Fertile Subjects Research Articles

Key predictors of fertility: Exploring the role of Vitamin-D

Background & Objectives: The relationship of Vitamin-D (VD) with Luteinizing Hormone (LH), Follicle stimulating Hormone (FSH) and Anti Mullerian Hormone (AMH) is recognized. This study was conducted to determine whether VD is a predictor of fertility and investigate its relationship with female reproductive hormones and markers of ovarian reserve in female population of Karachi. Methods: A cross-sectional study was performed from July 2020 to June 2022 at the Aga Khan University Hospital (AKUH) with recruitment of 135 fertile and infertile subjects. VD, AMH, FSH and LH levels were estimated by ‘Enzyme Linked Immunosorbent assay (ELISA)’. By applying binary logistic regression, variables with p-value < 0.25 in univariate analysis were used for multivariate regression model and adjusted odds ratios were computed. In multivariate analysis, significance was p-value ≤ 0.05. Results: VD deficiency was observed in all infertile female subjects. In univariate regression analysis, FSH, LH, LH/FSH ratio and VD levels turned out to be significant. The Multivariate analysis represented that for every one ng/mL increase in VD level, the odds of fertility were expected to be 50.154 times higher with p-value < 0.001. The positive correlation of VD with FSH was significant. Conclusion: VD deficiency was prevalent in all infertile female subjects. VD levels were strong predictor of fertility in the study population. The significant association of VD with FSH explained the indirect effect of VD on follicular development and ovarian functions however no relationship of VD with ovarian reserve was exhibited. Note: AI assisted technologies were used in the preparation of the manuscripts, to improve readability and language. doi: https://doi.org/10.12669/pjms.40.10.9774 How to cite this: Salahuddin H, Zaki S, Ashraf M, Rehana Rehman4. Key predictors of fertility: Exploring the role of Vitamin-D. Pak J Med Sci. 2024;40(10):2363-2367. doi: https://doi.org/10.12669/pjms.40.10.9774 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Translational Neuroscience Contributes to Understanding Neurodevelopmental Outcomes of Dostoyevsky's "Brothers Karamazov" With Treatment Implications.

Dostoyevsky's novels raise profound ethical, moral, philosophical and theological issues and, as a result, both he and his novels serve as fertile subjects of scholarly inquiry across a variety of academic disciplines. In particular, major characters in "The Brothers Karamazov" lend themselves to classical psychodynamic formulations, such as the influence of adverse childhood experiences on adult social and occupational outcomes, which in the case of Dmitry, the eldest son of Fyodor Pavlovich Karamazov, are considered in exquisitely fine detail. Prosecutor and defense attorney provide differing interpretations of how early traumas, largely due to paternal neglect and abuse, affected Dmitry's adult outcome in the climactic trial over his alleged patricide. The novel also captures an extreme, and perhaps fanciful, description of an Oedipal rivalry between Dmitry and his father for the affection of a love interest leading to tragic and unpredictable consequences for both. The novel has been dissected by scholars across a variety of diverse and seemingly unrelated disciplines and continues to serve as a springboard for collaborative discussion. Re-reading the novel led the authors to wonder if translational developments in clinical neuroscience could further understanding of poor developmental trajectories of the novel's characters, as well as offer therapeutic recommendations for promoting more favorable occupational and social outcomes. Advances in basic neuroscience have been translated into actionable individualized, interdisciplinary, multimodal treatment plans leading to improved functional outcomes for children like Dmitry, Ivan, and Smerdyakov. Translational neuroscience enriches understanding of neurodevelopmental outcomes of characters in Dostoyevsky's novel "The Brothers Karamazov," especially in the context of genetic risk and in utero environmental insults.

