Folding Behavior Research Articles

Conformational analysis of apolipoprotein E3/E4 heteromerization.

Apolipoprotein E (apoE) is a 299 residue, exchangeable apolipoprotein that has essential roles in cholesterol homeostasis and reverse cholesterol transport. It is a two-domain protein with the C-terminal (CT) domain mediating protein self-association via helix-helix interactions. In humans, the APOE gene is polymorphic with three common alleles, ε2, ε3, and ε4, occurring in frequencies of ~5%, 77%, and 18%, respectively. Heterozygotes expressing apoE3 and apoE4 isoforms, which differ in residue at position 112 in the N-terminal domain (C112 in apoE3 and R112 in apoE4), represent the highest population of ε4 carriers, an allele highly associated with Alzheimer's disease. The objective of this study was to determine if apoE3 and apoE4 have the ability to hybridize to form a heteromer in lipid-free state. Refolding an equimolar mixture of His-apoE3 and FLAG-apoE4 (or viceversa) followed by pull-down and immunoblotting indicated formation of apoE3/apoE4 heteromers. Förster resonance energy transfer between donor fluorophore on one isoform and acceptor on the other, both located in the respective CT domains, revealed a distance of separation of ~46Å between the donor/acceptor pair. Similarly, a quencher placed on one was able to mediate significant quenching of fluorescence emission on the other, indicative of spatial proximity within collisional distance between the two. ApoE3/apoE4 heteromer association was also noted in lipid-associated state in reconstituted lipoprotein particles. The possibility of heteromerization of apoE3/apoE4 bears implications in the potential mitigating role of apoE3 on the folding and physiological behavior of apoE4 and its role in maintaining cholesterol homeostasis.

Characterisation and Comparison of Process Chains for Producing Automotive Structural Parts from 7xxx Aluminium Sheets

Due to their high specific strength, EN AW-7xxx aluminium alloys are promising materials for reducing the weight of automotive structural parts. However, their formability at room temperature is poor due to pronounced natural ageing. Therefore, we investigated hot stamping and W-temper forming for EN AW-7075 and a modified variant of EN AW-7021. For hot stamping of the modified EN AW-7021, a low-temperature stabilisation heat treatment (pre-aging at 80 °C for 1 h) was incorporated into the process chain design to inhibit natural ageing after forming. The process chains were compared with respect to dimensional accuracy, mechanical properties, microstructure, precipitation status (assessed by differential scanning calorimetry) and crashworthiness. It was found that hot stamping is suitable to form failure-free parts with good dimensional accuracy for both alloys while W-temper forming suffers from springback. Within a time-span of 21 days after forming, hardness values of hot stamped and stabilised parts did not increase significantly. Compared to non-stabilised parts, stabilised parts also showed significantly improved folding behaviour in quasi-static compression testing and absorbed approximately 15% more energy.

Revealing solvent-dependent folding behavior of mycolic acids from Mycobacterium tuberculosis by advanced simulation analysis

