Fms-like Tyrosine Kinase Receptor Research Articles

Double synergic chitosan-coated poly (lactic-co-glycolic) acid nanospheres loaded with nucleic acids as an intranasally administered vaccine delivery system to control the infection of foot-and-mouth disease virus

The spread of foot-and-mouth disease virus (FMDV) through aerosol droplets among cloven-hoofed ungulates in close contact is a major obstacle for successful animal husbandry. Therefore, the development of suitable mucosal vaccines, especially nasal vaccines, to block the virus at the initial site of infection is crucial. Here, we constructed eukaryotic expression plasmids containing the T and B-cell epitopes (pTB) of FMDV in tandem with the molecular mucosal adjuvant Fms-like tyrosine kinase receptor 3 ligand (Flt3 ligand, FL) (pTB-FL). Then, the constructed plasmid was electrostatically attached to mannose-modified chitosan-coated poly(lactic-co-glycolic) acid (PLGA) nanospheres (MCS-PLGA-NPs) to obtain an active nasal vaccine targeting the mannose-receptor on the surface of antigen-presenting cells (APCs). The MCS-PLGA-NPs loaded with pTB-FL not only induced a local mucosal immune response, but also induced a systemic immune response in mice. More importantly, the nasal vaccine afforded an 80% protection rate against a highly virulent FMDV strain (AF72) when it was subcutaneously injected into the soles of the feet of guinea pigs. The nasal vaccine prepared in this study can effectively induce a cross-protective immune response against the challenge with FMDV of same serotype in animals and is promising as a potential FMDV vaccine.

Emerging DNA Methylome Targets in FLT3-ITD-Positive Acute Myeloid Leukemia: Combination Therapy with Clinically Approved FLT3 Inhibitors.

The internal tandem duplication (ITD) mutation of the FMS-like receptor tyrosine kinase 3 (FLT3-ITD) is the most common mutation observed in approximately 30% of acute myeloid leukemia (AML) patients. It represents poor prognosis due to continuous activation of downstream growth-promoting signaling pathways such as STAT5 and PI3K/AKT. Hence, FLT3 is considered an attractive druggable target; selective small FLT3 inhibitors (FLT3Is), such as midostaurin and quizartinib, have been clinically approved. However, patients possess generally poor remission rates and acquired resistance when FLT3I used alone. Various factors in patients could cause these adverse effects including altered epigenetic regulation, causing mainly abnormal gene expression patterns. Epigenetic modifications are required for hematopoietic stem cell (HSC) self-renewal and differentiation; however, critical driver mutations have been identified in genes controlling DNA methylation (such as DNMT3A, TET2, IDH1/2). These regulators cause leukemia pathogenesis and affect disease diagnosis and prognosis when they co-occur with FLT3-ITD mutation. Therefore, understanding the role of different epigenetic alterations in FLT3-ITD AML pathogenesis and how they modulate FLT3I's activity is important to rationalize combinational treatment approaches including FLT3Is and modulators of methylation regulators or pathways. Data from ongoing pre-clinical and clinical studies will further precisely define the potential use of epigenetic therapy together with FLT3Is especially after characterized patients' mutational status in terms of FLT3 and DNA methlome regulators.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Landscape of FLT3 Variations Associated with Structural and Functional Impact on Acute Myeloid Leukemia: A Computational Study.

Acute myeloid leukemia (AML) is hallmarked by the clonal proliferation of myeloid blasts. Mutations that result in the constitutive activation of the fms-like tyrosine kinase 3 (FLT3) gene, coding for a class III receptor tyrosine kinase, are significantly associated with this heterogeneous hematologic malignancy. The fms-related tyrosine kinase 3 ligand binds to the extracellular domain of the FLT3 receptor, inducing homodimer formation in the plasma membrane, leading to autophosphorylation and activation of apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. In the present study, we evaluated the association of FLT3 as a significant biomarker for AML and tried to comprehend the effects of specific variations on the FLT3 protein's structure and function. We also examined the effects of I836 variants on binding affinity to sorafenib using molecular docking. We integrated multiple bioinformatics tools, databases, and resources such as OncoDB, UniProt, COSMIC, UALCAN, PyMOL, ProSA, Missense3D, InterProScan, SIFT, PolyPhen, and PredictSNP to annotate the structural, functional, and phenotypic impact of the known variations associated with FLT3. Twenty-nine FLT3 variants were analyzed using in silico approaches such as DynaMut, CUPSAT, AutoDock, and Discovery Studio for their impact on protein stability, flexibility, function, and binding affinity. The OncoDB and UALCAN portals confirmed the association of FLT3 gene expression and its mutational status with AML. A computational structural analysis of the deleterious variants of FLT3 revealed I863F mutants as destabilizers of the protein structure, possibly leading to functional changes. Many single-nucleotide variations in FLT3 have an impact on its structure and function. Thus, the annotation of FLT3 SNVs and the prediction of their deleterious pathogenic impact will facilitate an insight into the tumorigenesis process and guide experimental studies and clinical implications.

Safety and Pharmacokinetics of Quizartinib Combination Therapy With Standard Induction and Consolidation Chemotherapy in Patients With Newly Diagnosed Acute Myeloid Leukemia: Results from Two Phase 1 Trials in Japan and China.