Cinnamon-mediated nano emulsion and its cryogenic activity on ROS-affected human sperm—A short study

Oil-mediated nano emulsion, a more advanced technology than other commercial extenders, will protect spermatozoa for extended periods against ROS and cryo injuries. The study is designed to elucidate the most suitable extender to preserve infertile subjects' sperm cells against ROS damage. This is a significant step forward for the andrology society, as it introduces the use of a nano emulsion extender (natural oil extract) for the first time, particularly for those who are undergoing urology-related defects. The study involved forty-four (44) infertile subjects with smoking habits and forty-two (42) fertile subjects without smoking habits, as per CASA guidelines. Semen preservatives (glycerol and egg yolk citrate), along with our naturally derived nano emulsion components (CN, EN, and EL), were prepared and used to preserve the semen sample for 24 hours. Standard semen parameters (morphology, viability, and integrity), ROS, and sperm acrosome state by staining were measured before and after cryopreservation. The results indicated that the morphology and motility of sperm features were better maintained in the CN-oil-mediated nano emulsion than in other emulsions, and ROS-induced DNA damage was reduced.

An insight into the vaginal microbiome of infertile women in Bangladesh using metagenomic approach.

The dysbiosis of vaginal microbiota is recognized as a potential underlying factor contributing to infertility in women. This study aimed to compare the vaginal microbiomes of infertile and fertile women to investigate their relationship with infertility. Metagenomic analysis was conducted on samples from 5 infertile and 5 fertile individuals using both amplicon 16S and metagenomics shotgun sequencing methods. In the infertile group, the bacterial community was primarily represented by three major bacterial genera: Lactobacillus (79.42%), Gardnerella (12.56%) and Prevotella (3.33%), whereas, the fertile group exhibited a more diverse composition with over 8 major bacterial genera, accompanied by significantly reduced abundance of Lactobacillus (48.79%) and Gardnerella (6.98%). At the species level, higher abundances of L. iners, L. gasseri and G. vaginalis were observed in the infertile group. Regarding the microbiome composition, only one fertile and two infertile subjects exhibited the healthiest Community State Types, CST-1, while CST-3 was observed among two infertile and one fertile subject, and CST-4 in three other fertile and one infertile subject. Overall, alpha diversity metrics indicated greater diversity and lower species richness in the control (fertile) group, while the infertile group displayed the opposite trend. However, beta-diversity analysis did not show distinct clustering of samples associated with any specific group; instead, it demonstrated CST-type specific clustering. Shotgun metagenomics further confirmed the dominance of Firmicutes, with a greater abundance of Lactobacillus species in the infertile group. Specifically, L. iners and G. vaginalis were identified as the most dominant and highly abundant in the infertile group. Fungi were only identified in the control group, dominated by Penicillium citrinum (62.5%). Metagenome-assembled genomes (MAGs) corroborated read-based taxonomic profiling, with the taxon L. johnsonii identified exclusively in disease samples. MAG identities shared by both groups include Shamonda orthobunyavirus, L. crispatus, Human endogenous retrovirus K113, L. iners, and G. vaginalis. Interestingly, the healthy microbiomes sequenced in this study contained two clusters, Penicillium and Staphylococcus haemolyticus, not found in the public dataset. In conclusion, this study suggests that lower species diversity with a higher abundance of L. iners, L. gasseri and G. vaginalis, may contribute to female infertility in our study datasets. However, larger sample sizes are necessary to further evaluate such association.

Black Life Insurance and the Blues

Insurance, and specifically life insurance, seems like an odd topic for the blues. Associated with urbanism and capitalism, the theme contests an understanding of the blues as an “authentic” expression of a rural folk culture. Focusing on a cluster of blues songs that reference life insurance reveals the consciousness of a long history of racialized exploitation and discrimination, including the everyday experiences associated with it. The representation of insurance in the blues also provides a window into polysemic modes of signifying and subtle forms of resistance.1 Recognizing the potential for insurance to function as fertile lyrical subject matter for messages of resistance or struggle requires excavating its long, racialized history extending back to the antebellum world.

A hemizygous loss-of-function variant in BCORL1 is associated with male infertility and oligoasthenoteratozoospermia.

