Flanking Genomic Sequences Research Articles

Uracil base PCR implemented for reliable DNA walking

PCR-based DNA walking is of efficacy for capturing unknown flanking genomic sequences. Here, an uracil base PCR (UB-PCR) with satisfying specificity has been devised for DNA walking. Primary UB-PCR replaces thymine base with uracil base, resulting in a primary PCR product composed of U-DNAs. A single-primer (primary nested sequence-specific primer) single-cycle amplification, using the four normal bases (adenine, thymine, cytosine, and guanine) as substrate, is then performed on the primary PCR product. Clearly, only those U-DNAs, ended by the primary nested sequence-specific primer at least at one side, will produce the corresponding normal single strands. Next, the single-cycle product undergoes uracil-DNA glycosylase treatment to destroy the U-DNAs, while the normal single strands are unaffected. Afterward, secondary even tertiary PCR is performed to exclusively enrich the target product. The feasibility of UB-PCR has been checked by obtaining unknown sequences bordering the three selected genetic sites.

Mapping the CP-Transgene Insert in the Papaya Genome and Developing a Hermaphrodite Transgenic Hybrid with Broad-Spectrum Resistance to Papaya Ringspot Virus.

Papaya ringspot virus (PRSV) limits papaya production worldwide. Previously, we generated transgenic lines of hybrid Tainung No.2 (TN-2) carrying the coat protein (CP) gene of PRSV with broad resistance to PRSV strains. Unfortunately, all of them were female, unacceptable for growers and consumers in practical applications. With our reported flanking sequences and the newly released papaya genomic information, the CP-transgene insert was identified at a non-coding region in chromosome 3 of the papaya genome, and the flanking sequences were verified and extended. The female transgenic line 16-0-1 was first used for backcrossing with the parental Sunrise cultivar six times and then followed by selfing three times. With multi-level molecular markers developed from the PRSV CP transgene and the genomic flanking sequences, the presence and zygosity of the CP transgene were characterized at the seedling stage. Meanwhile, hermaphrodite genotype was identified by a sex-linked marker. With homozygotic transgene and horticultural properties of Sunrise, a selected hermaphrodite individual was propagated by tissue culture (TC) and used as maternal progenitor to cross with non-transgenic parental cultivar Thailand to generate a new hybrid cultivar TN-2 with a hemizygotic CP-transgene. Three selected hermaphrodite individuals of transgenic TN were micropropagated by TC, and they showed broad-spectrum resistance to different PRSV strains from Taiwan, Hawaii, Thailand, and Mexico under greenhouse conditions. The selected clone TN-2 #1, with excellent horticultural traits, also showed complete resistance to PRSV under field conditions. These selected TC clones of hermaphrodite transgenic TN-2 provide a novel cultivation system in Taiwan and elsewhere.

Primer extension refractory PCR: an efficient and reliable genome walking method.

Genome walking, a molecular technique for obtaining unknown flanking genomic sequences from a known genomic sequence, has been broadly applied to determine transgenic sites, mine new genetic resources, and fill in chromosomal gaps. This technique has advanced genomics, genetics, and related disciplines. Here, an efficient and reliable genome walking technique, called primer extension refractory PCR (PER-PCR), is presented. PER-PCR uses a set of primary, secondary, and tertiary walking primers. The middle 15 nt of the primary walking primer overlaps with the 3' parts of the secondary and tertiary primers. The 5' parts of the three primers are heterologous to each other. The short overlap allows the walking primer to anneal to its predecessor only in a relaxed-stringency PCR cycle, resulting in a series of single-stranded DNAs; however, the heterologous 5' part prevents the creation of a perfect binding site for the walking primer. In the next stringent cycle, the target single strand can be extended into a double-stranded DNA molecule by the sequence-specific primer and thus can be exponentially amplified by the remaining stringent cycles. The nontarget single strand fails to be enriched due to the lack of a perfect binding site for any primer. PER-PCR was validated by extension into unknown flanking regions of the hyg gene in rice and the gadR gene in Levilactobacillus brevis CD0817. In summary, in this study, a new practical PER-PCR method was constructed as a potential alternative to existing genome walking methods.