Quizartinib is a potent, oral, second-generation, selective type II FMS-like receptor tyrosine kinase 3 (FLT3) inhibitor. It has shown improved overall survival in a randomized, multinational, Phase 3 (QuANTUM-First) study in patients with FLT3-internal tandem duplication (ITD)-positive newly diagnosed acute myeloid leukemia. We conducted 2 Phase 1b studies in Japan and China to evaluate the safety, pharmacokinetics, and efficacy of quizartinib in combination with standard induction and consolidation chemotherapy in patients with newly diagnosed acute myeloid leukemia. Quizartinib was started at a dose level of 20mg/day and then escalated to 40mg/day, the dose used in the Phase 3 study. Seven patients were enrolled according to the 3 + 3 dose-escalation method in each study, including 3 patients who were FLT3-ITD positive. No dose-limiting toxicities were observed at dose levels up to 40mg/day in both studies. Grade 3 or higher, quizartinib-related, treatment-emergent adverse events included febrile neutropenia, hematologic toxicities, and infections. QT prolongation on electrocardiogram was observed in 5 patients. The pharmacokinetics of quizartinib and its metabolite AC886 were similar between the studies and consistent with previous findings in the United States. We confirmed the tolerability of Japanese and Chinese patients to the dose of quizartinib and chemotherapy regimens used in the QuANTUM-First study.

Potentiating Gilteritinib Efficacy Using Nanocomplexation with a Hyaluronic Acid-Epigallocatechin Gallate Conjugate.

Acute myeloid leukemia carrying FMS-like tyrosine kinase receptor-3 (FLT3) mutations is a fatal blood cancer with a poor prognosis. Although the FLT3 inhibitor gilteritinib has recently been approved, it still suffers from limited efficacy and relatively high nonresponse rates. In this study, we report the potentiation of gilteritinib efficacy using nanocomplexation with a hyaluronic acid-epigallocatechin gallate conjugate. The self-assembly, colloidal stability, and gilteritinib loading capacity of the nanocomplex were characterized by reversed-phase high-performance liquid chromatography and dynamic light scattering technique. Flow cytometric analysis revealed that the nanocomplex efficiently internalized into FLT3-mutated leukemic cells via specific interactions between the surface-exposed hyaluronic acid and CD44 receptor overexpressed on the cells. Moreover, this nanocomplex was found to induce an eradication of the leukemic cells in a synergistic manner by elevating the levels of reactive oxygen species and caspase-3/7 activities more effectively than free gilteritinib. This study may provide a useful strategy to design nanomedicines capable of augmenting the therapeutic efficacy of FLT3 inhibitors for effective leukemia therapy.

The Protective Role of Tubular Epithelial Cells Produced Fms-like Tyrosine Kinase Receptor 3 Ligand in Acute Kidney Injury

Introduction: Dendritic cells (DC) accumulate in the kidneys of patients with acute kidney injury (AKI), but the Fms-like tyrosine kinase receptor 3 ligand (Flt3L)-dendritic cell axis is poorly defined in kidneys with AKI. Meanwhile it has not been reported whether Flt3L is produced by kidney cells under ischemic-reperfusion injury (IR) induced microenvironment. Methods: (1) Blood specimens and urine were collected from two patient cohorts: a) patients with pre-renal AKI and healthy controls for analysis of serum Flt3L. b) patients with acute myocardial infarction (AMI) developed with or without AKI on admission for analysis of serum and urine Flt3L. (2) Wild type mice and T cell-deficient mice ( Tcra -/- mice) were applied. IR induced AKI mice and hypoxia-reoxygenation stimulated HK-2 cell line (human tubular epithelial cell line) were constructed. The expression of Flt3L in kidney, tubular epithelial cells, and T cells were measured by RT-PCR, ELISA, immunohistochemistry, immunofluorescence staining, RNAscope, and flow cytometry. (3) Wild type mice and type I conventional dendritic cell (cDC1)-deficient mice ( Irf8 -/- mice) were treated with 15 μg rFlt3L or 10mg/kg gilteritinib (Flt3 inhibitor). They were subjected to IR. Serum and kidney tissues were collected. Kidney function, tubular injury, and DC accumulation were quantified. Results: Initially, among patients with pre-renal AKI, we observed an increased level of serum Flt3L within two days after admission. Another patient cohort revealed that this increase was specific for AMI patients with AKI rather than without AKI or healthy controls. Furthermore, among these AMI patients, serum Flt3L levels correlated with Creatinine increase (R 2 = 0.4532, p = 0.0002) and BUN increase (R 2 = 0.3417, p = 0.0017) within 48 hours after admission. Similarly, urine Flt3L levels among these AMI patients also steadily elevated with Creatinine increase (R 2 = 0.6395, p < 0.0001) and BUN increase (R 2 = 0.5115, p = < 0.0001) within 48 hours after admission. Flt3L was also enhanced in wild type mice with IR-AKI but not affected in T cell-deficient mice ( Tcra -/-) with IR-AKI. Among kidney tissue, Flt3L-positive cells scattered within tubules in outer stripe of the outer medulla (OSOM) and mRNA and protein increased within 24 hours after IR-AKD. In vitro, FLT3L mRNA was markedly induced in HK-2 cells during hypoxia and FLT3L protein remained enhanced during reoxygenation. Phenotypically, the numbers of renal cDC1 and CD64 +DC were significantly decreased in gilteritinib-treated IR-AKI mice, which were associated with more severe tubular injury. With reduced kidney cDC1, Irf8 -/- mice also showed worsen kidney injury and aggravated functional failure upon IR-AKI. Therapeutic administration of rFlt3L significantly increased kidney cDC1 and CD64 +DC upon IR-AKI in wild type but not Irf8 -/- mice. This was associated with significantly reduced tubular injury of wild type mice .In addition, pre-treatment of wild type mice with rFlt3L increased kidney cDC1 and protected the mice from severe IR-AKI. Conclusion: Flt3L is upregulated in human and mice and produced by tubular epithelial cells during IR-AKI. It fosters the accumulation of kidney cDC1 and CD64 +DC, thereby limiting the severity of kidney injury in mice. The current study implies the possibility of DC-based immunotherapy for treatment of AKD.