Oligoasthenoteratozoospermia (OAT) is a common type of male infertility; however, its genetic causes remain largely unknown. Some of the genetic determinants of OAT are gene defects affecting spermatogenesis. BCORL1 (BCL6 corepressor like 1) is a transcriptional corepressor that exhibits the OAT phenotype in a knockout mouse model. A hemizygous missense variant of BCORL1 (c.2615T > G:p.Val872Gly) was reported in an infertile male patient with non-obstructive azoospermia (NOA). Nevertheless, the correlation between BCORL1 variants and OAT in humans remains unknown. In this study, we used whole-exome sequencing to identify a novel hemizygous nonsense variant of BCORL1 (c.1564G > T:p.Glu522*) in a male patient with OAT from a Han Chinese family. Functional analysis showed that the variant produced a truncated protein with altered cellular localization and a dysfunctional interaction with SKP1 (S-phase kinase-associated protein 1). Further population screening identified four BCORL1 missense variants in subjects with both OAT (1 of 325, 0.31%) and NOA (4 of 355, 1.13%), but no pathogenic BCORL1 variants among 362 fertile subjects. In conclusion, our findings indicate that BCORL1 is a potential candidate gene in the pathogenesis of OAT and NOA, expanded its disease spectrum and suggested that BCORL1 may play a role in spermatogenesis by interacting with SKP1.

The semen microbiome of miniature pony stallions.

Little is known about the microbial composition of stallion semen. To describe the microbiota detected in equine semen of healthy miniature pony stallions. Semen specimens were collected using a Missouri artificial vagina at a single time point. PacBio (Pacific Biosciences) genomic DNA sequencing of the 16S rRNA gene was performed on these specimens, following which next-generation microbiome bioinformatics platform QIIME2 was used to process fastq files and analyse the amplicon data. The data were categorised into genus, family, class, order and phylum. Firmicutes and Bacteroidetes phyla predominated (76%), followed by Proteobacteria (15%). Bacteroidales, Clostridiales and Cardiobacteriales predominated the microbial rank of order (86%). Class was mainly composed of Bacteroidia, Clostridia and Gammaproteobacteria (87%), while family was mainly composed of Porphyromonadaceae , Family_XI and Cardiobacteriaceae (62%). At the level of genus, 80% of the abundance was composed of seven genera, namely Porphyromonas, Suttonella, Peptoniphilus, Fastidiosipila, Ezakiella, Petrimonas and an unknown taxon. The findings indicate that specific microbiota may be characteristic of healthy miniature pony stallions' semen with some inter-individual variations observed. Larger equine studies involving fertile and infertile subjects could be informed by this study and could explore the relationship of the semen microbiome to male fertility.

The greatest contribution to medical science is the transformation from studying symptoms to studying their causes-the unrelenting legacy of Robert Koch and Louis Pasteur-and a causality perspective to approach a definition of SLE.

The basic initiative related to this study is derived from the fact that systemic lupus erythematosus (SLE) is a unique and fertile system science subject. We are, however, still far from understanding its nature. It may be fair to indicate that we are spending more time and resources on studying the complexity of classified SLE than studying the validity of classification criteria. This study represents a theoretical analysis of current instinctual SLE classification criteria based on "the causality principle." The discussion has its basis on the radical scientific traditions introduced by Robert Koch and Louis Pasteur. They announced significant changes in our thinking of disease etiology through the implementation of the modern version of "the causality principle." They influenced all aspects of today's medical concepts and research: the transformation of medical science from studies of symptoms to study their causes, relevant for monosymptomatic diseases as for syndromes. Their studies focused on bacteria as causes of infectious diseases and on how the immune system adapts to control and prevent contagious spreading. This is the most significant paradigm shift in the modern history of medicine and resulted in radical changes in our view of the immune system. They described acquired post-infection immunity and active immunization by antigen-specific vaccines. The paradigm "transformation" has a great theoretical impact also on current studies of autoimmune diseases like SLE: symptoms and their cause(s). In this study, the evolution of SLE classification and diagnostic criteria is discussed from "the causality principle" perspective, and if contemporary SLE classification criteria are as useful as believed today for SLE research. This skepticism is based on the fact that classification criteria are not selected based on cogent causal strategies. The SLE classification criteria do not harmonize with Koch's and Pasteur's causality principle paradigms and not with Witebsky's Koch-derived postulates for autoimmune and infectious diseases. It is not established whether the classification criteria can separate SLE as a "one disease entity" from "SLE-like non-SLE disorders"-the latter in terms of SLE imitations. This is discussed here in terms of weight, rank, and impact of the classification criteria: Do they all originate from "one basic causal etiology"? Probably not.

