Fms-like Tyrosine Kinase Receptor Research Articles

FN-1501 Inhibits Diffuse Large B-Cell Lymphoma Tumor Growth by Inducing Cell Cycle Arrest and Apoptosis.

Due to its high degree of aggressiveness, diffuse large B-cell lymphoma (DLBCL) presents a treatment challenge because 30% to 50% of patients experience resistance or relapse following standard chemotherapy. FN-1501 is an effective inhibitor of cyclin-dependent kinases and Fms-like receptor tyrosine kinase 3. This study aimed to examine the anti-tumor impact of FN-1501 on DLBCL and clarify its molecular mechanism. This study used the cell counting kit-8 assay to evaluate cell proliferation, along with western blotting and flow cytometry to analyze cell cycle progression and apoptosis influenced by FN-1501 in vitro. Afterward, the effectiveness of FN-1501 was evaluated in vivo utilizing the xenograft tumor model. In addition, we identified the potential signaling pathways and performed rescue studies using western blotting and flow cytometry. We found that FN-1501 inhibited cell proliferation and induced cell cycle arrest and apoptosis in DLBCL cells in vitro. Its anti-proliferative effects were shown to be time- and dose-dependent. The effect on cell cycle progression resulted in G1/S phase arrest, and the apoptosis induction was found to be caspase-dependent. FN-1501 treatment also reduced tumor volumes and weights and was associated with a prolonged progressionfree survival in vivo. Mechanistically, the MAPK and PI3K/AKT/mTOR pathways were significantly inhibited by FN-1501. Additional pathway inhibitors examination reinforced that FN-1501 may regulate cell cycle arrest and apoptosis through these pathways. FN-1501 shows promising anti-tumor activity against DLBCL in vivo and in vitro, suggesting its potential as a new therapeutic option for patients with refractory or relapsed DLBCL.

FLT3 signaling inhibition abrogates opioid tolerance and hyperalgesia while preserving analgesia

Navigating the duality of opioids’ potent analgesia and side effects, including tolerance and hyperalgesia, is a significant challenge in chronic pain management, often prompting hazardous dose escalation to maintain analgesic effects. The peripheral mu-opioid receptor (MOR) is known to mediate these contradictory effects. Here, we show that the fms-like tyrosine kinase receptor 3 (FLT3) in peripheral somatosensory neurons drives morphine tolerance and hyperalgesia in a male rodent model. We found that chronic morphine treatment increases FLT3 and MOR co-expression, and that inhibiting FLT3 represses MOR-induced hyperactivation of the cyclic adenosine monophosphate (cAMP) signaling pathway, mitigating maladaptive excitatory processes engaged after chronic morphine treatment. Furthermore, in postsurgical or inflammatory models of chronic pain, co-administering morphine with a FLT3-specific inhibitor not only prevents or suppresses tolerance and hyperalgesia but also potentiates the analgesic efficacy of morphine, without aggravating other morphine-induced adverse effects. Our findings suggest that pairing morphine with FLT3 inhibitors could become a promising avenue for chronic pain management to safely harness the power of opioids, without the risk of dose escalation. By enhancing morphine analgesic potency through FLT3 inhibition, this approach could minimize opioid dosage, thereby curtailing the risk of addiction and other opioid-related side effects.

PRDM16 Induces Methylation of FLT3 to Promote FLT3-ITD Signaling and Leukemia Progression.

Internal tandem duplication (ITD) in the FMS-like receptor tyrosine kinase-3 (FLT3) is one of the most frequent mutations in acute myeloid leukemia (AML) and is associated with poor prognosis. FLT3-ITD mutations result in endoplasmic reticulum (ER) retention and constitutive autophosphorylation of FLT3. The PR/SET domain 16 (PRDM16) is highly expressed in FLT3-ITD+ AML patients, suggesting it might play a role in leukemogenesis. Here, we revealed that genetic and pharmacological suppression of PRDM16 greatly slowed the progression of FLT3-ITD-driven leukemia, sensitized leukemic cells to tyrosine kinase inhibitors (TKIs), and extended the survival of leukemic mice. PRDM16 enhanced activation of oncogenic FLT3-ITD and ligand-dependent activation of wild-type FLT3 in leukemic cells. Mechanistically, PRDM16 mediated monomethylation of FLT3-ITD at lysine 614 and promoted its ER localization, resulting in enhanced FLT3 signaling in leukemia cells. Moreover, pharmacological suppression of FLT3-ITD methylation in combination with TKIs increased the elimination of FLT3-ITD+ AML cells. Altogether, these results suggest that PRDM16 boosts oncogenic FLT3 signaling in leukemic cells by prompting FLT3-ITD methylation. Therefore, PRDM16 may serve as a therapeutic target for AML.