Transient TKI-resistant CD44+pBAD+ blasts undergo intrinsic homeostatic adaptation to promote the survival of acute myeloid leukemia in vitro.

Acute myeloid leukemia (AML) patients have frequent mutations in FMS-like receptor tyrosine kinase 3 (FLT3-mut AML), who respond poorly to salvage chemotherapies and targeted therapies such as tyrosine kinase inhibitors (TKIs). Disease relapse is a common reason of treatment failures in FLT3-mut AML patients, but its intracellular refractory mechanism remains to be discovered. In this study, we designed serial in vitro time-course studies to investigate the biomarkers of TKI-resistant blasts and their survival mechanism. First, we found that a group of transient TKI-resistant blasts were CD44+Phosphorylated-BAD (pBAD)+ and that they could initiate the regrowth of blast clusters in vitro. Notably, TKI-treatments upregulated the compensation pathways to promote PIM2/3-mediated phosphorylation of BAD to initiate the blast survival. Next, we discovered a novel process of intracellular adaptive responses in these transient TKI-resistant blasts, including upregulated JAK/STAT signaling pathways for PIM2/3 expressions and activated SOCS1/SOCS3/PIAS2 inhibitory pathways to down-regulate redundant signal transduction and kinase phosphorylation to regain intracellular homeostasis. Finally, we found that the combination of TKIs with TYK2/STAT4 pathways-driven inhibitors could effectively treat FLT3-mut AML in vitro. In summary, our findings reveal that TKI-treatment can activate a JAK/STAT-PIM2/3 axis-mediated signaling pathways to promote the survival of CD44+pBAD+blasts in vitro. Disrupting these TKIs-activated redundant pathways and blast homeostasis could be a novel therapeutic strategy to treat FLT3-mut AML and prevent disease relapse in vivo.

Shikonin Exerts an Antileukemia Effect against FLT3-ITD Mutated Acute Myeloid Leukemia Cells via Targeting FLT3 and Its Downstream Pathways

Introduction: Acute myeloid leukemia (AML) with internal tandem duplication (ITD) mutations in Fms-like tyrosine kinase 3 (FLT3) has an unfavorable prognosis. Recently, using newly emerging inhibitors of FLT3 has led to improved outcomes of patients with FLT3-ITD mutations. However, drug resistance and relapse continue to be significant challenges in the treatment of patients with FLT3-ITD mutations. This study aimed to evaluate the antileukemic effects of shikonin (SHK) and its mechanisms of action against AML cells with FLT3-ITD mutations in vitro and in vivo. Methods: The CCK-8 assay was used to analyze cell viability, and flow cytometry was used to detect cell apoptosis and differentiation. Western blotting and real-time polymerase chain reaction were used to examine the expression of certain proteins and genes. Leukemia mouse model was created to evaluate the antileukemia effect of SHK against FLT3-ITD mutated leukemia in vivo. Results: After screening a series of leukemia cell lines, those with FLT3-ITD mutations were found to be more sensitive to SHK in terms of proliferation inhibition and apoptosis induction than those without FLT3-ITD mutation. SHK suppresses the expression and phosphorylation of FLT3 receptors and their downstream molecules. Inhibition of the NF-κB/miR-155 pathway is an important mechanism through which SHK kills FLT3-AML cells. Moreover, a low concentration of SHK promotes the differentiation of AML cells with FLT3-ITD mutations. Finally, SHK could significantly inhibit the growth of MV4-11 cells in leukemia bearing mice. Conclusion: The findings of this study indicate that SHK may be a promising drug for the treatment of FLT3-ITD mutated AML.

Association between adverse pregnancy outcome and placental biomarkers in the first trimester: A prospective cohort study.