Loss of function mutations at the tomato SSI2 locus impair plant growth and development by altering the fatty acid desaturation pathway.

The stearoyl-ACP desaturase (SACPD) is a key enzyme in the regulation of saturated to unsaturated fatty acid ratio, playing a crucial role in regulating membrane stability and fluidity, as well as photosynthesis efficiency, which makes it an important research focus in crop species. This study reports the characterization and molecular cloning of pale dwarf (pad), a new tomato (Solanum lycopersicum L.) T-DNA recessive mutant, which exhibits a dwarf and chlorotic phenotype. Functional studies of the T-DNA tagged gene were conducted, including phylogenetic analysis, expression and metabolomic analyses, and generation of CRISPR/Cas9 knockout lines. The cloning of T-DNA flanking genomic sequences and a co-segregation analysis found the pad phenotype was caused by a T-DNA insertion disrupting the tomato homologue of the Arabidopsis SUPPRESSOR OF SALICYLIC ACID INSENSITIVITY 2 (SlSSI2), encoding a plastid localized isoform of SACPD. The phenotype of CRISPR/Cas9 SlSSI2 knockout lines confirmed that the morphological abnormalities in pad plants were due to SlSSI2 loss of function. Functional, metabolomic and expression analyses proved that SlSSI2 disruption causes deficiencies in 18:1 fatty acid desaturation and leads to diminished jasmonic acid (JA) content and increased salicylic acid (SA) levels. Overall, these results proved that SSI2 plays a crucial role in the regulation of polyunsaturated fatty acid profiles in tomato, and revealed that SlSSI2 loss of function results in an inhibited JA-responsive signalling pathway and a constitutively activated SA-mediated defence signalling response. This study lays the foundation for further research on tomato SACPDs and their role in plant performance and fitness.

Progress on methods for acquiring flanking genomic sequence.

Flanking genomic sequences refer to the DNA sequences flanking specific sites of known sequences in chromosome, which contain information such as candidate genes, transcriptional regulation, chromosome structure, and biosafety, and play an important role in genomics research. Flanking sequence acquisition technologies are mainly used in the cloning of regulatory sequences such as promoters and enhancers, identification of T-DNA or transposon insertion sites, chromosome walking, genome-wide gap filling, etc. It is an important means of structural genomics research and functional genomics research. It is applied in the identification of transgenic plants and animals and their safety management. With the development of molecular biology, many methods for obtaining flanking sequences have been established, including plasmid rescue, inverse PCR, ligation-mediated PCR, semi-random primer PCR, whole-genome resequencing etc. In this review, we summarize and compared different methods for acquiring flanking genomic sequence. The principles and research progress of each approach are discussed.

Predicting Drosha and Dicer Cleavage Sites with DeepMirCut.

MicroRNAs are a class of small RNAs involved in post-transcriptional gene silencing with roles in disease and development. Many computational tools have been developed to identify novel microRNAs. However, there have been no attempts to predict cleavage sites for Drosha from primary sequence, or to identify cleavage sites using deep neural networks. Here, we present DeepMirCut, a recurrent neural network-based software that predicts both Dicer and Drosha cleavage sites. We built a microRNA primary sequence database including flanking genomic sequences for 34,713 microRNA annotations. We compare models trained on sequence data, sequence and secondary structure data, as well as input data with annotated structures. Our best model is able to predict cuts within closer average proximity than results reported for other methods. We show that a guanine nucleotide before and a uracil nucleotide after Dicer cleavage sites on the 3′ arm of the microRNA precursor had a positive effect on predictions while the opposite order (U before, G after) had a negative effect. Our analysis was also able to predict several positions where bulges had either positive or negative effects on the score. We expect that our approach and the data we have curated will enable several future studies.