Mycobacterium tuberculosis remains a persistent pathogen, partly due to its lipid rich cell wall, of which mycolic acids (MAs) are a major component. The fluidity and conformational flexibilities of different MAs in the bacterial cell wall significantly influence its properties, function, and observed pathogenicity; thus, a proper conformational description of different MAs in different environments (e.g., in vacuum, in solution, in monolayers) can inform about their potential role in the complex setup of the bacterial cell wall. Previously, we have shown that molecular dynamics (MD) simulations of MA folding in vacuo can be used to characterize MA conformers in seven groupings relating to bending at the functional groups (W, U and Z-conformations). Providing a new OPLS-based forcefield parameterization for the critical cyclopropyl group of MAs and extensive simulations in explicit solvents (TIP4P water, hexane), we now present a more complete picture of MA folding properties together with improved simulation analysis techniques. We show that the ‘WUZ’ distance-based analysis can be used to pinpoint conformers with hairpin bends at the functional groups, with these conformers constituting only a fraction of accessible conformations. Applying principle component analysis (PCA) and refinement using free energy landscapes (FELs), we are able to discriminate a complete and unique set of conformational preferences for representative alpha-, methoxy- and keto-MAs, with overall preference for folded conformations. A control backbone-MA without any mero-chain functional groups showed significantly less folding in the mero-chain, confirming the role of functionalization in directing folding. Keto-MA showed the highest percentage of WUZ-type conformations and, in particular, a tendency to fold at its alpha-methyl trans-cyclopropane group, in agreement with results from Villeneuve et al. MAs demonstrate similar folding in vacuum and water, with a majority of folded conformations around the W-conformation, although the molecules are more flexible in vacuum than in water. Exchange between conformations, with a disperse distribution that includes unfolded conformers, is common in hexane for all MAs, although with more organization for Keto-MA. Globular, folded conformations are newly defined and may be specifically relevant in biofilms.Graphical abstractThrough advanced simulation analysis, including principle component analysis and free energy landscapes, we reveal detailed physical insights into the solvent-dependant folding behavior of mycolic acids from M. tb.

Folding analysis for thin-walled deployable composite boom

Thin-walled deployable composite structures with high strain ability are of considerable interest and increasingly used in aerospace field due to their superior mechanical behaviour and folding function. This paper seeks to investigate large folding deformation behaviour of a thin-walled deployable composite boom (DCB) made of high strain carbon-fibre-reinforced-plastics fabricated by vacuum-bag and co-bonding technologies. Large deformation function tests are conducted to determine tensile, compression and folding behaviours of the DCB. Geometrically nonlinear, explicit and standard, finite element models and an analytical model are implemented to characterize the tensile and compression behaviours of the DCB, and the deviations of predictions from experiments are in an acceptable scatter. Furthermore, a geometrically nonlinear and explicit finite element model is also generated for folding analysis of the DCB, and a good correlation between predictions and experiments has been achieved.

Single-Molecule FRET Kinetics of the Mn2+ Riboswitch: Evidence for Allosteric Mg2+ Control of "Induced-Fit" vs "Conformational Selection" Folding Pathways.

Gene expression in bacteria is often regulated dynamically by conformational changes in a riboswitch upon ligand binding, a detailed understanding of which is very much in its infancy. For example, the manganese riboswitch is a widespread RNA motif that conformationally responds in regulating bacterial gene expression to micromolar levels of its eponymous ligand, Mn2+, but the mechanistic pathways are poorly understood. In this work, we quantitatively explore the dynamic folding behavior of the manganese riboswitch by single-molecule fluorescence resonance energy transfer spectroscopy as a function of cation/ligand conditions. From the detailed analysis of the kinetics, the Mn2+ is shown to fold the riboswitch by a "bind-then-fold" (i.e., "induced-fit", IF) mechanism, whereby the ligand binds first and then promotes folding. On the other hand, the data also clearly reveal the presence of a folded yet ligand-free structure predominating due to the addition of physiological Mg2+ to a nonselective metal ion binding site. Of particular kinetic interest, such a Mg2+ "prefolded" conformation of the riboswitch is shown to exhibit a significantly increased affinity for Mn2+ and further stabilization by subsequent binding of the ligand, thereby promoting efficient riboswitch folding by a "fold-then-bind" (i.e., "conformational selection", CS) mechanism. Our results not only demonstrate Mg2+-controlled switching between IF and CS riboswitch folding pathways but also suggest a novel heterotropic allosteric control in the manganese riboswitch activity co-regulated by Mg2+ binding.

Novel Pathogenic PRSS1 Variant p.Glu190Lys in a Case of Chronic Pancreatitis.