To determine the inter-relationships between five first-trimester biomarkers (pregnancy associated plasma protein A [PAPP-A], alpha-fetoprotein [AFP], beta human chorionic gonadotrophin [beta-hCG], placenta growth factor [PlGF] and soluble fms-like tyrosine kinase receptor-1 [sFlt-1]) and a range of adverse pregnancy outcomes (APOs). Prospective cohort study of nulliparous singleton pregnancy. Cambridge, UK. 4056 pregnancy outcome prediction study participants. The biomarker concentrations were measured in maternal serum at ~12 weeks of gestation. Univariable analysis of APOs was performed using logistic regression. Multivariable analysis used best subsets logistic regression with cross-validation. Pre-eclampsia (PE), small for gestational age (SGA), including severe SGA (birthweight <3rd), fetal growth restriction (FGR), preterm birth (PTB, both induced and spontaneous [iPTB and sPTB, respectively]), pre-viable loss and stillbirth, plus combinations of outcomes. Lower values of PAPP-A, PlGF and sFlt-1 and higher values of AFP were associated with FGR (OR for 1 SD higher value 0.59 [95% CI 0.48-0.74], OR 0.56 [95% CI 0.44-0.70], OR 0.68 [95% CI 0.54-0.87] and OR 1.53 [95% CI 1.25-1.88]), severe SGA (OR0.59 [95% CI 0.49-0.72], OR 0.71 [95% CI 0.57-0.87], OR 0.74 [95% CI 0.60-0.91] and OR 1.41 [95% CI 1.17-1.71]), sPTB (OR 0.61 [95% CI 0.50-0.73], OR 0.79 [95% CI 0.66-0.96], OR 0.57 [95% CI 0.47-0.70] and OR 1.41 [95% CI 1.18-1.67]) and iPTB (OR 0.72 [95% CI 0.57-0.91], OR 0.62 [95% CI 0.49-0.78], OR 0.71 [95% CI 0.56-0.90] and OR 1.44 [95% CI 1.16-1.78]), respectively. When combinations of biomarkers were assessed, PAPP-A and AFP were independently associated with severe SGA; PAPP-A alone with PE + PTB; PlGF alone with severe PE; PlGF, beta-hCG, AFP and PAPP-A with the combination of PE and SGA; AFP and sFlt-1 with sPTB; and AFP and PlGF with iPTB. Combinations of first-trimester placental biomarkers are associated with APOs. However, the patterns vary for different types of APO, indicating heterogeneity in the underlying pathophysiological pathways.

Flt3 Activation Mitigates Mitochondrial Fragmentation and Heart Dysfunction through Rebalanced L-OPA1 Processing by Hindering the Interaction between Acetylated p53 and PHB2 in Cardiac Remodeling.

Recent studies have shown that FMS-like receptor tyrosine kinase 3 (Flt3) has a beneficial effect on cardiac maladaptive remodeling. However, the role and mechanism of Flt3 in mitochondrial dynamic imbalance under cardiac stress remains poorly understood. This study aims to investigate how Flt3 regulates p53-mediated optic atrophy 1 (OPA1) processing and mitochondrial fragmentation to improve cardiac remodeling. Mitochondrial fragmentation in cardiomyocytes was induced by isoprenaline (ISO) and H2O2 challenge, respectively, in vitro. Cardiac remodeling in mice was established by ligating the left anterior descending coronary artery or by chronic ISO challenge, respectively, in vivo. Our results demonstrated that the protein expression of acetylated-p53 (ac-p53) in mitochondria was significantly increased under cell stress conditions, facilitating the dissociation of PHB2-OPA1 complex by binding to prohibitin 2 (PHB2), a molecular chaperone that stabilizes OPA1 in mitochondria. This led to the degradation of the long isoform of OPA1 (L-OPA1) that facilitates mitochondrial fusion and resultant mitochondrial network fragmentation. This effect was abolished by a p53 K371R mutant that failed to bind to PHB2 and impeded the formation of the ac-p53-PHB2 complex. The activation of Flt3 significantly reduced ac-p53 expression in mitochondria via SIRT1, thereby hindering the formation of the ac-p53-PHB2 complex and potentiating the stability of the PHB2-OPA1 complex. This ultimately inhibits L-OPA1 processing and leads to the balancing of mitochondrial dynamics. These findings highlight a novel mechanism by which Flt3 activation mitigates mitochondrial fragmentation and dysfunction through the reduction of L-OPA1 processing by dampening the interaction between ac-p53 and PHB2 in cardiac maladaptive remodeling.

Improved efficacy of quizartinib in combination therapy with PI3K inhibition in primary FLT3-ITD AML cells.

Acute myeloid leukemia is a heterogeneous hematopoietic malignancy, characterized by uncontrolled clonal proliferation of abnormal myeloid progenitor cells, with poor outcomes. The internal tandem duplication (ITD) mutation of the Fms-like receptor tyrosine kinase 3 (FLT3) (FLT3-ITD) represents the most common genetic alteration in AML, detected in approximately 30% of AML patients, and is associated with high leukemic burden and poor prognosis. Therefore, this kinase has been regarded as an attractive druggable target for the treatment of FLT3-ITD AML, and selective small molecule inhibitors, such as quizartinib, have been identified and trialled. However, clinical outcomes have been disappointing so far due to poor remission rates, also because of acquired resistance. A strategy to overcome resistance is to combine FLT3 inhibitors with other targeted therapies. In this study, we investigated the preclinical efficacy of the combination of quizartinib with the pan PI3K inhibitor BAY-806946 in FLT3-ITD cell lines and primary cells from AML patients. We show here that BAY-806946 enhanced quizartinib cytotoxicity and, most importantly, that this combination increases the ability of quizartinib to kill CD34+ CD38-leukemia stem cells, whilst sparing normal hematopoietic stem cells. Because constitutively active FLT3 receptor tyrosine kinase is known to boost aberrant PI3K signaling, the increased sensitivity of primary cells to the above combination can be the mechanistic results of the disruption of signaling by vertical inhibition.