DNA sonication inverse PCR for genome scale analysis of uncharacterized flanking sequences

Abstract There are few available tools to comprehensively and economically identify uncharacterized flanking regions that are not extremely labour intensive and which exploit the advantages of emerging long‐read sequencing platforms. We describe SIP; a sonication‐based inverse PCR high‐throughput sequencing strategy to investigate uncharacterized flanking region sequences, including those flanking mobile DNA. SIP combines unbiased fragmentation by sonication and target enrichment by coupling outward facing PCR priming with long‐read sequencing technologies. We demonstrate the effectiveness of SIP by determining retroviral integrations which are high copy and challenging to characterize. We further describe SIP's workflow, examine retroviral (proviral) enrichment and characterize viral structural variants identified. When SIP was coupled with long‐read sequencing using the PacBio RS II platform, proviral integration was extensively characterized at high sequence depth per integration. By interrogating the sequence data, we were also able to test several intrinsic factors including SIP's propensity to form chimeric sequences and adapter ligation efficiencies. SIP is an adaption of a traditional molecular biology technique that can be used to characterize any unknown genomic flanking sequence or to extend any sequence for which only minimal sequence information is available. SIP can be applied broadly to study complex biological systems such as mobile genetic elements with high throughput.

Identification of genomic insertion and flanking sequences of the transgenic drought-tolerant maize line "SbSNAC1-382" using the single-molecule real-time (SMRT) sequencing method.

Safety assessment of genetically modified (GM) crops is crucial at the product-development phase before GM crops are placed on the market. Determining characteristics of sequences flanking exogenous insertion sequences is essential for the safety assessment and marketing of transgenic crops. In this study, we used genome walking and whole-genome sequencing (WGS) to identify the flanking sequence characteristics of the SbSNAC1 transgenic drought-tolerant maize line “SbSNAC1-382”, but both of the two methods failed. Then, we constructed a genomic fosmid library of the transgenic maize line, which contained 4.18×105 clones with an average insertion fragment of 35 kb, covering 5.85 times the maize genome. Subsequently, three positive clones were screened by pairs of specific primers, and one of the three positive clones was sequenced by using single-molecule real-time (SMRT) sequencing technology. More than 1.95 Gb sequence data (~105× coverage) for the sequenced clone were generated. The junction reads mapped to the boundaries of T-DNA, and the flanking sequences in the transgenic line were identified by comparing all sequencing reads with the maize reference genome and the sequence of the transgenic vector. Furthermore, the putative insertion loci and flanking sequences were confirmed by PCR amplification and Sanger sequencing. The results indicated that two copies of the exogenous T-DNA fragments were inserted at the same genomic site, and the exogenous T-DNA fragments were integrated at the position of Chromosome 5 from 177155650 to 177155696 in the transgenic line 382. In this study, we demonstrated the successful application of the SMRT technology for the characterization of genomic insertion and flanking sequences.

Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes

SummaryTo accelerate the isolation of plant protein complexes and study cellular localization and interaction of their components, an improved recombineering protocol is described for simple and fast site‐directed modification of plant genes in bacterial artificial chromosomes (BACs). Coding sequences of fluorescent and affinity tags were inserted into genes and transferred together with flanking genomic sequences of desired size by recombination into Agrobacterium plant transformation vectors using three steps of E. coli transformation with PCR‐amplified DNA fragments. Application of fast‐track recombineering is illustrated by the simultaneous labelling of CYCLIN‐DEPENDENT KINASE D (CDKD) and CYCLIN H (CYCH) subunits of kinase module of TFIIH general transcription factor and the CDKD‐activating CDKF;1 kinase with green fluorescent protein (GFP) and mCherry (green and red fluorescent protein) tags, and a PIPL (His18‐StrepII‐HA) epitope. Functionality of modified CDKF;1 gene constructs is verified by complementation of corresponding T‐DNA insertion mutation. Interaction of CYCH with all three known CDKD homologues is confirmed by their co‐localization and co‐immunoprecipitation. Affinity purification and mass spectrometry analyses of CDKD;2, CYCH, and DNA‐replication‐coupled HISTONE H3.1 validate their association with conserved TFIIH subunits and components of CHROMATIN ASSEMBLY FACTOR 1, respectively. The results document that simple modification of plant gene products with suitable tags by fast‐track recombineering is well suited to promote a wide range of protein interaction and proteomics studies.

