Fms-like Tyrosine Kinase Research Articles

A Second Trimester Prediction Algorithm for Early-Onset Hypertensive Disorders of Pregnancy Occurrence and Severity Based on Soluble fms-like Tyrosine Kinase 1 (sFlt-1)/Placental Growth Factor (PlGF) Ratio and Uterine Doppler Ultrasound in Women at Risk.

Hypertensive disorders of pregnancy (HDPs) represent a significant source of severe maternal and fetal morbidity. Screening strategies relying on traditional medical history and clinical risk factors have traditionally shown relatively modest performance, mainly in the prediction of preeclampsia, displaying a sensitivity of 37% for the early-onset form and 29% for the late-onset form. The development of more accurate predictive and diagnostic models of preeclampsia in the early stages of pregnancy represents a matter of high priority. The aim of the present paper is to create an effective second trimester prediction algorithm of early-onset HDP occurrence and severity, by combining the following two biochemical markers: a soluble fms-like tyrosine kinase 1 (sFlt-1)/placental growth factor (PlGF) ratio and uterine artery Doppler ultrasound parameters, namely the pulsatility index (PI) and the resistivity index (RI), in a population of high-risk pregnant women, initially assessed through traditional risk factors. A prospective single-center observational longitudinal study was conducted, in which 100 women with singleton pregnancy and traditional clinical and medical history risk factors for preeclampsia were enrolled at 24 weeks of gestation. Shortly after study enrollment, all women had their sFlt-1 and PlGF levels and mean uterine artery PI and RI determined. All pregnancies were followed up until delivery. Receiver operating characteristic (ROC) analysis established algorithms based on cutoffs for the prediction of the later development of preeclampsia: PI 1.25 (96.15% sensitivity, 86.49% specificity), RI 0.62 (84.6% sensitivity, 89.2% specificity) and sFlt-1/PlGF ratio 59.55 (100% sensitivity, 89.2% specificity). The sFlt-1/PlGF ratio was the best predictor for preeclampsia, as it displayed the highest area under the curve (AUC) of 0.973. The prediction algorithm for the severe form of preeclampsia, complicated by fetal growth restriction leading to preterm birth, antepartum fetal demise or acute fetal distress with a cerebro-placental ratio of <one consisted of the following cutoffs: PI 1.44 (93.75% sensitivity, 95.24% specificity), RI 0.69 (87.5% sensitivity, 100% specificity) and sFlt-1/PlGF ratio 102.74 (93.75% sensitivity, 95.2% specificity). These algorithms may significantly enhance the prediction accuracy of preeclampsia compared to traditional risk factors. The combination of the sFlt-1/PlGF ratio with mean uterine PI and RI in particular displayed an improved performance in the prediction of severe preeclampsia with the above-mentioned complications, compared to the biochemical markers or uterine Doppler parameters used alone. Therefore, HDP screening strategies should increasingly focus on implementing such algorithms for women who are initially regarded as high risk based on traditional risk factors, in order to properly diagnose HDP and properly limit or manage the later maternal and fetal complications.

Structure-Based Optimization of Pyrazinamide-Containing Macrocyclic Derivatives as Fms-like Tyrosine Kinase 3 (FLT3) Inhibitors to Overcome Clinical Mutations.

Secondary mutations in Fms-like tyrosine kinase 3-tyrosine kinase domain (FLT3-TKD) (e.g., D835Y and F691L) have become a major on-target resistance mechanism of FLT3 inhibitors, which present a significant clinical challenge. To date, no effective drugs have been approved to simultaneously overcome clinical resistance caused by these two mutants. Thus, a series of pyrazinamide macrocyclic compounds were first designed and evaluated to overcome the secondary mutations of FLT3. The representative 8v exhibited potent inhibitory activities against FLT3D835Y and FLT3D835Y/F691L with IC50 values of 1.5 and 9.7 nM, respectively. 8v also strongly suppressed the proliferation against Ba/F3 cells transfected with FLT3-ITD, FLT3-ITD-D835Y, FLT3-ITD-F691L, FLT3-ITD-D835Y-F691L, and MV4-11 acute myeloid leukemia (AML) cell lines with IC50 values of 12.2, 10.5, 24.6, 16.9, and 6.8 nM, respectively. Furthermore, 8v demonstrated ideal anticancer efficacy in a Ba/F3-FLT3-ITD-D835Y xenograft model. The results suggested that 8v can serve as a promising macrocycle-based FLT3 inhibitor for the treatment of AML.