A Multicenter, Open-Label, Phase I/II Study of FN-1501 in Patients with Advanced Solid Tumors.

FN-1501, a potent inhibitor of receptor FMS-like tyrosine kinase 3 (FLT3) and CDK4/6, KIT, PDGFR, VEGFR2, ALK, and RET tyrosine kinase proteins, has demonstrated significant in vivo activity in various solid tumor and leukemia human xenograft models. Anomalies in FLT3 have an established role as a therapeutic target where the gene has been shown to play a critical role in the growth, differentiation, and survival of various cell types in hematopoietic cancer and have shown promise in various solid tumors. An open-label, Phase I/II study (NCT03690154) was designed to evaluate the safety and PK profile of FN-1501 as monotherapy in patients (pts) with advanced solid tumors and relapsed, refractory (R/R) AML. Pts received FN-1501 IV three times a week for 2 weeks, followed by 1 week off treatment in continuous 21-day cycles. Dose escalation followed a standard 3 + 3 design. Primary objectives include the determination of the maximum tolerated dose (MTD), safety, and recommended Phase 2 dose (RP2D). Secondary objectives include pharmacokinetics (PK) and preliminary anti-tumor activity. Exploratory objectives include the relationship between pharmacogenetic mutations (e.g., FLT3, TP53, KRAS, NRAS, etc.), safety, and efficacy; as well as an evaluation of the pharmacodynamic effects of treatment with FN-1501. Dose expansion at RP2D further explored the safety and efficacy of FN-1501 in this treatment setting. A total of 48 adult pts with advanced solid tumors (N = 47) and AML (N = 1) were enrolled at doses ranging from 2.5 to 226 mg IV three times a week for two weeks in 21-day cycles (2 weeks on and 1 week off treatment). The median age was 65 years (range 30-92); 57% were female and 43% were male. The median number of prior lines of treatment was 5 (range 1-12). Forty patients evaluable for dose-limiting toxicity (DLT) assessment had a median exposure of 9.5 cycles (range 1-18 cycles). Treatment-related adverse events (TRAEs) were reported for 64% of the pts. The most common treatment-emergent adverse events (TEAEs), defined as those occurring in ≥20% of pts, primarily consisted of reversible Grade 1-2 fatigue (34%), nausea (32%), and diarrhea (26%). The most common Grade ≥3 events occurring in ≥5% of pts consisted of diarrhea and hyponatremia. Dose escalation was discontinued due to DLTs of Grade 3 thrombocytopenia (N = 1) and Grade 3 infusion-related reaction (N = 1) occurring in 2 pts. The maximum tolerated dose (MTD) was determined to be 170 mg. FN-1501 demonstrated reasonable safety, tolerability, and preliminary activity against solid tumors in doses up to 170 mg. Dose escalation was terminated based on 2 DLTs occurring at the 226 mg dose level.

Abstract 8: Differential flt3 mutational status in acute myeloid leukemia predicts sensitivity to flt3 inhibitor gilteritinib in vitro and in vivo

Abstract Acute Myeloid Leukemia (AML) is a heterogenous hematopoietic cancer characterized by abnormal differentiation and uncontrolled proliferation of hematopoietic progenitor cells. Recent approaches to treatment, which aim to improve outcomes in refractory AML, include strategies to molecularly target specific receptor-mediated signaling pathways which regulate cell growth and proliferation. One target-specific approach is the inhibition of fms-like tyrosine kinase 3 (FLT3). FLT3 is expressed on the surface of hematopoietic progenitor cells and plays an important role in regulating proliferation, survival, and differentiation of multipotent stem cells. The presence of internal tandem duplications (ITDs) at the juxta membrane domain within the FLT3 receptor are common driver mutations in 30% of AML patients. In this study, we utilized 3 luciferase-expressing human AML models, MV4-11, MOLM-13, and, OCI-AML3 to determine the prognostic impact of FLT3 inhibitor Gilteritinib on the allelic ratio of ITD versus wildtype allele. OCI-AML3 expresses wild-type FLT3 whereas MOLM-13 is heterozygous for FLT3-ITD mutations, and MV4-11 possesses a homozygous in-frame tandem repeat insertion in the FLT3 allele. Here we demonstrate that FLT3-ITD mutational status impacts the efficacy of Gilteritinib in both in vitro and in vivo AML models. The in vitro assays showed that treatment with Gilteritinib resulted in significant dose dependent reduction in overall cell viability and bioluminescence in the MV4-11 cell line, while MOLM-13 was only moderately sensitive, and OCI-AML3 was least sensitive to Gilteritinib treatment. Additionally, we evaluated the downstream MAPK and PI3K signaling pathways as FLT3-ITD oncogenic mutations result in ligand-independent constitutive activation of signaling pathways mediating leukemic transformation. For in vivo validation, MV4-11, MOLM-13, and OCI-AML3 luciferase expressing cells were implanted systemically into NCG mice and once tumors were established, we evaluated the survival benefit in response to Gilteritinib and various standard of care agents. In accordance with our in vitro findings, the quantification of tumor progression by bioluminescent imaging showed the highest therapeutic activity of Gilteritinib in MV4-11 tumor bearing mice through selective targeting of FLT3-ITD mutations. Taken together, our in vitro and in vivo results demonstrate that differential FLT3-ITD mutational status in AML models impacts Gilteritinib treatment response and downstream signaling events with the highest activity in MV4-11 followed by MOLM-13, and lack of activity in OCI-AML3 harboring wild-type FLT3. Citation Format: Bincy John, Pasupathi Sundaramoorthy, Elizabeth Rainbolt, Andrew Wong, Zachary Ward, Justin Avery, Savannah Todd, Shasta Kidder, Diana Gietl, Chassidy Hall, David Harris. Differential flt3 mutational status in acute myeloid leukemia predicts sensitivity to flt3 inhibitor gilteritinib in vitro and in vivo [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 8.