Mutations in the PRSS1 (serine protease 1) gene encoding human cationic trypsinogen cause hereditary pancreatitis or may be associated with sporadic chronic pancreatitis. The mutations exert their pathogenic effect either by increasing intra-pancreatic trypsinogen activation (trypsin pathway) or by causing proenzyme misfolding and endoplasmic reticulum stress (misfolding pathway). Here we report a novel heterozygous c.568G>A (p.Glu190Lys) variant identified in a case with chronic pancreatitis. The parents of the index patient had no history of pancreatitis but were unavailable for genetic testing. Functional characterization revealed 2.5-fold increased autoactivation of the mutant trypsinogen relative to wild type. Unlike many other clinically relevant PRSS1 mutations, p.Glu190Lys did not alter the chymotrypsin C (CTRC)-dependent degradation of trypsinogen nor did it increase CTRC-mediated processing of the trypsinogen activation peptide. Cellular secretion of the mutant protein was unchanged indicating normal folding behavior. Based on the genetic and functional evidence, we classify the p.Glu190Lys PRSS1 variant as likely pathogenic, which stimulates autoactivation of cationic trypsinogen independently of CTRC.

Studying the Folding Behavior of a 3D Lattice Protein under Oscillatory Conditions

By spontaneously and reliably folding from a primary amino acid sequence into a highly specific native geometry with bioactive functionalities, the natively-folded protein plays a significant role in fundamental biological processes. Protein folding is governed by the interactions between residues and between residues and the environment. The structural stability and bio-functionality of proteins depend on physiological environmental factors, such as temperature, acidity, crowding, and ionic strength. In addition, the local cellular environment is highly dynamic -- both spatially and temporally heterogeneous. In this work, we employed a 3D lattice protein model to investigate the changes to the equilibrium folded state properties and to the kinetics of folding pathways for small proteins that fold amidst ongoing temperature oscillations.

Exploiting scaling laws for designing polymeric bottle brushes: a theoretical coarse-graining for homopolymeric branched polymers.

Bottle brushes are polymeric macromolecules made of a linear polymeric backbone grafted with side chains. The choice of the grafting density σg, the length ns the grafted side chains and their chemical nature fully determines the properties of each macromolecule, such as its elasticity and its folding behaviour. Typically, experimental bottle brushes are systems made of tens of thousands of monomeric units, rendering a computational approach extremely expensive, especially in the case of bottle brush solutions. A proper coarse graining description of these macromolecules thus appears essential. We present here a theoretical approach able to develop a general, transferable and analytical multi-scale coarse graining of homopolymeric bottle brush polymers under good solvent conditions. Starting from scaling theories, each macromolecule is mapped onto a chain of tethered star polymers, whose effective potential is known from scaling predictions, computational and experimental validations and can be expressed as a function of the number of arms f, and the length na of each arm. Stars are then tethered to one another and the effective potential between them is shown to only depend on the key parameters of the original bottle brush polymer (σg, ns). The generalised form of the effective potential is then used to reproduce properties of the macromolecules obtained both with scaling theories and with simulations. The general form of the effective potentials derived in the current study allows a theoretical and computational description of the properties of homopolymeric bottle brush polymers for all grafting densities and all lengths of both backbone and grafted arms, opening the path for a manifold of applications.

Synthesis and folding behaviour of poly(p-phenylene vinylene)-based β-sheet polychromophores.

This contribution describes the design and synthesis of β-sheet-mimicking synthetic polymers comprising distinct poly(p-phenylene vinylene) (PPV) and poly(norbornene) (PNB) backbones with multiple turns. The rod-coil-coil-rod tetrablock copolymers, synthesized using ring-opening metathesis polymerization (ROMP) and featuring orthogonal face-to-face π-π stacking and phenyl/perfluorophenyl interactions, show persistent folding both in bulk and at the single molecule level, irrespective of the number of β-turns. Single molecule polarization studies reveal that the copolymers are more anisotropic than the corresponding homopolymers. Examination of the spectral signatures of the single molecules shows a dominant emissive chromophore in the linked materials compared to the homopolymer. The lack of significant spectral changes of the folded materials along with the existence of a dominant emission spectrum supports the proposed structure of well-aligned, minimally-interacting chromophores. Utilization of this reliably folding, phenyl/perfluorophenyl functionality could provide an extremely useful tool in future functional materials design.