β3-adrenergic agonist counters oxidative stress and Na+-K+ pump inhibitory S-glutathionylation of placental cells: Implications for preeclampsia.

Oxidative stress from placental ischemia/reperfusion and hypoxia/reoxygenation (H/R) in preeclampsia is accompanied by Na+-K+ pump inhibition and S-glutathionylation of its β1 subunit (GSS-β1), a modification that inhibits the pump. β3-adrenergic receptor (β3-AR) agonists can reverse GSS-β1. We examined effects of the agonist CL316,243 on GSS-β1 and sources of H/R-induced oxidative stress in immortalized first trimester human trophoblast (HTR-8/SVneo) and freshly isolated placental explants from normal term pregnancies. H/R increased GSS-β1 and, reflecting compromised α1/β1 subunit interaction, it reduced α1/β1 pump subunit co-immunoprecipitation. H/R increased p47phox/p22phox NADPH oxidase subunit co-immunoprecipitation reflecting membrane translocation of cytosolic p47phox that is needed to activate NADPH oxidase. Fluorescence of O2•--sensitive dihydroethidium increased in parallel. H/R increased S-glutathionylation of endothelial nitric oxide synthase (GSS-eNOS) that uncouples NO synthesis towards synthesis of O2•- and reduced trophoblast migration. Oxidative stress induced by tumor necrosis factor α (TNF-α) increased soluble fms-like tyrosine kinase receptor 1 (sFlt-1) trophoblast release, a marker of preeclampsia, and reduced trophoblast integration into endothelial cellular networks. CL316,243 eliminated H/R-induced GSS-β1 and decreases of α1/β1 subunit coimmunoprecipitation, eliminated NADPH oxidase activation and increases in GSS-eNOS, restored trophoblast migration, eliminated increased sFlt-1 release and restored trophoblast integration in endothelial cell networks. H/R induced GSS-β1, α1/β1 subunit co-immunoprecipitation and NADPH oxidase activation of placental explants reflected effects of H/R for trophoblasts and CL316,243 eliminated these changes. We conclude a β3-AR agonist counters key pathophysiological features of preeclampsia in vitro. β3 agonists already in human use for another purpose are potential candidates for re-purposing to treat preeclampsia.

Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity.

Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. One strategy involves administering Fms-like tyrosine kinase receptor 3 ligand (Flt3L), a vitally important cytokine for DC development. In this current study, the electroporation-mediated delivery of a novel albumin-fused Flt3L DNA (alb-Flt3L DNA) demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, TC-1-bearing-C57BL/6 mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration promoted robust DC and cDC1 expansion. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes were found in correlation to greater cDC1 population. Moreover, the toxicity of alb-Flt3L administration is limited. Collectively, our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA.

In silico and in vitro study of FLT3 inhibitors and their application in acute myeloid leukemia.

Acute myeloid leukemia (AML) is the most common hematological cancer in the adult population worldwide. Approximately 35% of patients with AML present internal tandem duplication (ITD) mutations in the FMS‑like tyrosine kinase 3 (FLT3) receptor associated with poor prognosis, and thus, this receptor is a relevant target for potential therapeutics. Tyrosine kinase inhibitors (TKIs) are used to treat AML; however, their molecular interactions and effects on leukemic cells are poorly understood. The present study aimed to gain insights into the molecular interactions and affinity forces of four TKI drugs (sorafenib, midostaurin, gilteritinib and quizartinib) with the wild‑type (WT)‑FLT3 and ITD‑mutated (ITD‑FLT3) structural models of FLT3, in its inactive aspartic acid‑phenylalanine‑glycine motif (DFG‑out) and active aspartic acid‑phenylalanine‑glycine motif (DFG‑in) conformations. Furthermore, the present study evaluated the effects of the second‑generation TKIs gilteritinib and quizartinib on cancer cell viability, apoptosis and proliferation in the MV4‑11 (ITD‑FLT3) and HL60 (WT‑FLT3) AML cell lines. Peripheral blood mononuclear cells (PBMCs) from a healthy volunteer were included as an FLT3‑negative group. Molecular docking analysis indicated higher affinities of second‑generation TKIs for WT‑FLT3/DFG‑out and WT‑FLT3/DFG‑in compared with those of the first‑generation TKIs. However, the ITD mutation changed the affinity of all TKIs. The in vitro data supported the in silico predictions: MV4‑11 cells presented high selective sensibility to gilteritinib and quizartinib compared with the HL60 cells, whereas the drugs had no effect on PBMCs. Thus, the current study presented novel information about molecular interactions between the FLT3 receptors (WT or ITD‑mutated) and some of their inhibitors. It also paves the way for the search for novel inhibitory molecules with potential use against AML.