Lipidomic Profile of Human Sperm Membrane Identifies a Clustering of Lipids Associated with Semen Quality and Function.

Reduced sperm motility and/or count are among the major causes of reduced fertility in men, and sperm membranes play an important role in the spermatogenesis and fertilization processes. However, the impact of sperm lipid composition on male fertility remains under-investigated. The aim of the present study was to perform a lipidomic analysis of human sperm membranes: we performed an untargeted analysis of membrane lipid composition in fertile (N = 33) and infertile subjects (N = 29). In parallel, we evaluated their serum lipid levels. Twenty-one lipids were identified by their mass/charge ratio and post-source decay spectra. Sulfogalactosylglycerolipid (SGG, seminolipid) was the most abundant lipid component in the membranes. In addition, we observed a significant proportion of PUFAs. Important differences have emerged between the fertile and infertile groups, leading to the identification of a lipid cluster that was associated with semen parameters. Among these, cholesterol sulfate, SGG, and PUFAs represented the most important predictors of semen quality. No association was found between the serum and sperm lipids. Dietary PUFAs and SGG have acknowledged antioxidant functions and could, therefore, represent sensitive markers of sperm quality and testicular function. Altogether, these results underline the important role of sperm membrane lipids, which act independently of serum lipids levels and may rather represent an independent marker of reproductive function.

Evidence based distribution of protamine 2 genes polymorphism variants in infertile and fertile males in Southwestern Nigeria.

Protamine 2 is a major core protein of spermatozoa and is important for maintaining male fertility. The aim of the study was to determine the distribution of protamine 2 gene polymorphisms variants in infertile males in Southwestern Part of Nigeria. This is a cross sectional study, consisted of volunteered infertile and fertile male attendees of known Fertility Clinics in Lagos Metropolis, Lagos, Nigeria. The infertile male subjects recruited, were fifty-seven (57) in number and the fertile male subjects (control) were thirty-five in number (35) and were within the age range of 30-59 years old. Semen specimen was collected from each subject in line with WHO guideline for semen analysis into sterile semen containers through masturbation. Sperm DNA from subjects’ sperm cells was extracted by chemical method (protein kinase buffer), quantified using nanodrop 1000 Spectrophotometer and amplified using the PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3’ PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -3' primers on an ABI 9700 Applied Biosystem thermal cycler at final volume of 25 µL for 35 cycles. Sequencing was done using the BigDye Terminator kit on a 3510 ABI sequencer. The results of genetic testing on the flank; 5’-UTR of the PRM 2 gene showed the following variants with polymorphisms and frequencies as follow: rs2069880951 (A>T /T>A) 6 (6.6%), rs1382451565 (C>T) 5 (5.4%), and rs935520555 (G>C) 5 (5.4%), rs1479789045 (G/C>A/ A>G) 4 (4.3%), rs570570800 (C>T/ G>T) 3 (3.3%), rs1281533806 (C>A) 3 (3.3%), rs1434703461 (C>T/ G>T) 3 (3.3%), rs2069881018 (G>C) 3 (3.3%), rs549835830 (G>C) 2 (2.2%), rs2069880888( C>T ) 2 (2.2%), rs997110743 (G>C/C>G), rs1236501997 1 (1.1%), rs119399669 (C>T) 1 (1.1%), and rs1052575569 (G>A/C>A) 1 (1.1%). In this study, there were novel variants of protamine 2 gene polymorphism, identified with reference to the reference sequence of NCBI data base in the infertile and fertile male subjects.