Identification, characterization and functional analysis of regulatory region of nanos gene from half-smooth tongue sole (Cynoglossus semilaevis)

The nanos gene encodes an RNA-binding zinc finger protein, which is required in the development and maintenance of germ cells. However, there is very limited information about nanos in flatfish, which impedes its application in fish breeding. In this study, we report the molecular cloning, characterization and functional analysis of the 3′-untranslated region of the nanos gene (Csnanos) from half-smooth tongue sole (Cynoglossus semilaevis), which is an economically important flatfish in China. The 1233-bp cDNA sequence, 1709-bp genomic sequence and flanking sequences (2.8-kb 5′- and 1.6-kb 3′-flanking regions) of Csnanos were cloned and characterized. Sequence analysis revealed that CsNanos shares low homology with Nanos in other species, but the zinc finger domain of CsNanos is highly similar. Phylogenetic analysis indicated that CsNanos belongs to the Nanos2 subfamily. Csnanos expression was widely detected in various tissues, but the expression level was higher in testis and ovary. During early development and sex differentiation, Csnanos expression exhibited a clear sexually dimorphic pattern, suggesting its different roles in the migration and differentiation of primordial germ cells (PGCs). Higher expression levels of Csnanos mRNA in normal females and males than in neomales indicated that the nanos gene may play key roles in maintaining the differentiation of gonad. Moreover, medaka PGCs were successfully labeled by the microinjection of synthesized mRNA consisting of green fluorescence protein and the 3′-untranslated region of Csnanos. These findings provide new insights into nanos gene expression and function, and lay the foundation for further study of PGC development and applications in tongue sole breeding.

Genome-wide amplification of proviral sequences reveals new polymorphic HERV-K(HML-2) proviruses in humans and chimpanzees that are absent from genome assemblies.

BackgroundTo date, the human population census of proviruses of the Betaretrovirus–like human endogenous retroviral (HERV-K) (HML-2) family has been compiled from a limited number of complete genomes, making it certain that rare polymorphic loci are under-represented and are yet to be described.ResultsHere we describe a suppression PCR-based method called genome-wide amplification of proviral sequences (GAPS) that selectively amplifies DNA fragments containing the termini of HERV-K(HML-2) proviral sequences and their flanking genomic sequences. We analysed the HERV-K(HML-2) proviral content of 101 unrelated humans, 4 common chimpanzees and three centre d’etude du polymorphisme humain (CEPH) pedigrees (44 individuals). The technique isolated HERV-K(HML-2) proviruses that had integrated in the genomes of the great apes throughout their divergence and included evolutionarily young elements still unfixed for presence/absence.ConclusionsBy examining the HERV-K(HML-2) proviral content of 145 humans we detected a new insertionally polymorphic Type I HERV-K(HML-2) provirus. We also observed provirus versus solo long terminal repeat (LTR) polymorphism within humans at a previously unreported, but ancient, locus. Finally, we report two novel chimpanzee specific proviruses, one of which is dimorphic for a provirus versus solo LTR. Thus GAPS enables the isolation of uncharacterised HERV-K(HML-2) proviral sequences and provides a direct means to assess inter-individual genetic variation associated with HERV-K(HML-2) proviruses.Electronic supplementary materialThe online version of this article (doi:10.1186/s12977-015-0162-8) contains supplementary material, which is available to authorized users.

Aberrant splicing in transgenes containing introns, exons, and V5 epitopes: lessons from developing an FSHD mouse model expressing a D4Z4 repeat with flanking genomic sequences.