Quizartinib: a new hope in acute myeloid leukemia, an applied comprehensive review.

Acute myeloid leukemia (AML) is caused by a defective precursor leading to malignant clonal expansion, often with FMS-like tyrosine kinase-3 receptor (FLT3) mutations, particularly internal tandem duplication (ITD), which has a poor prognosis. Quizartinib, a second-generation FLT3 inhibitor, has FDA approval for relapsed/refractory AML with FLT3/ITD mutation. It has shown promise in clinical studies since 2013 due to its excellent oral absorption and potent activity on FLT3. This review explores Quizartinib's mechanism of action, efficacy in monotherapy or combination with chemotherapy, drug interactions, adverse events, resistance mechanisms and future research directions.

Abstract P195: Vascular MAPK/ERK Activation in sFTL-1-Induced Preeclampsia In Vivo

Vascular endothelial growth factor (VEGF) inhibition is linked to the development of hypertension and proteinuria in preeclampsia. This occurs as anti-angiogenic factors from the placenta contribute to pregnancy-related hypertension disorder. Soluble VEGF receptor fms-like tyrosine kinase-1 (sFLT-1) is an anti-angiogenic factor that counteracts VEGF. Levels of sFLT-1 are three times higher in preeclamptic placentas compared to those from normotensive pregnancies, and plasma sFLT-1 levels increase with the severity of preeclampsia. Infusing sFLT-1 in rodents induces hypertension, proteinuria, and glomerular endotheliosis, resembling the human condition of preeclampsia. Currently, there is no effective pharmacological treatment of preeclampsia, and in severe cases, early delivery is often the only effective treatment. In this study, we aim to determine how sFLT-1 exposure affects the activation of the vascular MAPK/ERK pathway and the contractility of the aorta ex-vivo using wire myography, to assess if the MAPK/ERK pathway can be a therapeutic target in preeclampsia. To this end, we treated pregnant female C57BL/6 mice from embryonic day E7.5 to E18.5 with either sFLT-1 (3.7mg/kg/day) or vehicle (phosphate-buffered saline) delivered by osmotic minipumps (intraperitoneal) and carried out non-invasive tail-cuff blood pressure measurements. After sacrifice, we isolated descending thoracic aorta for isometric tension measurements in a wire myograph. Infusion of sFLT-1 resulted in marked systolic blood pressure (SBP) elevation (D increase of 14 mmHg, P=0.0003) and augmented aortic phosphorylated-ERK activation (2-fold increase, P=0.040) by western blot and displayed impaired acetylcholine-induced endothelial relaxation in thoracic aortic segments (P<0.05), providing in vivo evidence of increased vascular p-ERK activation, accompanied by higher SBP and endothelial dysfunction in sFLT-1 - indued mouse model of preeclampsia. Future experiments are aimed to test the effect of pharmacological ERK inhibition in sFLT-1 infusion in vivo . We hypothesize that sFLT-1-induced rise in SBP and vascular p-ERK could be prevented in vivo by treatment with the pharmacological ERK inhibitor.

Enhancing Therapeutic Efficacy of FLT3 Inhibitors with Combination Therapy for Treatment of Acute Myeloid Leukemia.