Paternity Test

The article presents modern data on the properties of seminal fluid creating the primary conditions for the development of a healthy pregnancy. Actual pathophysiological theories based on the study of cell lines, proving the direct role of paternal material in the formation of an allogeneic environment, are considered. Literature data on the influence of dosing and quality of the partner's biological material are given. The subject of fertility is the interaction between male seminal fluid and female tissues during sexual intercourse, the effect on fertility, pregnancy and the health of the child. It has been established that the biological contribution of the father to pregnancy and his ability to influence the reproductive outcome goes beyond the simple provision of male mi gametes at conception. The key questions of the study are: whether the seminal fluid delivered during sexual intercourse affects gene expression and immune responses to the endometrium; the completeness of the identity of the molecular agents by which seminal plasma and sperm interact with the cells of the cervix and endometrium; the physiological significance of semen priming in women and its potential contribution to unexplained infertility, embryonic development and pregnancy outcome; clinical factors, lifestyle and environmental environments that affect seminal fluid composition and signaling function. Ultimately, a better understanding of the role of seminal fluid in shaping reproductive success could provide new avenues for diagnosing and treating infertility in couples and improve recommendations for couples planning a pregnancy or in assisted reproduction settings.

Seminal plasma level of bisphenol A among males investigated for infertility in Benin City, Nigeria

Background: Evidence of an increasing rate of male infertility is replete in literature and has been attributed to several factors associated with environmental toxicants such as bisphenol A (BPA). It's presence in several products frequently used and the potential harmful effect on humans has raised serious concerns. Aims: The objective of this study was to determine the seminal plasma concentration of BPA among men investigated for infertility. Setting and Design: This was a cross-sectional study of men investigated for infertility in a tertiary hospital in Benin City, Nigeria. Materials and Methods: A total of 144 males (mean age: 40.55 ± 7.30) and 50 control subjects of proven fertility (mean age: 39.96 ± 5.68) were enrolled in the study. A structured questionnaire was used to obtain the sociodemographic data. Semen was collected after at least 3 days of sexual abstinence. Semen analysis was done according to the World Health Organization guidelines and seminal plasma BPA was determined using the enzyme-linked immunosorbent assay technique. Statistical Analysis Used: Chi-square, Student's t-test, and analysis of variance were used to compare measured variables. Pearson's correlation coefficient was used to determine the relationship between seminal plasma BPA and sperm indices. Results: Seminal plasma BPA was significantly higher (P < 0.001) among infertile men than control subjects. The mean seminal plasma BPA concentrations increased with declining sperm count (P < 0.001). Seminal plasma BPA levels strongly correlated inversely with sperm motility (r = −0.857, P < 0.001) and sperm count (r = −0.821, P < 0.001) and positively with abnormal morphology (r = 0.815, P < 0.001). The likelihood ratios of elevated BPA concentration to cause harm to sperm count (14.562), motility (10.425), and morphology (27.838) were several folds higher among subjects being investigated for infertility. Conclusions: Seminal plasma BPA levels were significantly higher among infertile men than controls. The detection of high levels of BPA in the seminal plasma is an indication of human exposure to high concentrations of BPA, this information may be used to formulate environmental policy that may minimize human exposure and improve male reproduction.

The human sperm proteome - towards a panel for male fertility testing.

Although male factor accounts for 40-50% of unintended childlessness, we are far from fully understanding the detailed causes. Usually, affected men cannot even be provided with a molecular diagnosis. The aim of this study was to achieve a higher resolution of the human sperm proteome for better understanding of the molecular causes of male infertility. We were particularly interested in why reduced sperm count decreases fertility despite many normal-looking sperm, and which proteins might be involved. Applying mass spectrometry analysis, we qualitatively and quantitatively examined the proteomic profiles of sperm from 76 men differing in fertility. Infertile men had abnormal semen parameters and were involuntarily childless. Fertile subjects exhibited normozoospermia and had fathered children without medical assistance. We discovered proteins from about 7,000 coding genes in the human sperm proteome. These were mainly known for involvements in cellular motility, response to stimuli, adhesion, and reproduction. Numbers of sperm proteins showing at least three-fold deviating abundances increased from oligozoospermia (n = 153) and oligoasthenozoospermia (n = 154) to oligoasthenoteratozoospermia (n = 368). Deregulated sperm proteins primarily engaged in flagellar assembly and sperm motility, fertilization, and male gametogenesis. Most of these participated into a larger network of male infertility genes and proteins. We expose 31 sperm proteins displaying deviant abundances under infertility, which already were known before to have fertility relevance, including ACTL9, CCIN, CFAP47, CFAP65, CFAP251 (WDR66), DNAH1, and SPEM1. We propose 18 additional sperm proteins with at least eight-fold differential abundance for further testing of their diagnostic potential, such as C2orf16, CYLC1, SPATA31E1, SPATA31D1, SPATA48, EFHB (CFAP21), and FAM161A. Our results shed light on the molecular background of the dysfunctionality of the fewer sperm produced in oligozoospermia and syndromes including it. The male infertility network presented may prove useful in further elucidating the molecular mechanism of male infertility. This article is protected by copyright. All rights reserved.