Abstract CT150: Trial in progress: A phase 1b single-arm, open-label, study of emavusertib (CA-4948) in combination with azacitidine and venetoclax in acute myeloid leukemia patients in complete response with measurable residual disease

Abstract Background: Emavusertib is a novel potent oral inhibitor of interleukin-1 receptor-associated kinase 4 (IRAK4) with additional inhibitory activity against FMS-like tyrosine kinase 3 (FLT3) and CDC-like kinases (CLK1/2/4). Inhibition of these onco-proteins may induce remission thereby addressing a critical unmet need for novel therapies in acute myeloid leukemia (AML). Clinical studies with emavusertib monotherapy have demonstrated a significant reduction in AML blasts with clinical and molecular responses, including patients with relapsed or refractory AML, previously treated with an HMA and/or FLT3 inhibitors (Metzeler 2022). Azacitidine + venetoclax (aza+ven) has been approved in newly diagnosed, unfit patients with AML. In the VIALE-A study, composite complete response (CRc) (CR, CRh, or CRi) in the absence of measurable residual disease (MRD) of &amp;lt;1 residual blast/1000 leukocytes (MRD negative [MRD−]) resulted in longer duration of response (DOR), event-free survival, and overall survival (OS), and better HSCT outcome compared with patients who achieved CRc but were MRD+ (Pratz, 2022). In pre-clinical studies, emavusertib in combination with aza+ven demonstrated synergistic antileukemic effects in AML cell lines, including azacitidine- or venetoclax-resistant cell lines. Adding emavusertib to aza+ven in MRD+ patients at the time of CR may convert MRD status without adding significant toxicity and confirm that emavusertib can be safely added to aza+ven as a potential new regimen in front-line therapy. Study Design: This is a single-arm, open-label Phase 1b trial evaluating safety and tolerability, PK, and conversion of MRD status with emavusertib as an add-on agent to aza+ven in AML patients who achieved CR or CRh with MRD+ based on local testing (EU CT Number 2023-505828-58-00). The primary objective of the study is to determine a safe and tolerable dosing schedule for the triple combination. Secondary objectives include MRD conversion rate, DOR, OS, and pharmacokinetics. The study will enroll approximately 24 patients at 5 to 10 sites globally. Patients will have received azacitidine and venetoclax as first line therapy and achieved CR or CRh after 1-6 cycles of aza/ven. If MRD status remains positive, emavusertib will be added to the existing well tolerated aza+ven regimen. The starting emavusertib dose is 200 mg BID for 7 days per cycle of 28 days. If well tolerated, duration of emavusertib treatment will be extended to 14 and 21, respectively; no intra-patient change of emavusertib dosing duration is planned. The patients will continue triple treatment (emavusertib+aza+ven) until consent withdrawal, disease progression, intolerable toxicity, or not achieving MRD- within 6 cycles of triple treatment. In this Phase 1b trial, MRD can be evaluated by local testing of bone marrow. Key exclusion criteria include residual toxicities and significant comorbidities. Citation Format: Reinhard von Roemeling, Adolfo De La Fuente, Claudio Cerchione, Sebastian Scholl, Jan Moritz Middeke, Gaurav S. Choudhary, Maria Lamar, Steven Angelides, Uwe Platzbecker. Trial in progress: A phase 1b single-arm, open-label, study of emavusertib (CA-4948) in combination with azacitidine and venetoclax in acute myeloid leukemia patients in complete response with measurable residual disease [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 2 (Late-Breaking, Clinical Trial, and Invited Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(7_Suppl):Abstract nr CT150.

In Situ Hydrogel ModulatescDC1-Based Antigen Presentation and Cancer Stemness to Enhance Cancer Vaccine Efficiency.

Effective presentation of antigens by dendritic cells (DC) is essential for achieving a robust cytotoxic T lymphocytes (CTLs) response, in which cDC1 is the key DC subtype for high-performance activation of CTLs. However, low cDC1 proportion, complex process, and high cost severely hindered cDC1 generation and application. Herein, the study proposes an in situ cDC1 recruitment and activation strategy with simultaneous inhibiting cancer stemness for inducing robust CTL responses and enhancing the anti-tumor effect. Fms-like tyrosine kinase 3 ligand (FLT3L), Poly I:C, and Nap-CUM (NCUM), playing the role of cDC1 recruitment, cDC1 activation, inducing antigen release and decreasing tumor cell stemness, respectively, are co-encapsulated in an in situ hydrogel vaccine (FP/NCUM-Gel). FP/NCUM-Gel is gelated in situ after intra-tumoral injection. With the near-infrared irradiation, tumor cell immunogenic cell death occurred, tumor antigens and immunogenic signals are released in situ. cDC1 is recruited to tumor tissue and activated for antigen cross-presentation, followed by migrating to lymph nodes and activating CTLs. Furthermore, tumor cell stemness are inhibited by napabucasin, which can help CTLs to achieve comprehensive tumor killing. Collectively, the proposed strategy of cDC1 in situ recruitment and activation combined with stemness inhibition provides great immune response and anti-tumor potential, providing new ideas for clinical tumor vaccine design.

Prognostic impact of inhibitors of DNA binding proteins1 and inhibitors of DNA binding proteins4 genes expression on adult Egyptian patients with acute myeloid leukemia