FMS-like tyrosine kinase 3 (FLT3) mutations are genetic changes found in approximately thirty percent of patients with acute myeloid leukemia (AML). FLT3 mutations in AML represent a challenging clinical scenario characterized by a high rate of relapse, even after allogeneic hematopoietic stem cell transplantation (allo-HSCT). The advent of FLT3 tyrosine kinase inhibitors (TKIs), such as midostaurin and gilteritinib, has shown promise in achieving complete remission. However, a substantial proportion of patients still experience relapse following TKI treatment, necessitating innovative therapeutic strategies. This review critically addresses the current landscape of TKI treatments for FLT3+ AML, with a particular focus on gilteritinib. Gilteritinib, a highly selective FLT3 inhibitor, has demonstrated efficacy in targeting the mutant FLT3 receptor, thereby inhibiting aberrant signaling pathways that drive leukemic proliferation. However, monotherapy with TKIs may not be sufficient to eradicate AML blasts. Specifically, we provide evidence for integrating gilteritinib with mammalian targets of rapamycin (mTOR) inhibitors and interleukin-15 (IL-15) complexes. The combination of gilteritinib, mTOR inhibitors, and IL-15 complexes presents a compelling strategy to enhance the eradication of AML blasts and enhance NK cell killing, offering a potential for improved patient outcomes.

Concomitant targeting of FLT3 and SPHK1 exerts synergistic cytotoxicity in FLT3-ITD+ acute myeloid leukemia by inhibiting β-catenin activity via the PP2A-GSK3β axis

BackgroundApproximately 25–30% of patients with acute myeloid leukemia (AML) have FMS-like receptor tyrosine kinase-3 (FLT3) mutations that contribute to disease progression and poor prognosis. Prolonged exposure to FLT3 tyrosine kinase inhibitors (TKIs) often results in limited clinical responses due to diverse compensatory survival signals. Therefore, there is an urgent need to elucidate the mechanisms underlying FLT3 TKI resistance. Dysregulated sphingolipid metabolism frequently contributes to cancer progression and a poor therapeutic response. However, its relationship with TKI sensitivity in FLT3-mutated AML remains unknown. Thus, we aimed to assess mechanisms of FLT3 TKI resistance in AML.MethodsWe performed lipidomics profiling, RNA-seq, qRT-PCR, and enzyme-linked immunosorbent assays to determine potential drivers of sorafenib resistance. FLT3 signaling was inhibited by sorafenib or quizartinib, and SPHK1 was inhibited by using an antagonist or via knockdown. Cell growth and apoptosis were assessed in FLT3-mutated and wild-type AML cell lines via Cell counting kit-8, PI staining, and Annexin-V/7AAD assays. Western blotting and immunofluorescence assays were employed to explore the underlying molecular mechanisms through rescue experiments using SPHK1 overexpression and exogenous S1P, as well as inhibitors of S1P2, β-catenin, PP2A, and GSK3β. Xenograft murine model, patient samples, and publicly available data were analyzed to corroborate our in vitro results.ResultsWe demonstrate that long-term sorafenib treatment upregulates SPHK1/sphingosine-1-phosphate (S1P) signaling, which in turn positively modulates β-catenin signaling to counteract TKI-mediated suppression of FLT3-mutated AML cells via the S1P2 receptor. Genetic or pharmacological inhibition of SPHK1 potently enhanced the TKI-mediated inhibition of proliferation and apoptosis induction in FLT3-mutated AML cells in vitro. SPHK1 knockdown enhanced sorafenib efficacy and improved survival of AML-xenografted mice. Mechanistically, targeting the SPHK1/S1P/S1P2 signaling synergizes with FLT3 TKIs to inhibit β-catenin activity by activating the protein phosphatase 2 A (PP2A)-glycogen synthase kinase 3β (GSK3β) pathway.ConclusionsThese findings establish the sphingolipid metabolic enzyme SPHK1 as a regulator of TKI sensitivity and suggest that combining SPHK1 inhibition with TKIs could be an effective approach for treating FLT3-mutated AML.

Double synergic chitosan-coated poly (lactic-co-glycolic) acid nanospheres loaded with nucleic acids as an intranasally administered vaccine delivery system to control the infection of foot-and-mouth disease virus