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3′-terminal under the bottom G-quartet. The 3′-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

Bacterial expression, purification and biophysical characterization of wheat germ agglutinin and its four hevein-like domains.

Wheat germ agglutinin (WGA), a chitin binding lectin, has attracted increasing interest because of its unique characteristics such as conformational stability, binding specificity and transcytosis capacity. To pave the way for the study of the molecular basis of WGA's structural stability and binding capacity, as well as to facilitate its use in biomedical and biotechnological developments, we produced recombinant WGA and its 4 isolated hevein-like domains in a bacterial system. All the proteins were expressed as fusion constructs linked to a thioredoxin domain, which was enzymatically or chemically released. The structural and ligand-binding properties of recombinant WGA were similar to the wild lectin. The 4 isolated domains folded and were ligand-binding competent, indicating that each domain constitutes an independent folding unity. The biophysical characterization of the recombinant domains sheds new light on the intricate folding and binding behavior of this emblematic lectin.

Effect of Intra- versus Intermolecular Cross-Linking on the Supramolecular Folding of a Polymer Chain.

Anfinsen’s famous experiment showed that the restoration of catalytic activity of a completely unfolded ribonuclease A is only possible when the correct order of events is followed during the refolding process. Inspired by this work, the effect of structural constraints induced by covalent cross-links on the folding of a synthetic polymer chain via hydrogen-bonding interactions is investigated. Hereto, methacrylate-based monomers comprising either benzene-1,3,5-tricarboxamide (BTA)-based or coumarin-based pendants are copolymerized with n-butyl methacrylate in various ratios via reversible addition–fragmentation chain-transfer (RAFT) polymerization. To assess whether the folding and single-chain polymeric nanoparticle (SCPN) formation depend on the order of events, we compare two folding pathways. In the one case, we first covalently cross-link the coumarin pendants within the polymers in a solvent that prevents hydrogen bonding, after which hydrogen bonding is activated, inducing folding of the polymer. In the other case, we induce hydrogen-bonding interactions between tethered BTAs prior to covalent cross-linking of the coumarin pendants. A combination of circular dichroism (CD) spectroscopy, UV–vis spectroscopy, size-exclusion chromatography (SEC), and dynamic light scattering (DLS) is employed to understand the effect of the structural constraints on the folding behavior of these synthetic polymers. The results show that like in ribonuclease A, the order of events matters greatly and determines the outcome. Importantly, a hydrogen-bond-promoting solvent prevents the formation of SCPNs upon covalent cross-linking and results in multichain aggregates. In contrast, covalently cross-linking the polymer when no hydrogen bonds are present followed by inducing hydrogen bonding favors the formation of SCPNs above the UCST of the methacrylate-based polymer. To our surprise, the two systems show a fundamentally different response to changes in temperature, indicating that also in synthetic polymers differences in the folding pathway induce differences in the properties of the resultant nanostructures.

Elucidating thermal behavior, native contacts, and folding funnels of simple lattice proteins using replica exchange Wang-Landau sampling.

We studied the folding behavior of two coarse-grained, lattice models, the HP (hydrophobic-polar) model and the semi-flexible H0P model, whose 124 monomer long sequences were derived from the protein Ribonuclease A. Taking advantage of advanced parallel computing techniques, we applied replica exchange Wang-Landau sampling and calculated the density of states over the models entire energy ranges to high accuracy. We then determined both energetic and structural quantities in order to elucidate the folding behavior of each model completely. As a result of sufficiently long sequences and model complexity, yet computational accessibility, we were able to depict distinct free energy folding funnels for both models. In particular, we found that the HP model folds in a single-step process with a very highly degenerate native state and relatively flat low temperature folding funnel minimum. By contrast, the semi-flexible H0P model folds via a multi-step process and the native state is almost four orders of magnitude less degenerate than that for the HP model. In addition, for the H0P model, the bottom of the free energy folding funnel remains rough, even at low temperatures.