Background Acute myeloid leukemia (AML) pathogenesis and treatment are currently being better understood at an accelerated rate. Determining genetic and epigenetic changes that can identify patients who are at risk of poor outcomes is therefore desired to optimize treatment options. Many solid tumors have been reported to overexpress Inhibitors of DNA binding proteins (ID1), but few research has looked at the clinical significance of ID1 expression in AML. Additionally, little research has been focused on the direct role of ID4 in myeloid malignancies, as well as its expression and methylation patterns. The aim of the current study was to assess ID1 and ID4 gene expression in bone marrow (BM) aspiration specimens of 91 AML patients, compared with 14 control donors of bone marrow transplantation (BMT), using real-time polymerase chain reaction (RT-PCR). Data were correlated with patients’ clinicopathological features, response to treatment, disease-free survival (DFS), and overall survival (OS) rates. Results ID1 transcript level was significantly increased in AML bone marrow samples compared with normal controls (P = 0.002), while ID4 gene expression showed a nonsignificant difference (P = 0.717). In addition, there was a significant increase in ID1 gene expression in fms-like tyrosine kinase 3 (FLT3) mutant group than fms-like tyrosine kinase 3 wild group (P = 0.010). The total leukocytic count (TLC) was significantly higher in patients with high ID1 expression (P = 0.038) and patients with undetected ID4 expression (P = 0.025). No significant associations were detected between ID1 and ID4 expression levels and patients’ clinicopathological characteristics and OS rates. Conclusion In contrast to ID4, overexpressed ID1 can be adopted as a genetic biomarker for diagnosing AML. ID1 and ID4 expressions did not affect the patients’ OS or DFS.

Abstract 1966: The FLT3 tyrosine kinase receptor ITD mutation controls its expression and drug resistance in acute myeloid leukemia

Abstract In approximately 23% of AML patients, Fms-like tyrosine kinase 3 (FLT3) contains a gain-of-function, internal tandem duplication (ITD) mutation that is associated with an unfavourable prognosis. FLT3 is therefore seen as a promising therapeutic avenue for AML and as a result, a more complete understanding of its function and signalling may lead to additional targets and resistance mechanisms being identified. To date, several FLT3 inhibitors including Quizartinib (AC220), a second-generation ITD-selective tyrosine kinase inhibitor, have been developed, but single-agent clinical trials have not been overwhelmingly successful. In most preclinical studies, the inhibitory effects of FLT3 inhibitors are mainly evaluated using mutant-expressing models, however, most AML patients harbour both a wild-type and mutant FLT3 allele as well as presenting with high plasma levels of FLT3 ligand (FLT3L). We hypothesized that FLT3L could act through WT-FLT3 to influence the efficacy of FLT3 inhibitors in cells with heterozygous mutations. In this study, we have examined the role of FLT3 inhibition and FLT3L activation on the cellular localisation and downstream signalling in several AML cell lines, some of which express ITD mutations. We also looked at mechanisms by which FLT3L could impair the efficacy of FLT3 inhibitors. Our results revealed that the majority of FLT3 in the MV4-11 and MOLM-13 cells was intracellular. Inhibition of ITD-FLT3 with quizartinib led to a dramatic relocalisation of FLT3 to the cell surface. This effect was more pronounced in MV4-11 (FLT3ITD/ITD) than the heterozygous MOLM-13 (FLT3ITD/WT) cells that also express WT. This was accompanied by inhibition of ERK, AKT and STAT5 signalling pathways and resulted in cell death. Quizartinib induced cell death only in AML lines expressing FLT3-ITD mutations (MOLM-13 and MV4-11), and this could be antagonised by FLT3 ligand (FLT3L). The largest inhibitory effects were seen in heterozygous cells expressing a mutated and wild-type allele. FLT3 inhibition was associated with downregulation of the anti-apoptotic protein Mcl1 and upregulation of the pro-apoptotic BH3-only protein, Bim. Our experiments indicated that both of these proteins were regulated by both WT and ITD-FLT3 through the MAPK pathway. These results suggest that activation of FLT3 signalling by FLT3L confers resistance to quizartinib through upregulation of Mcl-1 and suppression of Bim expression. Taken together, our data suggest that FLT3 cell surface localisation and expression are controlled by ITD mutations and are key components of drug resistance. The data also suggests a novel therapeutic approach in patients with high plasma FLT3L levels, especially when using type II inhibitors such as quizartinib, is to co-target the MAPK/ERK pathway to abrogate the FLT3Lmediated resistance in FLT3-ITD AML. Citation Format: Taha Alqahtani, David MacEwan. The FLT3 tyrosine kinase receptor ITD mutation controls its expression and drug resistance in acute myeloid leukemia [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1966.

Abstract 617: BH-30236, a novel macrocyclic CLK inhibitor modulating RNA splicing, demonstrates potent inhibition of cancer cell growth in a broad panel of cancer cell lines