The specific psychosocial modulator factors of emotional adjustment in infertile individuals compared to fertile people

Certain psychological and social factors modulate emotional adjustment in infertility. The aims of this study were: analyse whether there are sex and group differences (infertile vs. fertile) in emotional adjustment, and personality, dispositional optimism, coping strategies, personal and interpersonal resources; observe the modulating role of these psychosocial variables in the emotional adjustment of infertile individuals compared to fertile ones; and determine if the modulator variables associated with emotional adjustment are specific to infertile people. Method: A cross-sectional study design was used with a sample of 139 heterosexual Spanish participants (84 infertile, 55 fertile). For the data analysis we performed correlations, multiple regression analysis, MANOVAS and ANOVAS. Results: The multivariate and univariate analyses showed that the infertile group exhibited greater emotional maladjustment, more personal resources, lesser degree of confrontive coping, social support seeking, positive reappraisal, and lower marital satisfaction than the fertile group. In addition, women (infertile and fertile) sought more social support seeking and the infertile ones made more use of self-controlling strategies. Multiple regression analyses showed that for all subjects the emotional adjustment was modulated by dispositional optimism and escape/avoidance. For infertile participants, the remaining significant modulating factors were personal resources and marital satisfaction, whereas, for the fertile group, they were openness and interpersonal resources. Conclusion: Infertile women and men showed no differences in emotional maladjustment, but levels were higher than in the fertile group. We found differences between infertile and fertile subjects in terms of modulating variables of emotional adjustment. For infertile participants, the development of personal resources and increased marital satisfaction are particularly important.

EVALUATION OF SEMEN SAMPLE PARAMETERS IN MALE INFERTILE SUBJECTS AND ITS CORRELATION WITHY CHROMOSOME MICRODELETION IN POPULATION OF DODA CITY, JAMMU AND KASHMIR

Introduction: More than half of reproductive difficulties cannot be attributed to female characteristics. A number of illnesses and conditions that may have an impact on male fertility have been found via recent research. A number of underlying diseases and health issues, as well as environmental variables, may contribute to male infertility. For a sexually active couple, infertility is diagnosed after a year of unsuccessful attempting to conceive. Infertility affects around 19% of couples who have trouble conceiving. Any and all racial and ethnic groups may feel at home within these parameters. Materials and Methods: The study was conducted in 100 infertile patients and 50 fertile subjects were use as controls. The sample will be obtained by masturbation and ejaculated into a clean and proper labeled, wide-mouthed container made of glass or plastic according to the rules laid down by WHO. Result and Conclusion: The sperm count in infertile and fertile subjects were 15.8 ± 2.85 and 56.57 ± 8.47 respectively, Motility 37.6±1.8and 54.4 ±1.8, volume 2±0.8 and 2.6±0.1, viability 53.7±1.4 and 66±1.2. Out of 100 infertile patients 5 percent subjects had Y chromosomal microdeletions (5 samples of 100).