Quantitative evaluation of the three-dimensional deployment behavior of a shape memory polymer antenna

The three-dimensional (3D) deployment behavior of a shape memory polymer (SMP) was quantitatively characterized using 3D shape descriptors. 3D shape descriptor is a numerical value which represents and analyzes the shape information of a given 3D shape. A 3D deployable antenna was designed and fabricated using an epoxy-based SMP. First, the folding behavior of the antenna was observed during deployment in a device. At this time, its entire shape was scanned, processed, and converted into surface data. Two-dimensional (2D) (area and circularity) and 3D (compactness and cubeness) shape descriptors were calculated from the surface data and compared to determine if the 3D folding behavior of an SMP antenna could be adequately described by 3D compactness, which represents how compactly the SMP antenna was able to fold. In addition to 2D shape information, these data provide height information, resulting in a more accurate and sensitive characterization of the folding process. Finally, the 3D deployment behavior (folding-unfolding) of the SMP antenna was analyzed using a 3D descriptor. The shape fixation and recovery ratios of the SMP antenna according to the 3D descriptor were 100% and 99.5%, respectively, whereas those values evaluated with a one-dimensional descriptor, such as uniaxial strain, were 98.0% and 79.1%, respectively. These results demonstrate that a 3D descriptor (compactness) can adequately assess shape memory performance.

Creating Linkage Permutations to Prevent Self-Intersection and Enable Deployable Networks of Thick-Origami

Origami concepts show promise for creating complex deployable systems. However, translating origami to thick (non-paper) materials introduces challenges, including that thick panels do not flex to facilitate folding and the chances for self-intersection of components increase. This work introduces methods for creating permutations of linkage-based, origami-inspired mechanisms that retain desired kinematics but avoid self-intersection and enable their connection into deployable networks. Methods for reconfiguring overconstrained linkages and implementing them as modified origami-inspired mechanisms are proved and demonstrated for multiple linkage examples. Equations are derived describing the folding behavior of these implementations. An approach for designing networks of linkage-based origami vertices is demonstrated and applications for tessellations are described. The results offer the opportunity to exploit origami principles to create deployable systems not previously feasible.

An implicit frictional contact solver for adaptive cloth simulation

Cloth dynamics plays an important role in the visual appearance of moving characters. Properly accounting for contact and friction is of utmost importance to avoid cloth-body and cloth-cloth penetration and to capture typical folding and stick-slip behavior due to dry friction. We present here the first method able to account for cloth contact with exact Coulomb friction, treating both cloth self-contacts and contacts occurring between the cloth and an underlying character. Our key contribution is to observe that for a nodal system like cloth, the frictional contact problem may be formulated based on velocities as primary variables, without having to compute the costly Delassus operator. Then, by reversing the roles classically played by the velocities and the contact impulses, conical complementarity solvers of the literature can be adapted to solve for compatible velocities at nodes. To handle the full complexity of cloth dynamics scenarios, we have extended this base algorithm in two ways: first, towards the accurate treatment of frictional contact at any location of the cloth, through an adaptive node refinement strategy; second, towards the handling of multiple constraints at each node, through the duplication of constrained nodes and the adding of pin constraints between duplicata. Our method allows us to handle the complex cloth-cloth and cloth-body interactions in full-size garments with an unprecedented level of realism compared to former methods, while maintaining reasonable computational timings.

Cociente de Contacto (CQ) y Frecuencia Fundamental (Fo) en Profesionales de la Voz: [estudio piloto

El objetivo del presente estudio es evaluar los efectos de la edad y el género en el comportamiento vibratorio de los pliegues vocales durante la emisión de una vocal sostenida en tres grupos etarios definidos de profesionales de la voz basado en valores obtenidos por medio de electroglotografía (EGG). Participaron de este estudio 40 sujetos (25 mujeres y 15 varones) divididos en tres grupos. Los parámetros de análisis fueron cociente de contacto (CQ) y frecuencia fundamental (Fo). No se reportaron relaciones significativas entre las variables en cuestión. Los hallazgos sugieren que un uso adecuado de la voz sumado a un entrenamiento sistemático, tal como en el caso de las voces profesionales, tiene un impacto positivo y podría favorecer la conservación de la función vocal luego de iniciado el proceso normal de envejecimiento.

