Chromosomal mapping and zygosity check PCR of transgenes in a GFP mouse line (C57BL/6‐Tg(CAG‐EGFP)C14‐Y01‐FM131Osb) determined by genomic walking (1138.13)

Abstract

Positional effect of transgenes is important for analyses of transgenic animals. In this study, the transgene insertion site in genomes of a GFP mouse line and primers for zygosity check PCR were determined by genomic walking (Exp Anim 53:103‐111, 2004). Adapter‐ligated, enzyme‐restricted genomic libraries were constructed with genomic DNA from hemizygous GFP mice. The sequence flanking the transgene was determined by sequencing amplicons from PCR of the genomic libraries with transgene‐specific and adaptor primers. The insertion site was located by BLAST search in Ensembl genome database (http://www.ensembl.org) using the genome sequence flanking the transgene. Primer sets for zygosity check were designed based on the transgene and flanking genome sequences. The flanking sequence was mapped on chromosome 11. Three primers were designed for zygosity check (1: CACCGCCGGGTCTCTCACTGTCAGTCT, 2: GACGTCAATGGGCGGGGGTCGTT, and 3: TGGGACCTGATCACGGTAAAACGAGGT). Transgenic and wild alleles could be detected in the genome by PCR with primers 1 and 2, and primer 1 and 3, respectively. The information should be useful for genomic research using the GFP line (C57BL/6‐Tg(CAG‐EGFP)C14‐Y01‐FM131Osb).Grant Funding Source: Supported by a grant from the Ministry of Health, Labor and Welfare of Japan.