The spread of foot-and-mouth disease virus (FMDV) through aerosol droplets among cloven-hoofed ungulates in close contact is a major obstacle for successful animal husbandry. Therefore, the development of suitable mucosal vaccines, especially nasal vaccines, to block the virus at the initial site of infection is crucial. Here, we constructed eukaryotic expression plasmids containing the T and B-cell epitopes (pTB) of FMDV in tandem with the molecular mucosal adjuvant Fms-like tyrosine kinase receptor 3 ligand (Flt3 ligand, FL) (pTB-FL). Then, the constructed plasmid was electrostatically attached to mannose-modified chitosan-coated poly(lactic-co-glycolic) acid (PLGA) nanospheres (MCS-PLGA-NPs) to obtain an active nasal vaccine targeting the mannose-receptor on the surface of antigen-presenting cells (APCs). The MCS-PLGA-NPs loaded with pTB-FL not only induced a local mucosal immune response, but also induced a systemic immune response in mice. More importantly, the nasal vaccine afforded an 80% protection rate against a highly virulent FMDV strain (AF72) when it was subcutaneously injected into the soles of the feet of guinea pigs. The nasal vaccine prepared in this study can effectively induce a cross-protective immune response against the challenge with FMDV of same serotype in animals and is promising as a potential FMDV vaccine.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Landscape of FLT3 Variations Associated with Structural and Functional Impact on Acute Myeloid Leukemia: A Computational Study.

Acute myeloid leukemia (AML) is hallmarked by the clonal proliferation of myeloid blasts. Mutations that result in the constitutive activation of the fms-like tyrosine kinase 3 (FLT3) gene, coding for a class III receptor tyrosine kinase, are significantly associated with this heterogeneous hematologic malignancy. The fms-related tyrosine kinase 3 ligand binds to the extracellular domain of the FLT3 receptor, inducing homodimer formation in the plasma membrane, leading to autophosphorylation and activation of apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. In the present study, we evaluated the association of FLT3 as a significant biomarker for AML and tried to comprehend the effects of specific variations on the FLT3 protein's structure and function. We also examined the effects of I836 variants on binding affinity to sorafenib using molecular docking. We integrated multiple bioinformatics tools, databases, and resources such as OncoDB, UniProt, COSMIC, UALCAN, PyMOL, ProSA, Missense3D, InterProScan, SIFT, PolyPhen, and PredictSNP to annotate the structural, functional, and phenotypic impact of the known variations associated with FLT3. Twenty-nine FLT3 variants were analyzed using in silico approaches such as DynaMut, CUPSAT, AutoDock, and Discovery Studio for their impact on protein stability, flexibility, function, and binding affinity. The OncoDB and UALCAN portals confirmed the association of FLT3 gene expression and its mutational status with AML. A computational structural analysis of the deleterious variants of FLT3 revealed I863F mutants as destabilizers of the protein structure, possibly leading to functional changes. Many single-nucleotide variations in FLT3 have an impact on its structure and function. Thus, the annotation of FLT3 SNVs and the prediction of their deleterious pathogenic impact will facilitate an insight into the tumorigenesis process and guide experimental studies and clinical implications.

Safety and Pharmacokinetics of Quizartinib Combination Therapy With Standard Induction and Consolidation Chemotherapy in Patients With Newly Diagnosed Acute Myeloid Leukemia: Results from Two Phase 1 Trials in Japan and China.

Quizartinib is a potent, oral, second-generation, selective type II FMS-like receptor tyrosine kinase 3 (FLT3) inhibitor. It has shown improved overall survival in a randomized, multinational, Phase 3 (QuANTUM-First) study in patients with FLT3-internal tandem duplication (ITD)-positive newly diagnosed acute myeloid leukemia. We conducted 2 Phase 1b studies in Japan and China to evaluate the safety, pharmacokinetics, and efficacy of quizartinib in combination with standard induction and consolidation chemotherapy in patients with newly diagnosed acute myeloid leukemia. Quizartinib was started at a dose level of 20mg/day and then escalated to 40mg/day, the dose used in the Phase 3 study. Seven patients were enrolled according to the 3 + 3 dose-escalation method in each study, including 3 patients who were FLT3-ITD positive. No dose-limiting toxicities were observed at dose levels up to 40mg/day in both studies. Grade 3 or higher, quizartinib-related, treatment-emergent adverse events included febrile neutropenia, hematologic toxicities, and infections. QT prolongation on electrocardiogram was observed in 5 patients. The pharmacokinetics of quizartinib and its metabolite AC886 were similar between the studies and consistent with previous findings in the United States. We confirmed the tolerability of Japanese and Chinese patients to the dose of quizartinib and chemotherapy regimens used in the QuANTUM-First study.

Potentiating Gilteritinib Efficacy Using Nanocomplexation with a Hyaluronic Acid-Epigallocatechin Gallate Conjugate.