PlGF/FLT-1 deficiency leads to reduced STAT3-C/EBPβ signaling and aberrant polarization in decidual macrophages during early spontaneous abortion.

Dysregulated macrophage polarization (excessive M1-like or limited M2-like macrophages) in the early decidua contributes to allogeneic fetal rejection and thus early spontaneous abortion. However, the modulators of M1/M2 balance at the early maternal-fetal interface remain mostly unknown. First-trimester decidual tissues were collected from normal pregnant women undergoing elective pregnancy terminations and patients with spontaneous abortion. We measured the expression of placental growth factor (PlGF) and Fms-like-tyrosine-kinase receptor 1 (FLT-1), and characterized the profiles of macrophages in decidua. Notably, we investigated the effect of recombinant human PlGF (rhPlGF) on decidual macrophages (dMφs) from normal pregnancy and revealed the underlying mechanisms both in vitro and in vivo. The downregulated expression of PlGF/ FLT-1 may result in spontaneous abortion by inducing the M1-like deviation of macrophages in human early decidua. Moreover, the CBA/J×DBA/2 abortion-prone mice displayed a lower FLT-1 expression in uterine macrophages than did CBA/J×BALB/c control pregnant mice. In in vitro models, rhPlGF treatment was found to drive the M2-like polarization of dMφs via the STAT3/CEBPB signaling pathway. These findings were further supported by a higher embryo resorption rate and uterine macrophage dysfunction in Pgf knockout mice, in addition to the reduced STAT3 transcription and C/EBPβ expression in uterine macrophages. PlGF plays a key role in early pregnancy maintenance by skewing dMφs toward an M2-like phenotype via the FLT-1-STAT3-C/EBPβ signaling pathway. Excitingly, our results highlight a rationale that PlGF is a promising target to prevent early spontaneous abortion.

A prospective and comparative investigation of blood sFlt-1, P1GF, and niacin concentrations in women with premature ovarian insufficiency.

Endothelial dysfunction is an important component of preeclampsia like premature ovarian insufficiency (POI), and it is reported that placental growth factor (P1GF) and soluble fms-like tyrosine kinase receptor-1 (sFlt-1) levels are important in preeclampsia. Extra-placental sources for P1GF and sFlt-1 have also been identified, including various cell types. In animal models of POI, niacin treatment inhibited follicular apoptosis under hazardous conditions while significantly reducing cumulus cell apoptosis. The number of developing follicles also increased after niacin was given. This study was designed to determine blood sFlt-1, P1GF, and niacin concentrations in women with idiopathic POI (iPOI) compared with those of healthy women. The study comprised 45 women with iPOI and 45 healthy women. Blood was obtained and analyzed at the early follicular phase of the menstrual cycle and sFlt-1, P1GF, and niacin levels were measured using a commercially available enzyme-linked immunosorbent assay kit. No significant differences were observed in the two groups according to the gravidity numbers, parity, abortion, live births, and menarche ages (p ≥ 0.05). In the iPOI group, the mean anti-mullerian hormone value was 0.03 ± 0.04 (min-max, 0.00-0.21)ng/ml. sFlt-1, P1GF, niacin levels, and also the sFlt-1/P1GF ratio were lower in the iPOI group (p < 0.01). A significant discriminative role of sFlt-1, P1GF, niacin levels, and the sFlt-1/P1GF ratio for the presence of iPOI, with cut-off values of 5.13, 10.28, 37.17, and 0.61 ng/ml, respectively, were reported in the receiver operating characteristics curve analysis. Lower levels of P1GF, sFlt-1, niacin, and sFlt-1/P1GF ratios may be associated with the development of POI/iPOI. Further studies are required to better understand the etiopathogenesis of POI/iPOI. NCT04641624 (clinicaltrials.gov).

Activation of FMS-like tyrosine kinase 3 protects against isoprenaline-induced cardiac hypertrophy by improving autophagy and mitochondrial dynamics.