Abstract Alternative splicing (AS) is a primary mechanism for mRNA transcript diversification and protein expression regulation. In cancer, altered mRNA splicing promotes oncogenic transformation, induces metastasis, and confers resistance to cancer treatment. Mutations or imbalanced expression/activity of splicing factors (SF), such as serine-arginine-rich SFs (SRSFs), often result in deregulation of RNA splicing and tumor progression. CDC2-like kinases (CLK) and dual-specificity tyrosine-regulated kinase (DYRK) are key regulators of AS via phosphorylation of SRSFs. BH-30236 is a novel macrocyclic ATP-competitive inhibitor of CLK1/2/4. It also inhibits DYRK1/2, provirus integration site for moloney leukemia virus 3 (PIM3) and FMS-like tyrosine kinase 3 (FLT3) at clinically relevant concentrations. The inhibitory activity of BH-30236 against CLK, DYRK, PIM3 and FLT3 in cancer cells was investigated via the phosphorylation inhibition of SRSFs, Tau, 4EBP1 and FLT3, respectively. A panel of 119 hematological and solid tumor cell lines were used to investigate the spectrum of BH-30236 against cancer cell growth. To understand the mechanism of anti-cancer cell growth, the effect of BH-30236 on AS and protein expression of key tumor related biomarkers were examined. In conclusion, BH-30236 effectively inhibited pSRSF (IC50 40-60 nM in IMR-32 cells), pTau (IC50 ~50 nM in SH-SY5Y cells), p4EBP1 (IC50 ~80 nM in MM1S cells) and pFLT3-ITD (IC50 0.16 nM in MV-4-11 cells). BH-30236 demonstrated broad inhibition of cancer cell growth with a median IC50 of 85.2 nM (range 0.55-393 nM) across 12 tumor types. BH-30236 showed great efficacy against cell lines derived from hematological malignancy (median IC50 23.34 nM), neuroblastoma (median IC50 25.73 nM), breast cancer (median IC50 83.80 nM), colon cancer (median IC50 85.17 nM), and lung cancer (median IC50 102.65 nM). Furthermore, BH-30236 demonstrated synergy with KRAS inhibitors in KRAS mutant cell lines, with EGFR inhibitors in RBM10 mutant H1975 cells, and with BCL2 inhibitor Venetoclax in MOLM-13 cells. Mechanistically, BH-30236 modulated AS by increasing pro-apoptotic and anti-proliferative splicing variants of key factors, such as BCL2L1, S6K, and BCLAF1. Meanwhile, BH-30236 downregulated RNA expression of SRSFs and modulated BCL2 family to increase apoptosis. These results strongly support the clinical applications of the novel multikinase CLK inhibitor BH-30236 in hematological malignancies and solid tumors as a single agent or in combination with other therapies. Citation Format: Ping Jiang, Danan Li, Nancy Ling, Dayong Zhai, Wei Deng, Eugene Rui, J. Jean Cui. BH-30236, a novel macrocyclic CLK inhibitor modulating RNA splicing, demonstrates potent inhibition of cancer cell growth in a broad panel of cancer cell lines [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 617.

Abstract 5944: Discovery of BH-30236: A novel macrocyclic CLK inhibitor targeting alternative splicing in cancers

Abstract Aberrant alternative splicing is a newly recognized hallmark of cancer, that has been shown to play a critical role in tumorigenesis, cancer progression, and therapeutic resistance via multiple mechanisms, including increased proliferation, decreased apoptosis, promoted migration, enhanced metastatic potential, and induced evasion of immune surveillance. Serine and arginine-rich splicing factors (SRSFs) are RNA-binding proteins (RBPs) that regulate constitutive and alternative splicing. SRSFs are often mutated or overexpressed in cancers, resulting in widespread alterations in splicing patterns. The Cdc2-like kinase (CLK) family and dual-specificity tyrosine-regulated kinase (DYRK) phosphorylate SRSFs, influencing the assembly of spliceosome machinery, exon recognition, and splicing. Therefore, targeting CLK/DYRK kinases can modulate cancer specific splicing isoforms, opening avenues for new therapeutic interventions. BH-30236 was designed as a novel orally bioavailable, ATP-competitive, macrocyclic inhibitor of CLK with IC50s of 0.134, 0.165, and 0.446 nM against CLK1, CLK2, and CLK4, respectively in enzymatic kinase assays. At clinically relevant concentrations, BH-30236 also inhibited DYRK1A/1B/2, proviral insertion site of moloney murine leukemia virus kinase 3 (PIM3), and FMS-like tyrosine kinase 3 (FLT3) with IC50s of 0.111, 0.148, 0.562, 0.115 and 0.248 nM, respectively. In cancer cells, BH-30236 impaired the phosphorylation of SRSFs, Tau and 4EBP1, the direct downstream substrates of CLK, DYRK, and PIM kinases with IC50s of 40-60 nM, ~50 nM, and ~80 nM, respectively. Furthermore, BH-30236 potently inhibited the FLT3 phosphorylation with an IC50 of 0.16 nM. Overall, BH-30236 regulated alternative splicing by primarily inducing skipped exons in favor of anti-tumor isoforms, leading to cancer cell death and growth suppression in a broad panel of cancer cell lines and in vivo efficacy studies. For example, BH-30236 potently inhibited cell proliferation with an IC50 of 0.62 nM in FLT3-ITD positive MV-4-11 cells and achieved complete tumor regression in the MV-4-11 cell-derived xenograft tumor model, even after dose cessation for 4 weeks. In MV-4-11 cells, BH-30236 increased pro-apoptosis splicing variant BCLxS, downregulated RNA expression of BCL2, MCL1, and AML stem cell markers CD33 and CD123. In addition, BH-30236 has demonstrated good human ADME and preclinical safety profiles. Collectively, the preclinical study results strongly support the clinical applications of the novel multikinase CLK inhibitor BH-30236 in hematological malignancies and solid tumors, as a single agent or in combination with other therapies. Citation Format: J. Jean Cui, Ping Jiang, Wei Deng, Dayong Zhai, Nancy Ling, Danan Li, Zhenping Wang, Yue Hu, Levan Darjania, Jeff Whitten, Evan Rogers, Eugene Rui. Discovery of BH-30236: A novel macrocyclic CLK inhibitor targeting alternative splicing in cancers [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5944.