The DUX4 gene, encoded within D4Z4 repeats on human chromosome 4q35, has recently emerged as a key factor in the pathogenic mechanisms underlying Facioscapulohumeral muscular dystrophy (FSHD). This recognition prompted development of animal models expressing the DUX4 open reading frame (ORF) alone or embedded within D4Z4 repeats. In the first published model, we used adeno-associated viral vectors (AAV) and strong viral control elements (CMV promoter, SV40 poly A) to demonstrate that the DUX4 cDNA caused dose-dependent toxicity in mouse muscles. As a follow-up, we designed a second generation of DUX4-expressing AAV vectors to more faithfully genocopy the FSHD-permissive D4Z4 repeat region located at 4q35. This new vector (called AAV.D4Z4.V5.pLAM) contained the D4Z4/DUX4 promoter region, a V5 epitope-tagged DUX4 ORF, and the natural 3’ untranslated region (pLAM) harboring two small introns, DUX4 exons 2 and 3, and the non-canonical poly A signal required for stabilizing DUX4 mRNA in FSHD. AAV.D4Z4.V5.pLAM failed to recapitulate the robust pathology of our first generation vectors following delivery to mouse muscle. We found that the DUX4.V5 junction sequence created an unexpected splice donor in the pre-mRNA that was preferentially utilized to remove the V5 coding sequence and DUX4 stop codon, yielding non-functional DUX4 protein with 55 additional residues on its carboxyl-terminus. Importantly, we further found that aberrant splicing could occur in any expression construct containing a functional splice acceptor and sequences resembling minimal splice donors. Our findings represent an interesting case study with respect to AAV.D4Z4.V5.pLAM, but more broadly serve as a note of caution for designing constructs containing V5 epitope tags and/or transgenes with downstream introns and exons.

Next-generation sequencing is a robust strategy for the high-throughput detection of zygosity in transgenic maize.

Simple and reliable, high-throughput techniques to detect the zygosity of transgenic events in plants are valuable for biotechnology and plant breeding companies seeking robust genotyping data for the assessment of new lines and the monitoring of breeding programs. We show that next-generation sequencing (NGS) applied to short PCR products spanning the transgene integration site provides accurate zygosity data that are more robust and reliable than those generated by PCR-based methods. The NGS reads covered the 5' border of the transgenic events (incorporating part of the transgene and the flanking genomic DNA), or the genomic sequences flanking the unfilled transgene integration site at the wild-type locus. We compared the NGS method to competitive real-time PCR with transgene-specific and wild-type-specific primer/probe pairs, one pair matching the 5' genomic flanking sequence and 5' part of the transgene and the other matching the unfilled transgene integration site. Although both NGS and real-time PCR provided useful zygosity data, the NGS technique was favorable because it needed fewer optimization steps. It also provided statistically more-reliable evidence for the presence of each allele because each product was often covered by more than 100 reads. The NGS method is also more suitable for the genotyping of large panels of plants because up to 80 million reads can be produced in one sequencing run. Our novel method is therefore ideal for the rapid and accurate genotyping of large numbers of samples.

A-T linker adapter polymerase chain reaction for determining flanking sequences by rescuing inverse PCR or thermal asymmetric interlaced PCR products

The polymerase chain reaction (PCR)-based genome walking method has been extensively used to isolate unknown flanking sequences, whereas nonspecific products are always inevitable. To resolve these problems, we developed a new strategy to isolate the unknown flanking sequences by combining A-T linker adapter PCR with inverse PCR (I–PCR) or thermal asymmetric interlaced PCR (TAIL–PCR). The result showed that this method can be efficiently achieved with the flanking sequence from the Arabidopsis mutant and papain gene. Our study provides researchers with an additional method for determining genomic DNA flanking sequences to identify the target band from bulk of bands and to eliminate the cloning step for sequencing.