Acute myeloid leukemia carrying FMS-like tyrosine kinase receptor-3 (FLT3) mutations is a fatal blood cancer with a poor prognosis. Although the FLT3 inhibitor gilteritinib has recently been approved, it still suffers from limited efficacy and relatively high nonresponse rates. In this study, we report the potentiation of gilteritinib efficacy using nanocomplexation with a hyaluronic acid-epigallocatechin gallate conjugate. The self-assembly, colloidal stability, and gilteritinib loading capacity of the nanocomplex were characterized by reversed-phase high-performance liquid chromatography and dynamic light scattering technique. Flow cytometric analysis revealed that the nanocomplex efficiently internalized into FLT3-mutated leukemic cells via specific interactions between the surface-exposed hyaluronic acid and CD44 receptor overexpressed on the cells. Moreover, this nanocomplex was found to induce an eradication of the leukemic cells in a synergistic manner by elevating the levels of reactive oxygen species and caspase-3/7 activities more effectively than free gilteritinib. This study may provide a useful strategy to design nanomedicines capable of augmenting the therapeutic efficacy of FLT3 inhibitors for effective leukemia therapy.

Does a sFlt-1/PlGF ratio result > 655 before 34 weeks’ gestation necessitate preterm delivery within 2 days? A retrospective observational study

Introduction Preeclampsia is associated with adverse perinatal outcomes, including fetal growth restriction (FGR) and preterm delivery. The maternal serum ratio of soluble fms-like tyrosine kinase receptor-1 (sFlt-1) to placental growth factor (PlGF) can be used to evaluate placental dysfunction in cases of preeclampsia and FGR. A need for delivery within 2 days has been recommended for sFlt-1/PlGF ratios > 655 (normal ratio < 38) measured before 34 weeks’ gestation. However, few studies have assessed this recommendation in a real-world setting and there remains a need for further evidence-based guidance on the use of the ratio in delivery timing planning in this situation. Aim To assess the need for delivery within 2 days associated with sFlt-1/PlGF ratios > 655 before 34 weeks’ gestation. Methods A retrospective audit of all sFlt-1/PlGF ratio test results obtained at a single maternity hospital between September 2016 and November 2022. The primary outcome was time to delivery after recording a ratio > 655 in patients with a pregnancy between 20 + 0 and 33 + 6 weeks’ gestation. Statistical analysis was performed using IBM SPSS Statistics v29.0.0.0. Results During the study period a total of 33 patients with suspected or confirmed preeclampsia and/or FGR recorded sFlt-1/PlGF ratios > 655 before 34 + 0 weeks’ gestation. Amongst cases with ratios > 655, median time to delivery was 4 days (IQR 1.0–9.0), with 14 (42.4%) delivering in ≤ 2 days, 8 (24.2%) delivering between 2 and 7 days and 11 (33.3%) delivering after 7 days. A significant inverse correlation was observed between time to delivery and gestational age at the time of ratio testing (rs = −0.484, p = 0.004). Discussion This study provides updated recommendations on the use of the sFlt-1/PlGF ratio in predicting the risk of imminent delivery amongst those with high ratios > 655 measured before 34 weeks’ gestation. Our results suggest that the risk of imminent delivery can be stratified based on ratio level and gestational age, which in combination with the results of other clinical assessments, can be used to plan delivery timing and allow for considerations of fetal lung maturing corticosteroid and neuroprotective magnesium sulfate therapies prior to delivery.

The Protective Role of Tubular Epithelial Cells Produced Fms-like Tyrosine Kinase Receptor 3 Ligand in Acute Kidney Injury