Abstract 429: A novel regulatory role of FLT3/ITD mutation in lipid metabolism of leukemia cells: The mechanism and therapeutic implications

Abstract Internal tandem duplication in FMS-like tyrosine kinase 3 (FLT3/ITD), is a common type of activating mutation and frequently detected in AML. FLT3/ITD is associated with poor prognosis of AML. In this study, we investigated the regulation of FLT3/ITD mutation on sterol regulatory element-binding protein (SREBP) and the therapeutic vulnerabilities of lipid metabolism in FLT3/ITD leukemia. With the transcriptomics analysis we found that FLT3/ITD controlled lipid metabolism via the transcription factor SREBP. The analysis of TCGA_LAML dataset revealed that a gene signature involved in fatty acid and cholesterol metabolism, which is regulated by SREBP, was upregulated in FLT3/ITD patients compared with FLT3/wild-type patients. The upregulation of SREBP protein expression in FLT3/ITD leukemia was confirmed using a genetically engineered mouse model. We further demonstrated that FLT3/ITD regulates the protein degradation of SREBP through the PI3K/AKT-GSK3β axis. The metabolomics analysis further showed that FLT3/ITD primarily regulates glycerophospholipid synthesis, which contribute to the key structure lipid in the membrane, specifically, the cardiolipin. Moreover, pharmacologic inhibition of SREBP activation and its downstream enzyme fatty acid synthase (FASN) sensitized FLT3-ITD AMLs to the treatment of FLT3 inhibitor quizartinib. Collectively, our findings reveal a novel regulation of FLT3-ITD in metabolic reprogramming and indicate a targetable vulnerability in a subset of refractory leukemia. Citation Format: Yumin Hu, Feng Yin, Mingyue Zhao, Wenhua Lu, Tiantian Yu. A novel regulatory role of FLT3/ITD mutation in lipid metabolism of leukemia cells: The mechanism and therapeutic implications [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 429.

Abstract 3115: Systematic analysis of gene mutations and therapeutic efficacy via ex vivo hematological vitroscreen platform

Abstract Acute myeloid leukemia (AML) is a common hematological malignancy found in adult patients, and FMS-like tyrosine kinase 3 gene (FLT3) mutation occurs in about 30% of patients. In 2019, a phase 3 clinical trial suggested that gilteritinib treatment resulted in significantly longer survival than salvage chemotherapy in relapsed or refractory FLT3-mutated AML patients. Targeting FLT3-mutants in AML has become one of the important therapeutic strategies in this decade. The ex vivo hematological VitroScreen platform provides a powerful tool to evaluate the performance of FLT3 inhibitors and other test articles. With Champions Oncology’s primary hematological repository (https://www.championsoncology.com/hematological-vitroscreen) and proprietary LUMIN Bioinformatics platform, we classified models based on patient responses, clinical annotation, NGS data, and cell surface markers. In this Ex vivo study, we tested gilteritinib in 30 AML patients, and 8 of models were identified as FLT-3 mutants’ carrier. Fold changes of cell viability after gilteritinib treatment were assessed based on quantitation of the ATP present. FLT3-mutants models showed significantly higher sensitivity to gilteritinib than FLT3-WT models (IC50, 132.56 nM vs. 234.16nM) in a 6-day assay. Only 25% of models in the FLT3-mutants group had higher IC50 than the average of all AML models (n=28, IC50 = 204.05 nM), compared to 53% in the FLT3-WT group. Our preclinical data highly match the observations in previous clinical trials, which suggest that VitroScreen is a reliable high throughput tool for drug development of drug resistant cancers. Citation Format: Fu-Ju Chou, Stefano Cairo, Mara Gilardi, Abhay Andar, Karin Abarca-Heidemann, Maria Mancini. Systematic analysis of gene mutations and therapeutic efficacy via ex vivo hematological vitroscreen platform [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3115.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Abstract 6751: In situ vaccination with Flt3l gene modified CD103+ type 1 conventional dendritic cells synergizes with anti-PD-1 checkpoint blockade in murine models of non-small cell lung cancer