FMS-like receptor tyrosine kinase 3 (Flt3) expression was reported to increase in the heart in response to pathological stress, but the role of Flt3 activation and its underlying mechanisms remain poorly elucidated. This study was designed to investigate the role of Flt3 activation in sympathetic hyperactivity-induced cardiac hypertrophy and its mechanisms through autophagy and mitochondrial dynamics. In vivo, cardiac hypertrophy was established by subcutaneous injection of isoprenaline (6mg/kg·day) in C57BL/6 mice for 7 consecutive days. The Flt3-ligand intervention was launched 2 h prior to isoprenaline each day. In vitro, experiments of cardiomyocyte hypertrophy, autophagy, and mitochondrial dynamics were performed in neonatal rat cardiomyocytes (NRCMs). Our results revealed that the expression level of Flt3 protein was significantly increased in the hypertrophic myocardium provoked by isoprenaline administration. Flt3-ligand intervention alleviated isoprenaline-induced cardiac oxidative stress, hypertrophy, fibrosis, and contractile dysfunction. Isoprenaline stimulation impaired autophagic flux in hypertrophic mouse hearts, supported by the accumulation of LC3II and P62 proteins, while Flt3-ligand restored the impairment of autophagic flux. Flt3 activation normalized the imbalance of mitochondrial fission and fusion in the hearts of mice evoked by isoprenaline as evidenced by the neutralization of elevated mitochondrial fission markers and reduced mitochondrial fusion markers. In NRCMs, Flt3-ligand treatment attenuated isoprenaline-stimulated hypertrophy, which was abolished by a Flt3-specific blocker AC220. Activating Flt3 reversed isoprenaline-induced autophagosome accumulation and impairment of autophagic flux probably by enhancing SIRT1 expression and consequently TFEB nuclear translocation. Flt3 activation improved the imbalance of mitochondrial dynamics induced by isoprenaline in NRCMs through the SIRT1/P53 pathway. Activation of Flt3 mitigated ISO-stimulated hypertrophy probably involves the restoration of autophagic flux and balance of mitochondrial dynamics. Therefore, activation of Flt3 attenuates isoprenaline-induced cardiac hypertrophy in vivo and in vitro, the potential mechanism probably attributes to SIRT1/TFEB-mediated autophagy promotion and SIRT1/P53-mediated mitochondrial dynamics balance. These findings suggest that activation of Flt3 may be a novel target for protection against cardiac remodeling and heart failure during sympathetic hyperactivity.

The Tubular Cells Produce Fms-like Tyrosine Kinase Receptor 3 Ligand to Recover Kidney Function after Acute Kidney Injury Disease

INTRODUCTION: Dendritic cells (DC) are involved in the recovery process of acute kidney injury disease (AKD). Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is critical for instructing DC generation and maintenance in organs. In healthy kidney, nonhematopoietic cells produce most Flt3L, rather than immune cells. However, it remains unknown which cells produce Flt3L, and which cellular source drives DC development during AKD. Further, We hypothesized that tubular cells probably produce Flt3L, which improves kidney function after AKD by fostering the accumulation of DC. METHODS: Blood specimens were collected from patients of prerenal or renal AKD and healthy controls for analysis of serum Flt3L and DC subsets. Wild type mice and IRF8KO mice were treated with rFlt3L or Flt3 inhibitor gilteritinib. They were subjected to unilateral ischemia-reperfusion (IR) to induce post-ischemic AKD or were injected with cisplatin to induce nephrotoxic AKD. Serum and kidneys were collected and analyzed. Kidney function, tubular injury, primary/proximal tubular cell numbers and Flt3L expression were quantified. RESULTS: Initially, we observed an increased level of serum Flt3L in patients with AKD. Further analysis revealed that this increase was specific for trauma- rather than heart failure- or sepsis-induced AKD. A similar increase in serum Flt3L was found in mice with IR-AKD but not cisplatin-induced AKD. Flow cytometric analysis revealed a reduced expression level of Flt3L among intrarenal CD4-CD8+T, CD4+CD8-T and, CD4+CD8+T cells. However, the level of serum Flt3L among Tcrαko mice showed no difference with wild type mice after IR-AKD. Conversely, Flt3L-positive cells scattered within tubules in outer stripe of the outer medulla (OSOM). Both mRNA and protein increased within 24 hours after IRI-AKD in renal tissue, which were confirmed by immunohistochemistry staining, in situ hybridization staining, PCR and, RNA-sequencing data of IR kidneys. This was accompanied by reduced peripheral blood DC but increased kidney DC in mice after IR-AKD. The numbers of type I conventional dendritic cell (cDC1) and CD64+DC in kidney were significantly decreased in gilteritinib-treated IR-AKD mice, which were associated with more severe tubular injury. With reduced kidney cDC1, IRF8KO mice also showed worsen kidney injury and aggravated functional failure upon IR-AKD. Therapeutic administration of rFlt3L significantly increased kidney cDC1 upon IR-AKD in wild type but not IRF8KO mice. This was associated with significantly reduced tubular injury, enhanced proliferation activity of tubular cells, and decreased expressions of tubular injury markers (Ngal, Timp-2, Igfbp-7 and Hgf) in kidney of wild type mice. In addition, pre-treatment of wild type mice with rFlt3L increased kidney cDC1 and protected the mice from severe IR-AKD. CONCLUSION: Flt3L is upregulated in humans and mice during IR-AKD and probably produced by tubules in OSOM. It fosters the accumulation of kidney cDC1 and, thereby limiting the severity of kidney injury in mice. The current study implies the possibility of Flt3L-dependent DC-based immunotherapy for treatment of AKD.