Chromosomal mapping and zygosity check PCR of transgenes in a GFP mouse line (C57BL/6‐Tg(CAG‐EGFP)C14‐Y01‐FM131Osb) determined by genomic walking (1138.13)

Positional effect of transgenes is important for analyses of transgenic animals. In this study, the transgene insertion site in genomes of a GFP mouse line and primers for zygosity check PCR were determined by genomic walking (Exp Anim 53:103‐111, 2004). Adapter‐ligated, enzyme‐restricted genomic libraries were constructed with genomic DNA from hemizygous GFP mice. The sequence flanking the transgene was determined by sequencing amplicons from PCR of the genomic libraries with transgene‐specific and adaptor primers. The insertion site was located by BLAST search in Ensembl genome database (http://www.ensembl.org) using the genome sequence flanking the transgene. Primer sets for zygosity check were designed based on the transgene and flanking genome sequences. The flanking sequence was mapped on chromosome 11. Three primers were designed for zygosity check (1: CACCGCCGGGTCTCTCACTGTCAGTCT, 2: GACGTCAATGGGCGGGGGTCGTT, and 3: TGGGACCTGATCACGGTAAAACGAGGT). Transgenic and wild alleles could be detected in the genome by PCR with primers 1 and 2, and primer 1 and 3, respectively. The information should be useful for genomic research using the GFP line (C57BL/6‐Tg(CAG‐EGFP)C14‐Y01‐FM131Osb).Grant Funding Source: Supported by a grant from the Ministry of Health, Labor and Welfare of Japan.

Cloning flanking sequence by single-primer PCR in transgenic plants

The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

Molecular characterization and homology modeling of a short-chain reductase/dehydrogenase from Gracilaria changii (Rhodophyta)

Short-chain dehydrogenases (SDRs) which catalyze the dehydrogenation/reduction reaction have a wide range of substrate specificities. In this study, we report the molecular characterization of a transcript encoding SDR from the red seaweed, Gracilaria changii (Rhodophyta) as part of our effort to elucidate the functions of novel transcripts from this marine alga. The transcript, denoted as GcSDR, encodes a protein of 282 amino acids with a predicted size of approximately 31 kDa. The GxxxGxG coenzyme binding motif and YxxxK active-site motif of SDRs are well conserved in GcSDR. The coding sequence of GcSDR was cloned and expressed as recombinant protein in Escherichia coli BL21 (DE3) pLysS. Kinetic analysis of recombinant GcSDR using pyruvaldehyde dimethyl acetal as a substrate has a Km value of 116.52 mM and a Vmax value of 720 nmol product formed per minute per milligram. It has a higher affinity towards NADPH compared to NADP+ as a cofactor. Homology modeling showed that the three-dimensional structure of GcSDR has 34.5 % sequence identity to the SDR from a soil bacterium. Virtual screening of the possible substrates for GcSDR revealed that CMP-N-acetyl-beta-neuraminate (2-) which belongs to a group of amino sugars has the lowest binding energy among the compounds examined. The predicted cis-acting regulatory elements (CREs) at the 5′-flanking genomic sequence of GcSDR include CREs associated with abscisic acid, methyl jasmonic acid, light, anoxia, endosperm, low-temperature stress, and heat stress. The transcripts of GcSDR were found to accumulate in seaweed samples treated under low-salinity stress, thus suggesting its involvement during saline deprivation.

Molecular cloning, homology modeling and site-directed mutagenesis of vanadium-dependent bromoperoxidase (GcVBPO1) from Gracilaria changii (Rhodophyta)