Abstract A major hurdle in treatment of Non-Small Cell Lung Cancer (NSCLC) with anti-PD-1 immune checkpoint blockade (ICB) therapy is a lack of response (primary resistance) and relapse after an initial response (acquired resistance). Recent studies reveal that responses to PD-1/PD-L1 blockade are associated with high tumor mutational burden (TMB), increased CD8+ T cell infiltration and high baseline PD-L1 expression within the tumor microenvironment (TME), while impaired tumor antigen presentation and the immunosuppressive TME have been associated with resistance to ICB. One approach to overcome anti-PD-1 resistance is to intratumorally vaccinate NSCLC tumors with gene modified conventional dendritic cells (cDC), specifically the type I conventional DC (cDC1) lineage. Recent studies have established that generation of an anti-tumor immune response driven by CD8+ T cells requires the cross presentation of tumor associated antigens and that cDC1s are the primary cross presenting APC subtype in vivo, which can license CD8+ T cells to initiate an adaptive anti-tumor immune response. In addition, previous studies have shown that intratumoral administration of the FMS-like tyrosine kinase 3 ligand (FLT3L) protein can expand endogenous CD103+ cDC1s in the TME and augment anti-tumor immune responses to ICB therapy. Here, we engineered murine CD103+ cDC1s to constitutively secrete soluble FLT3L (FLT3L_cDC1) and performed in situ vaccination studies on anti-PD1 resistant murine models of NSCLC with LKB1-deficiency and elevated TMB that better represents human disease. In situ vaccination with FLT3L_cDC1 enhances anti-tumor efficacy compared to non-modified cDC1 vaccination and synergizes with anti-PD-1 ICB to inhibit tumor growth. FLT3L_cDC1 + anti-PD-1 combination therapy induces significant activation and expansion T cells and cDC1s within the TME. Furthermore, combination therapy significantly increases DC progenitor numbers within the tumor draining lymph node, including DC progenitors that are committed to the cDC1 lineage. Our data suggests in situ vaccination with FLT3L_cDC1 may represent a promising strategy to potentiate the efficacy of ICB and improve outcomes for patients with primary resistance PD-1/PD-L1 monotherapy. Citation Format: Jensen W. Abascal, Raymond J. Lim, Ramin Salehi-Rad, Zhe Jing, Michael S. Oh, William P. Crosson, Bitta P. Kahangi, Edgar Perez Reyes, Camelia Dumitras, Diana Reyimjan, Jessie Zhu, Linh M. Tran, Manash Paul, Kostyantyn Krysan, Bin Liu, Steven M. Dubinett. In situ vaccination with Flt3l gene modified CD103+ type 1 conventional dendritic cells synergizes with anti-PD-1 checkpoint blockade in murine models of non-small cell lung cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6751.

Landscape of FLT3 Variations Associated with Structural and Functional Impact on Acute Myeloid Leukemia: A Computational Study.

Acute myeloid leukemia (AML) is hallmarked by the clonal proliferation of myeloid blasts. Mutations that result in the constitutive activation of the fms-like tyrosine kinase 3 (FLT3) gene, coding for a class III receptor tyrosine kinase, are significantly associated with this heterogeneous hematologic malignancy. The fms-related tyrosine kinase 3 ligand binds to the extracellular domain of the FLT3 receptor, inducing homodimer formation in the plasma membrane, leading to autophosphorylation and activation of apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. In the present study, we evaluated the association of FLT3 as a significant biomarker for AML and tried to comprehend the effects of specific variations on the FLT3 protein's structure and function. We also examined the effects of I836 variants on binding affinity to sorafenib using molecular docking. We integrated multiple bioinformatics tools, databases, and resources such as OncoDB, UniProt, COSMIC, UALCAN, PyMOL, ProSA, Missense3D, InterProScan, SIFT, PolyPhen, and PredictSNP to annotate the structural, functional, and phenotypic impact of the known variations associated with FLT3. Twenty-nine FLT3 variants were analyzed using in silico approaches such as DynaMut, CUPSAT, AutoDock, and Discovery Studio for their impact on protein stability, flexibility, function, and binding affinity. The OncoDB and UALCAN portals confirmed the association of FLT3 gene expression and its mutational status with AML. A computational structural analysis of the deleterious variants of FLT3 revealed I863F mutants as destabilizers of the protein structure, possibly leading to functional changes. Many single-nucleotide variations in FLT3 have an impact on its structure and function. Thus, the annotation of FLT3 SNVs and the prediction of their deleterious pathogenic impact will facilitate an insight into the tumorigenesis process and guide experimental studies and clinical implications.

Red blood cell membrane-coated FLT3 inhibitor nanoparticles to enhance FLT3-ITD acute myeloid leukemia treatment

FMS-like tyrosine kinase 3 (FLT3) is a viable and important therapeutic target for acute myeloid leukemia (AML). FLT3 internal tandem duplication (FLT3-ITD) mutations have been identified in approximately 30% of AML patients, and are associated with unfavorable prognosis, higher risk of relapse, drug resistance, and poor clinical outcome. Even FLT3 inhibitors have demonstrated promising efficacy, they cannot cure AML or even significantly extend the lives of patients with FLT3-ITD mutations. This is partly because of poor water solubility, insufficient membrane penetration and short half-life of small molecule inhibitors. Besides, the presence of enzymes like CYP3A4 in bone marrow accelerate the elimination and metabolism of FLT3 inhibitors, resulting in low plasma concentrations and side effects. Here we report the erythrocyte membrane-camouflaged FLT3 inhibitor nanoparticles to enhance FLT3-ITD AML treatment. Briefly, we physically coextruded red blood cell (RBC) membrane vesicles with nanoparticles derived from FLT3 inhibitor F30 to obtain F30@RBC-M, which exhibited comparable potent FLT3-ITD inhibitory effects compared to free F30in vitro, while displaying a higher potent antitumor efficacy in xenograft models due to the prolonged circulation properties. Furthermore, administration of F30@RBC-M significantly extended the survival of mice in a transplanted mouse model than F30 free drug. These findings suggest that RBC membrane-coated nanoparticles derived from FLT3 inhibitors hold promise as a tool to enhance the therapeutic efficacy to treat FLT3-ITD AML.