Prognostic Factors in Children with Acute Myeloid Leukemia Receiving the First Hematopoietic Stem Cell Transplantation in Second Remission

Introduction In children with acute myeloid leukemia (AML), hematopoietic stem cell transplantation (HSCT) during the first complete remission (CR1) is generally restricted to patients with a high risk of relapse. However, 30-40% of children with AML receiving chemotherapy will eventually relapse; these patients often undergo initial HSCT after achieving second CR (CR2) with re-induction chemotherapy. Previous studies have reported favorable prognostic factors in children with relapsed AML: no prior history of HSCT, longer duration of CR1, and achieving CR2 before HSCT. The identification of prognostic factors in children who received initial HSCT in CR2 may facilitate the refinement of risk stratification in first-line therapy, but they remain largely unknown. In this study, we explored the prognostic factors of pediatric patients with AML who received initial HSCT in CR2. Methods Data from 234 patients were collected from the Transplant Registry Unified Management Program sponsored by the Japanese Society for Transplantation and Cellular Therapy and the Japanese Data Center for Hematopoietic Cell Transplantation. The patients were selected according to the following criteria: (1) de novo AML, (2) age < 16 years and CR2 at the time of receiving HSCT, (3) no prior HSCT, and (4) HSCT performed between 2000 and 2019. Patients without information on survival and disease recurrence or those with Down syndrome (DS) were excluded. A myeloablative conditioning (MAC) regimen was defined as total-body irradiation (TBI) at > 8 Gy, melphalan > 140 mg/m2, or busulfan ≥ 9 mg/kg. All other regimens were analyzed as reduced-intensity conditioning regimens. High-risk (HR) cytogenetics/genetics were defined as either 7-/7q-, 5q-, complex karyotype (three or more chromosomal abnormalities in the absence of one of the recurring translocations or inversions), t(6;11)(q27;q23), t(6;9)(p23;q34), t(16;21)(p11;q22), t(9:22)(q34;q11.2), or fms-like tyrosine kinase receptor 3 internal tandem duplication (FLT3-ITD). Results The median age at HSCT was 7 years (range, 1-15), and the median follow-up period for survivors was 7.7 years (range, 0.2-19.2). The 5-year event-free survival (5y-EFS) and 5-year overall survival (5y-OS) rates were 63.5% (95% CI, 56.6-69.5%) and 66.9% (95% CI, 60.0-72.8%), respectively (Figure 1). The 5-year cumulative incidence of relapse was 24.7% (95% CI, 19.2-30.6%), whereas the 5-year cumulative incidence of non-relapse mortality was 11.8% (95% CI, 7.9-16.6%). The 5y-EFS was 72.6% (95% CI, 61.1-81.2%) for patients with core binding factor AML and 100% (95% CI unavailable owing to small patient number) for patients with t(15;17)(q22;q21). Patients with 11q23/KMT2A rearrangement and HR cytogenetics/genetics showed worse outcomes, with 5y-EFS rates of only 43.8% (95% CI, 21.4-64.3%) and 36.4% (95% CI, 17.8-55.3%), respectively. Among the French American British classification subtypes, patients with M7 AML showed inferior outcomes with a 5y-EFS of 18.8% (95% CI, 4.6-40.2%). For the conditioning regimens, aside from "other MAC,” which included only three patients, melphalan-based non-TBI MAC was associated with the most favorable outcomes, with a 5y-EFS of 77.1% (95% CI, 64.2-85.9%). Multivariate analysis identified duration of CR1 > 1 year and melphalan-based non-TBI MAC regimen as independent favorable prognostic factors, while M7 was identified as an independent adverse prognostic factor (hazard ratio 2.62, p = 0.033, Table 1). Conclusion In the present study, approximately two-thirds of children who experienced relapse after chemotherapy remained in remission after HSCT in CR2. Melphalan-based non-TBI MAC is recommended as a conditioning regimen for this select population. Patients with t(15;17)(q22;q21) showed particularly excellent outcomes after initial HSCT in CR2, whereas those with HR cytogenetics/genetics or non-DS M7 were scarcely rescued with HSCT even after attaining CR2. Precise identification of high-risk populations among them with poor early treatment response and/or unfavorable genetic alterations will contribute to refining the risk stratification and indications for HSCT in CR1. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

PRL2 phosphatase enhances oncogenic FLT3 signaling via dephosphorylation of the E3 ubiquitin ligase CBL at tyrosine 371

AbstractAcute myeloid leukemia (AML) is an aggressive blood cancer with poor prognosis. FMS-like tyrosine kinase receptor-3 (FLT3) is one of the major oncogenic receptor tyrosine kinases aberrantly activated in AML. Although protein tyrosine phosphatase PRL2 is highly expressed in some subtypes of AML compared with normal human hematopoietic stem and progenitor cells, the mechanisms by which PRL2 promotes leukemogenesis are largely unknown. We discovered that genetic and pharmacological inhibition of PRL2 significantly reduce the burden of FLT3-internal tandem duplications–driven leukemia and extend the survival of leukemic mice. Furthermore, we found that PRL2 enhances oncogenic FLT3 signaling in leukemia cells, promoting their proliferation and survival. Mechanistically, PRL2 dephosphorylates the E3 ubiquitin ligase CBL at tyrosine 371 and attenuates CBL-mediated ubiquitination and degradation of FLT3, leading to enhanced FLT3 signaling in leukemia cells. Thus, our study reveals that PRL2 enhances oncogenic FLT3 signaling in leukemia cells through dephosphorylation of CBL and will likely establish PRL2 as a novel druggable target for AML.