the influence of the known large genetic variation among GLRaV-3 isolates on the foliar symptoms from different grapevine cultivars remains undescribed, especially in cool-climate growing environments, such as New Zealand. Over three vintages (2015, 2016, and 2017), VSI for GLD was undertaken at three field sites in New Zealand (Auckland, Hawke’s Bay, and Marlborough), each including four cultivars (Merlot, Pinot noir, Sauvignon blanc, and Pinot gris) infected with three GLRaV-3 genotypes (Groups I, VI, and X) or GLRaV-3-uninfected control plants. Throughout this study, no visual symptoms were observed on white-berry cultivars infected with GLRaV-3. For red-berry cultivars, the greatest variability in observed foliar symptoms among regional study sites, cultivars, and GLRaV-3 genotypes was observed early in the growing season. In particular, Group X had significantly delayed symptom expression across all three sites compared with Groups I and VI. As the newly infected, young vines matured in years 2 and 3, the GLRaV-3 genotype, cultivar, region, and environmental conditions had minimal influence on the accuracy of VSI, with consistently high (>95%) within-vintage identification by the end of each vintage. The results from this study strongly support the use of VSI for the GLD management of red-berry cultivar grapevines, Merlot and Pinot noir, as a reliable and cost-effective tool against GLD.

First Report of Curvularia Leaf Spot of Field Corn, Caused by Curvularia lunata, in Mississippi.

In July 2021, foliar symptoms characterized by small, circular, light brown to tan lesions (0.5 to 3 mm diameter) with reddish-brown margins were observed on field corn (Zea mays L.) in two commercial fields in Hinds and Marion counties, Mississippi. Disease severity ranged from 2 to 15% on observed leaves. Symptomatic leaves were sealed in plastic bags, stored on ice, and transferred to the laboratory. Lesions were cut into small sections (≈4 mm2) and surface-sterilized with 70% ethanol for 30 s then rinsed with sterile water. Sterilized sections were transferred to potato dextrose agar (PDA) amended with chloramphenicol (75 mg/liter) and streptomycin sulfate (125 mg/liter) and incubated at 25°C in the dark for 7 days. Gray to brown-black colonies with orange margins and melanized, curved conidia with three transverse septa were observed microscopically (Fig. 1; ×400). Conidia measurements ranged from 15 to 25 μm in length and 7.5 to 12.5 μm in width (x̄= 20 × 9.8 μm; n= 44). Colony and conidia morphology were consistent with previous descriptions of Curvularia lunata (Wakker) Boedijn (Mabadeje 1969; Ellis 1971). Pure cultures were obtained, and DNA was extracted from 9-day old cultures. Two isolates (TW003-21; TW008-21) were selected for sequencing of the internal transcribed spacer (ITS) region using ITS4 and ITS5 primers. The 530-bp consensus sequences were deposited in GenBank under the accession No. OK095277 and OK095278. BLASTn queries of NCBI GenBank showed that the sequences shared 100% identity with C. lunata isolate DMCC2087 from Louisiana (MG971304) and isolate CX-3 from China (KR633084). A pathogenicity test was performed on V4/V5 stage corn plants (Progeny 9114VT2P) grown in 10.2 cm pots in the greenhouse. Plants were transferred to a growth chamber one-week prior to inoculation. The two isolates were grown on amended PDA for 14 days at 25°C and an inoculum suspension was prepared for each isolate by rinsing culture plates with 2 ml of autoclaved reverse osmosis (RO) water amended with Tween 20 (0.01%) and re-suspended into 40 ml of RO water containing Tween 20. The final concentration was adjusted to 2.6×105 conidia/ml (TW003-21) and 2×105 conidia/ml (TW008-21). Ten corn plants were sprayed with 10 ml of inoculum suspension for each isolate using a Preval sprayer with a CO2 canister, and 10 plants were sprayed with water containing Tween 20 only. Plants were incubated in a growth chamber at ≈79% relative humidity and 25°C. Foliar symptoms including small, circular, and tan lesions, similar to those observed in the field, developed 3 days after inoculation. No symptoms were observed on control plants. Following incubation, symptomatic leaves were collected and C. lunata was re-isolated as described above. Colony, spore morphology and DNA sequences from inoculated plants were consistent with the original isolates as described above. The disease has been recently reported in Louisiana (Garcia-Aroca et al. 2018), Kentucky (Anderson et al. 2019), and Delaware (Henrickson et al. 2021). Although Curvularia leaf spot has been observed sporadically in MS corn fields since 2009 (Allen, personal communication), to our knowledge, this is the first official report of the disease in MS. While this disease has been more frequently encountered in MS, the economic impact associated with C. lunata is currently unknown. References Anderson, N. R., et al. 2019. Plant Dis. 103:2692. Chang, J., et al. 2020. J. Integr. Agr. 19:551-560. Ellis, M. B. 1971. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, England, p. 452-458. Garcia-Aroca T., et al. 2018. Plant Health Prog. 19:140. Henrickson M., et al. 2021. Plant Dis. First Look. Mabadeje, S. A. 1969. Trans. Br. Mycol. Soc. 52:267-271. † Indicates the corresponding author. E-mail: twilkerson@drec.msstate.edu.