Evaluation of serum pro/anti-angiogenic biomarkers in hyperglycemic rats treated with Securigera securidaca seeds, alone and in combination with Glibenclamide.

Herbal medicines are commonly used by many people with diabetes in addition to standard treatment. Plants contain numerous known and unknown compounds that may exacerbate or ameliorate diabetes complications. Therefore, it is crucial to be aware of the side effects of these herbs before prescribing them. This study aimed to investigate the effects of hydroalcoholic extracts of Securigera securidaca (HESS) seeds alone and in combination with glibenclamide on the angiogenic/anti-angiogenic balance in streptozotocin (STZ)-induced diabetic rats. Groups involved in this animal study included diabetic and healthy controls, three doses of HESS, glibenclamide, and combination therapy. Serum samples were collected and analyzed for a vascular endothelial growth factor (VEGF), fibroblast growth factor 21 (FGF21), fetal liver kinase 1 (FLK-1), soluble fms-like tyrosine kinase 1 (sFLT-1), and transforming growth factor -beta (TGF-β). Induction of diabetes increased VEGF, FGF21, and TGF-β serum levels and decreased circulating FLK-1 and sFLT-1 factors. Herbal extract, except TGF-β, had little effect on the above blood levels even at the highest doses. Glibenclamide was more effective than the highest dose of HESS in improving the vascular complications of diabetes. Combination therapy with the highest dose of HESS partly enhanced the glibenclamide effects. Compared with glibenclamide as a standard chemical drug, HESS had no significant effects on the blood levels of the pro/anti-angiogenesis factor in diabetic rats. Glibenclamide attenuated the levels of the biomarkers and its effects were somewhat enhanced in combination with the highest dose of HESS.

Intra-bone marrow injection with engineered Lactococcus lactis for the treatment of metastatic tumors: Primary report

Bone marrow has the capacity to produce different types of immune cells, such as natural killer cells, macrophages, dendritic cells (DCs) and T cells. Improving the activation of immune cells in the bone marrow can enhance the therapy of bone metastases. Previously, we designed an engineered probiotic Lactococcus lactis, capable of expressing a fusion protein of Fms-like tyrosine kinase 3 ligand and co-stimulator OX40 ligand (FOLactis), and proved that it can induce the activation and differentiation of several immune cells. In this research, we successfully establish mouse models of bone metastasis, lung metastasis and intraperitoneal dissemination, and we are the first to directly inject the probiotics into the bone marrow to inhibit tumor growth. We observe that injecting FOLactis into the bone marrow of mice can better regulate the immune microenvironment of tumor-bearing mice, resulting in a tumor-suppressive effect. Compared to subcutaneous (s.c.) injection, intra-bone marrow (IBM) injection is more effective in increasing mature DCs and CD8+ T cells and prolonging the survival of tumor-bearing mice. Our results confirm that IBM injection of FOLactis reprograms the immune microenvironment of bone marrow and has remarkable effectiveness in various metastatic tumor models.

Impact of physical activity on preeclampsia and angiogenic markers in the Finnish Genetics of Pre-eclampsia Consortium (FINNPEC) cohort

Introduction Effect of physical activity in pregnancy on preeclampsia (PE) and angiogenic markers is not well understood. We studied the association of physical activity and PE in a case-control setting and assessed whether exercise in PE and non-PE women associate with maternal serum concentrations of soluble fms-like tyrosine kinase 1 (s-Flt-1), placental growth factor (PlGF) and soluble endoglin (sEng) and sFlt-1/PlGF ratio in the Finnish Genetics of Pre-eclampsia Consortium (FINNPEC) cohort. Materials and methods Participants completed a questionnaire on their background information and serum samples were collected from a subset. Questionnaire data on physical activity were available from 708 PE women and 724 non-PE women. Both first trimester serum samples and questionnaire data on physical activity were available from 160 PE women and 160 non-PE women, and second/third trimester serum samples and questionnaire data on physical activity were available from 139 PE women and 47 non-PE women. The PE and non-PE women were divided into categories of physically active (exercise 2 − 3 times/week or more) and physically inactive (exercise less than 2 − 3 times/week). Results A total of 43.4% of the PE women and 42.4% of the non-PE women were categorized as physically active. There were no differences in physical activity and exercise habits between the groups. The physically active women were more often nulliparous and non-smokers and had a lower body mass index. There were no differences in the concentrations of angiogenic markers (sFlt-1, PlGF and sEng and sFlt-1/PlGF ratio) between the groups who exercised more or less than 2 − 3 times/week. Conclusions In the FINNPEC study cohort, there was no association between physical activity and PE and no associations of physical activity in pregnant women with and without PE with maternal serum concentrations of sFlt-1, PlGF and sEng and sFlt-1/PlGF ratio.