Vanadium-dependent haloperoxidases belong to a class of vanadium enzymes that may have potential industrial and pharmaceutical applications due to their high stability. In this study, the 5'-flanking genomic sequence and complete reading frame encoding vanadium-dependent bromoperoxidase (GcVBPO1) was cloned from the red seaweed, Fracilaria changii, and the recombinant protein was biochemically characterized. The deduced amino acid sequence of GcVBPO1 is 1818 nucleotides in length, sharing 49% identity with the vanadium-dependent bromoperoxidases from Corralina officinalis and Cor. pilulifera, respectively. The amino acid residues associated with the binding site of vanadate cofactor were found to be conserved. The Km value of recombinant GcVBPO1 for Br(-) was 4.69 mM, while its Vmax was 10.61 μkat mg(-1) at pH 7. Substitution of Arg(379) with His(379) in the recombinant protein caused a lower affinity for Br(-), while substitution of Arg(379) with Phe(379) not only increased its affinity for Br(-) but also enabled the mutant enzyme to oxidize Cl(-). The mutant Arg(379)Phe was also found to have a lower affinity for I(-), as compared to the wild-type GcVBPO1 and mutant Arg(379)His. In addition, the Arg(379)Phe mutant has a slightly higher affinity for H2O2 compared to the wild-type GcVBPO1. Multiple cis-acting regulatory elements associated with light response, hormone signaling, and meristem expression were detected at the 5'-flanking genomic sequence of GcVBPO1. The transcript abundance of GcVBPO1 was relatively higher in seaweed samples treated with 50 parts per thousand (ppt) artificial seawater (ASW) compared to those treated in 10 and 30 ppt ASW, in support of its role in the abiotic stress response of seaweed.

De novo piRNA cluster formation in the Drosophila germ line triggered by transgenes containing a transcribed transposon fragment

PIWI-interacting RNAs (piRNAs) provide defence against transposable element (TE) expansion in the germ line of metazoans. piRNAs are processed from the transcripts encoded by specialized heterochromatic clusters enriched in damaged copies of transposons. How these regions are recognized as a source of piRNAs is still elusive. The aim of this study is to determine how transgenes that contain a fragment of the Long Interspersed Nuclear Elements (LINE)-like I transposon lead to an acquired TE resistance in Drosophila. We show that such transgenes, being inserted in unique euchromatic regions that normally do not produce small RNAs, become de novo bidirectional piRNA clusters that silence I-element activity in the germ line. Strikingly, small RNAs of both polarities are generated from the entire transgene and flanking genomic sequences—not only from the transposon fragment. Chromatin immunoprecipitation analysis shows that in ovaries, the trimethylated histone 3 lysine 9 (H3K9me3) mark associates with transgenes producing piRNAs. We show that transgene-derived hsp70 piRNAs stimulate in trans cleavage of cognate endogenous transcripts with subsequent processing of the non-homologous parts of these transcripts into piRNAs.

71 Genomic regions flanking E-box binding sites influence DNA binding specificity of bHLH transcription factors through DNA shape

Transcriptional regulation of gene expression is enacted mainly through binding of transcription factors (TFs) to specific, short DNA sites in cis-regulatory regions of genes. Most TFs are members of protein families that share a common DNA-binding domain and thus recognize similar DNA-binding sequences. It is not well understood why paralogous TFs often bind different genomic target sites in vivo to effect different regulatory programs, despite apparently recognizing the same sequence motifs. Here, we designed custom protein-binding microarrays (PBMs) to analyze the DNA-binding specificities of two Saccharomyces cerevisiae basic helix-loop-helix (bHLH) proteins, Tye7 and Cbf1, as a model system. Our data reveal that E-box DNA-binding sequences (CAnnTG), when tested in the context of their native genomic flanking sequences, are bound differently by Cbf1 and Tye7. Computational models of the PBM data indicate that DNA sequence features located in the genomic sequences outside the E-box contribute to DNA-binding specificity in vitro. Our analyses suggest that these flanking regions affect DNA-binding specificity indirectly by influencing the three-dimensional structure of the E-box binding sites. Finally, we show that these subtle differences in intrinsic sequence preferences of Cbf1 and Tye7 in vitro help to explain their differential DNA-binding preferences in vivo. Our results provide further evidence that the local shape of DNA-binding sites may be an important feature in distinguishing the DNA-binding preferences among paralogous TFs and thus may play a widespread role in determining how transcriptional regulatory specificity within TF families is achieved.