Effects of Non-native Interactions on Frustrated Proteins Folding under Confinement.

In vitro, kinetically significant non-native interactions have been identified experimentally during the folding of proteins Im7, Im9, and A39V/N53P/V55L Fyn SH3 domain. To understand the role of non-native interactions on the folding of some frustrated proteins in chaperone, we employed native-centric models with and without additional transferable, sequence-dependent non-native hydrophobic interactions to comparatively study the folding behaviors of the three proteins confined in spherical cages. Under purely repulsive confinement, as a decrease of cavity size, the non-native interactions increase, especially in the unfolded state, enhancing the roughness of the folding energy landscape. As a result, the increase in native stability for the three proteins by the model incorporated non-native interactions (db + MJ hϕ model) is much smaller than that by the purely native-centric model (desolvation-barrier (db) model); the acceleration of folding simulated by the db + MJ hϕ model is much slower than that via the db model; in particular, the folding rate of Im7 decreases when reducing the cavity size under zero-denaturant condition. The repulsive confinement can also promote formation of specific non-native contacts in the transition state and favor more folding pathways passing through the misfolded state, leading to a higher population of the misfolded intermediate. In an attractive cage, the attractive interactions could inhibit the formation of intrachain non-native contacts and provide alternate folding pathways to the native state so that the population of the misfolded intermediate decreases when increasing the strength of attractive interaction between the substrate protein and cavity wall. This study should be helpful in general to understand how the chaperonins reshape the folding energy landscape of some frustrated proteins.

Confirmation of Bioinformatics Predictions of the Structural Domains in Honeybee Silk.

Honeybee larvae produce a silk made up of proteins in predominantly a coiled coil molecular structure. These proteins can be produced in recombinant systems, making them desirable templates for the design of advanced materials. However, the atomic level structure of these proteins is proving difficult to determine: firstly, because coiled coils are difficult to crystalize; and secondly, fibrous proteins crystalize as fibres rather than as discrete protein units. In this study, we synthesised peptides from the central structural domain, as well as the N- and C-terminal domains, of the honeybee silk. We used circular dichroism spectroscopy, infrared spectroscopy, and molecular dynamics to investigate the folding behaviour of the central domain peptides. We found that they folded as predicted by bioinformatics analysis, giving the protein engineer confidence in bioinformatics predictions to guide the design of new functionality into these protein templates. These results, along with the infrared structural analysis of the N- and C-terminal domain peptides and the comparison of peptide film properties with those of the full-length AmelF3 protein, provided significant insight into the structural elements required for honeybee silk protein to form into stable materials.

Supramolecular Self‐Assembly of Ionic Discotic Liquid Crystalline Dimer with DNA at Interfaces

AbstractNanoarchitectonics through ionic self‐assembly at interfaces is an attractive approach to obtain advanced functional materials. Here, a novel discotic dimer‐DNA complex hybrid system has been investigated at air‐water and air‐solid interfaces. The ionic discotic liquid crystalline dimer consisted of two triphenylene cores linked via alkyl spacer with a imidazolium moiety. At air‐water interface, the dimer formed a stable monolayer with a reversible collapse. The surface manometry results suggested that the condensed phase of the monolayer consisted of molecules arranged in an edge‐on conformation. To understand the folding behavior of the molecules, DFT calculations were carried out which showed that the quantum chemically optimized folded‐form of the molecule was electronically more stable than its unfolded‐form. Upon adding DNA to the subphase, a complex monolayer was formed with enhanced stability as was indicated by increased collapse pressure and decreased limiting area. Importantly, this complexation enabled an efficient and stable multilayer formation on silicon substrates with layers as many as 40. Since both DNA and discotic dimer molecules share common properties of one‐dimensional charge transport with compatible structures, this complex film could serve as a model system for organic electronics.