Placenta-anchored tadalafil liposomes rescues intrauterine growth restriction through continuous placental blood perfusion improvement

Physiological or pathological hypoperfusion of the placenta is one of the main causes of intrauterine growth restriction (IUGR) which poses a significant risk to the health of the fetus and newborn. Tadalafil, a 5-type phosphodiesterase inhibitor, has previously been found to improve the symptoms of IUGR in various clinical studies. Unfortunately, its clinical utility is hindered by its limited water solubility, rapid metabolism, and lack of specific distribution in target tissues rendering tadalafil unable to maintain long-term placental perfusion. In this study, iRGD-modified tadalafil-loaded liposomes (iRGD-lipo@Tad) featuring a size of approximately 480 nm were designed to rectify the shortcomings of tadalafil. The prepared iRGD-lipo@Tad exhibited superior stability, sustained drug release capacity, and low cytotoxicity. The fluorescence study, tissue slice study, and drug biodistribution study together demonstrated the placenta-anchored ability of iRGD-modified liposomes. This was achieved by a dual approach consisting of the iRGD-mediated placenta-targeting effect and special particle size-mediated placenta resident effect. The pharmacokinetic study revealed a significant improvement in the in vivo process of tadalafil encapsulated by the iRGD-modified liposomes. In comparison to the tadalafil solution, the peak plasma concentration of iRGD-lipo@Tad was significantly increased, and the area under the curve was increased by about 7.88 times. In the pharmacodynamic study, iRGD-lipo@Tad achieved a continuous and efficient improvement of placental blood perfusion. This was achieved by decreasing the ratio of plasma soluble fms-like tyrosine kinase to placental growth factor and increasing the levels of cyclic guanosine monophosphate and nitric oxide. Consequently, iRGD-lipo@Tad resulted in a significant increase in embryo weight and a reduction in the miscarriage rate of N-Nitro-L-arginine methyl ester-induced IUGR pregnant mice without detectable toxicity. In summary, the nanotechnology-assisted therapy strategy presented here not only overcomes the limitations of tadalafil in the clinical treatment of IUGR but also offers new avenues to address the treatment of other placenta-originated diseases.

Prior Exposure to Experimental Preeclampsia Increases Atherosclerotic Plaque Inflammation in Atherogenic Mice-Brief Report.

Women with a history of preeclampsia have evidence of premature atherosclerosis and increased risk of myocardial infarction and stroke compared with women who had a normotensive pregnancy. Whether this is due to common risk factors or a direct impact of prior preeclampsia exposure has never been tested in a mouse atherosclerosis model. Pregnant LDLR-KO (low-density lipoprotein receptor knockout; n=35) female mice were randomized in midgestation to sFlt1 (soluble fms-like tyrosine kinase 1)-expressing adenovirus or identical control adenovirus. Postpartum, mice were fed high-fat diet for 8 weeks to induce atherogenesis. Comparison between the control and preeclampsia models was made for metabolic parameters, atherosclerosis burden and composition by histology, plaque inflammation by flow cytometry, and aortic cytokines and inflammatory markers using a cytokine array. In pregnant LDLR-KO mice, sFlt1 adenovirus significantly induced serum sFlt1, blood pressure, renal endotheliosis, and decreased pup viability. After 8 weeks of postpartum high fat feeding, body weight, fasting glucose, plasma cholesterol, HDL (high-density lipoprotein), and LDL (low-density lipoprotein) were not significantly different between groups with no change in aortic root plaque size, lipid content, or necrotic core area. Flow cytometry demonstrated significantly increased CD45+ aortic arch leukocytes and CD3+T cells and aortic lysate contained more CCL (CC motif chemokine ligand) 22 and fetuin A and decreased expression of IGFBP6 (insulin-like growth factor-binding protein 6) and CCL21 in preeclampsia-exposed mice compared with controls. In atherogenic LDLR-KO mice, exposure to sFlt1-induced preeclampsia during pregnancy increases future atherosclerotic plaque inflammation, supporting the concept that preeclampsia directly exacerbates atherosclerotic inflammation independent of preexisting risk factors. This mechanism may contribute to ischemic vascular disease in women after preeclampsia pregnancy.

Outcomes and prognosis of haploidentical haematopoietic stem cell transplantation in children with FLT3-ITD mutated acute myeloid leukaemia.

The presence of internal tandem duplication mutations in the FMS-like tyrosine kinase 3 receptor (FLT3-ITD) is a poor prognostic predictor in paediatric patients with acute myeloid leukaemia (AML). We evaluated the treatment outcomes and prognostic factors of 45 paediatric patients with FLT3-ITD AML who achieved complete remission before haploidentical haematopoietic stem cell transplantation (haplo-HSCT) at our institution from 2012 to 2021. Among the 45 patients, the overall survival (OS), event‑free survival (EFS), and cumulative incidence of relapse (CIR) rates were 74.9% ± 6.6%, 64.1% ± 7.2%, and 31.4% ± 7.1%, respectively, with 48.8 months of median follow-up. Univariate and multivariate analyses associated positive minimal residual disease (MRD) at pre-HSCT and non-remission (NR) after introduce 1 with inferior long-term survival. The 100-day cumulative incidence of grade II-IV acute graft-versus-host disease (aGVHD) was 35.6% ± 5.2%, and that of grade III-IV aGVHD was 15.6% ± 3.0% The overall 4-year cumulative incidence of chronic graft-versus-host disease after transplantation was 35.7% ± 9.8%, respectively. In conclusion, haplo-HSCT may be a feasible strategy for paediatric patients with FLT3-ITD AML, and pre-HSCT MRD status and NR after introduce 1 significantly affected the outcomes.