Introduction: Dendritic cells (DC) accumulate in the kidneys of patients with acute kidney injury (AKI), but the Fms-like tyrosine kinase receptor 3 ligand (Flt3L)-dendritic cell axis is poorly defined in kidneys with AKI. Meanwhile it has not been reported whether Flt3L is produced by kidney cells under ischemic-reperfusion injury (IR) induced microenvironment. Methods: (1) Blood specimens and urine were collected from two patient cohorts: a) patients with pre-renal AKI and healthy controls for analysis of serum Flt3L. b) patients with acute myocardial infarction (AMI) developed with or without AKI on admission for analysis of serum and urine Flt3L. (2) Wild type mice and T cell-deficient mice ( Tcra -/- mice) were applied. IR induced AKI mice and hypoxia-reoxygenation stimulated HK-2 cell line (human tubular epithelial cell line) were constructed. The expression of Flt3L in kidney, tubular epithelial cells, and T cells were measured by RT-PCR, ELISA, immunohistochemistry, immunofluorescence staining, RNAscope, and flow cytometry. (3) Wild type mice and type I conventional dendritic cell (cDC1)-deficient mice ( Irf8 -/- mice) were treated with 15 μg rFlt3L or 10mg/kg gilteritinib (Flt3 inhibitor). They were subjected to IR. Serum and kidney tissues were collected. Kidney function, tubular injury, and DC accumulation were quantified. Results: Initially, among patients with pre-renal AKI, we observed an increased level of serum Flt3L within two days after admission. Another patient cohort revealed that this increase was specific for AMI patients with AKI rather than without AKI or healthy controls. Furthermore, among these AMI patients, serum Flt3L levels correlated with Creatinine increase (R 2 = 0.4532, p = 0.0002) and BUN increase (R 2 = 0.3417, p = 0.0017) within 48 hours after admission. Similarly, urine Flt3L levels among these AMI patients also steadily elevated with Creatinine increase (R 2 = 0.6395, p &amp;lt; 0.0001) and BUN increase (R 2 = 0.5115, p = &amp;lt; 0.0001) within 48 hours after admission. Flt3L was also enhanced in wild type mice with IR-AKI but not affected in T cell-deficient mice ( Tcra -/-) with IR-AKI. Among kidney tissue, Flt3L-positive cells scattered within tubules in outer stripe of the outer medulla (OSOM) and mRNA and protein increased within 24 hours after IR-AKD. In vitro, FLT3L mRNA was markedly induced in HK-2 cells during hypoxia and FLT3L protein remained enhanced during reoxygenation. Phenotypically, the numbers of renal cDC1 and CD64 +DC were significantly decreased in gilteritinib-treated IR-AKI mice, which were associated with more severe tubular injury. With reduced kidney cDC1, Irf8 -/- mice also showed worsen kidney injury and aggravated functional failure upon IR-AKI. Therapeutic administration of rFlt3L significantly increased kidney cDC1 and CD64 +DC upon IR-AKI in wild type but not Irf8 -/- mice. This was associated with significantly reduced tubular injury of wild type mice .In addition, pre-treatment of wild type mice with rFlt3L increased kidney cDC1 and protected the mice from severe IR-AKI. Conclusion: Flt3L is upregulated in human and mice and produced by tubular epithelial cells during IR-AKI. It fosters the accumulation of kidney cDC1 and CD64 +DC, thereby limiting the severity of kidney injury in mice. The current study implies the possibility of DC-based immunotherapy for treatment of AKD.

Transient TKI-resistant CD44+pBAD+ blasts undergo intrinsic homeostatic adaptation to promote the survival of acute myeloid leukemia in vitro.

Acute myeloid leukemia (AML) patients have frequent mutations in FMS-like receptor tyrosine kinase 3 (FLT3-mut AML), who respond poorly to salvage chemotherapies and targeted therapies such as tyrosine kinase inhibitors (TKIs). Disease relapse is a common reason of treatment failures in FLT3-mut AML patients, but its intracellular refractory mechanism remains to be discovered. In this study, we designed serial in vitro time-course studies to investigate the biomarkers of TKI-resistant blasts and their survival mechanism. First, we found that a group of transient TKI-resistant blasts were CD44+Phosphorylated-BAD (pBAD)+ and that they could initiate the regrowth of blast clusters in vitro. Notably, TKI-treatments upregulated the compensation pathways to promote PIM2/3-mediated phosphorylation of BAD to initiate the blast survival. Next, we discovered a novel process of intracellular adaptive responses in these transient TKI-resistant blasts, including upregulated JAK/STAT signaling pathways for PIM2/3 expressions and activated SOCS1/SOCS3/PIAS2 inhibitory pathways to down-regulate redundant signal transduction and kinase phosphorylation to regain intracellular homeostasis. Finally, we found that the combination of TKIs with TYK2/STAT4 pathways-driven inhibitors could effectively treat FLT3-mut AML in vitro. In summary, our findings reveal that TKI-treatment can activate a JAK/STAT-PIM2/3 axis-mediated signaling pathways to promote the survival of CD44+pBAD+blasts in vitro. Disrupting these TKIs-activated redundant pathways and blast homeostasis could be a novel therapeutic strategy to treat FLT3-mut AML and prevent disease relapse in vivo.

Shikonin Exerts an Antileukemia Effect against FLT3-ITD Mutated Acute Myeloid Leukemia Cells via Targeting FLT3 and Its Downstream Pathways

Introduction: Acute myeloid leukemia (AML) with internal tandem duplication (ITD) mutations in Fms-like tyrosine kinase 3 (FLT3) has an unfavorable prognosis. Recently, using newly emerging inhibitors of FLT3 has led to improved outcomes of patients with FLT3-ITD mutations. However, drug resistance and relapse continue to be significant challenges in the treatment of patients with FLT3-ITD mutations. This study aimed to evaluate the antileukemic effects of shikonin (SHK) and its mechanisms of action against AML cells with FLT3-ITD mutations in vitro and in vivo. Methods: The CCK-8 assay was used to analyze cell viability, and flow cytometry was used to detect cell apoptosis and differentiation. Western blotting and real-time polymerase chain reaction were used to examine the expression of certain proteins and genes. Leukemia mouse model was created to evaluate the antileukemia effect of SHK against FLT3-ITD mutated leukemia in vivo. Results: After screening a series of leukemia cell lines, those with FLT3-ITD mutations were found to be more sensitive to SHK in terms of proliferation inhibition and apoptosis induction than those without FLT3-ITD mutation. SHK suppresses the expression and phosphorylation of FLT3 receptors and their downstream molecules. Inhibition of the NF-κB/miR-155 pathway is an important mechanism through which SHK kills FLT3-AML cells. Moreover, a low concentration of SHK promotes the differentiation of AML cells with FLT3-ITD mutations. Finally, SHK could significantly inhibit the growth of MV4-11 cells in leukemia bearing mice. Conclusion: The findings of this study indicate that SHK may be a promising drug for the treatment of FLT3-ITD mutated AML.

Association between adverse pregnancy outcome and placental biomarkers in the first trimester: A prospective cohort study.

To determine the inter-relationships between five first-trimester biomarkers (pregnancy associated plasma protein A [PAPP-A], alpha-fetoprotein [AFP], beta human chorionic gonadotrophin [beta-hCG], placenta growth factor [PlGF] and soluble fms-like tyrosine kinase receptor-1 [sFlt-1]) and a range of adverse pregnancy outcomes (APOs). Prospective cohort study of nulliparous singleton pregnancy. Cambridge, UK. 4056 pregnancy outcome prediction study participants. The biomarker concentrations were measured in maternal serum at ~12 weeks of gestation. Univariable analysis of APOs was performed using logistic regression. Multivariable analysis used best subsets logistic regression with cross-validation. Pre-eclampsia (PE), small for gestational age (SGA), including severe SGA (birthweight <3rd), fetal growth restriction (FGR), preterm birth (PTB, both induced and spontaneous [iPTB and sPTB, respectively]), pre-viable loss and stillbirth, plus combinations of outcomes. Lower values of PAPP-A, PlGF and sFlt-1 and higher values of AFP were associated with FGR (OR for 1 SD higher value 0.59 [95% CI 0.48-0.74], OR 0.56 [95% CI 0.44-0.70], OR 0.68 [95% CI 0.54-0.87] and OR 1.53 [95% CI 1.25-1.88]), severe SGA (OR0.59 [95% CI 0.49-0.72], OR 0.71 [95% CI 0.57-0.87], OR 0.74 [95% CI 0.60-0.91] and OR 1.41 [95% CI 1.17-1.71]), sPTB (OR 0.61 [95% CI 0.50-0.73], OR 0.79 [95% CI 0.66-0.96], OR 0.57 [95% CI 0.47-0.70] and OR 1.41 [95% CI 1.18-1.67]) and iPTB (OR 0.72 [95% CI 0.57-0.91], OR 0.62 [95% CI 0.49-0.78], OR 0.71 [95% CI 0.56-0.90] and OR 1.44 [95% CI 1.16-1.78]), respectively. When combinations of biomarkers were assessed, PAPP-A and AFP were independently associated with severe SGA; PAPP-A alone with PE + PTB; PlGF alone with severe PE; PlGF, beta-hCG, AFP and PAPP-A with the combination of PE and SGA; AFP and sFlt-1 with sPTB; and AFP and PlGF with iPTB. Combinations of first-trimester placental biomarkers are associated with APOs. However, the patterns vary for different types of APO, indicating heterogeneity in the underlying pathophysiological pathways.