EVALUATION OF SEMINAL FRUCTOSE AND CITRIC ACID LEVELS IN INFERTILE MALES AND ITS CORRELATION WITH BODY MASS INDEX (BMI) IN POPULATION OF JAMMU AND KASHMIR

Introduction:30-35% of total population in Jammu and Kashmir reportedly has infertility problem which can be related to many factors. Overweight and obesity is one such factor which have a negative effect on fertility. It is generally assumed that obese patients have higher fat content in semen samples and that higher BMI value alters the level of reproductive hormones. Materials and methods: 150subjects (100 infertile as test and 50 fertile subjects as controls) were taken after taking proper consent. Sample was collected by the criteria laid down by WHO 2010. Results:In this study, the sperm count was found as 56.57 ± 8.47 in fertile and 15.8 ± 2.85 in infertile subjects. The fructose levels for controls and test were found out to be 108.29±2.97 and 92.68±3.75. And the citric acid levels are 36.70 ±1.65 and 42.16±1.22 in control and test respectively. Conclusion: In our study conducted in the population of Jammu and Kashmir, it has been found that increase BMI value has a significant relation with infertility.

Genome-Wide Association Screening Determines Peripheral Players in Male Fertility Maintenance

Deciphering the functional relationships of genes resulting from genome-wide screens for polymorphisms that are associated with phenotypic variations can be challenging. However, given the common association with certain phenotypes, a functional link should exist. We have tested this prediction in newly sequenced exomes of altogether 100 men representing different states of fertility. Fertile subjects presented with normal semen parameters and had naturally fathered offspring. In contrast, infertile probands were involuntarily childless and had reduced sperm quantity and quality. Genome-wide association study (GWAS) linked twelve non-synonymous single-nucleotide polymorphisms (SNPs) to fertility variation between both cohorts. The SNPs localized to nine genes for which previous evidence is in line with a role in male fertility maintenance: ANAPC1, CES1, FAM131C, HLA-DRB1, KMT2C, NOMO1, SAA1, SRGAP2, and SUSD2. Most of the SNPs residing in these genes imply amino acid exchanges that should only moderately affect protein functionality. In addition, proteins encoded by genes from present GWAS occupied peripheral positions in a protein-protein interaction network, the backbone of which consisted of genes listed in the Online Mendelian Inheritance in Man (OMIM) database for their implication in male infertility. Suggestive of an indirect impact on male fertility, the genes focused were indeed linked to each other, albeit mediated by other interactants. Thus, the chances of identifying a central player in male infertility by GWAS could be limited in general. Furthermore, the SNPs determined and the genes containing these might prove to have potential as biomarkers in the diagnosis of male fertility.

Lipophilic phthalic acid esters impair human sperm acrosomal reaction through the likely inhibition of phospholipase A2-signaling pathway

Phthalic acid esters (PAEs) are recognized endocrine disruptors. Detection of PAEs in semen from idiopathic infertile males suggests possible direct mechanisms of sperm toxicity. In this study we aimed to correlate sperm function with semen levels of PAEs. Semen samples were obtained from 100 male patients attending the Unit of Andrology and Reproductive Medicine, University Hospital of Padova, (Italy), 22 of which having a recognized history of idiopathic infertility. Compared to fertile subjects, infertile patients showed reduced levels of acrosome reaction (AR), evaluated by CD46 staining upon progesterone (P4) triggering (p < 0.001). Subjects showing positive detection of PAEs in semen, evaluated by liquid chromatography-mass spectrometry (LC-MS), were significantly more represented in those reporting an history of infertility (13 out of 22), compared to fertile subjects (25 out of 78, P = 0.0266). In vitro sperm exposure to PAEs showed that lipophilic PAE representative Di-n-octyl phthalate (DNOP) had higher cell accumulation and inhibition of P4-induced AR than less lipophilic PAE representative Dibutyl phthalate (DBP). Computer-based binding analysis and fluorimetric inhibition assay, showed that both DNOP and DBP had similar Phospholipase-A2 (PLA2) inhibitory activity (respectively: 3.98 nM and 5.52 nM). However, only DNOP showed a significant inhibition of PLA2-mediated AR, triggered by A23187 calcium ionophore. Incubation with PLA2-related product arachidonic acid restored AR. Our data are suggestive of a novel mechanistic model of PAEs interference on sperm function, through the inhibition of PLA2-mediated signaling. According to this hypothesis, the inhibitory efficacy of the specific PAE is possibly linked to the corresponding cell accumulation.

The association of testis-specific hTAF7L gene variants with idiopathic azoospermic and severe oligozoospermic male infertility.

Spermatogenesis is regulated by complex tissue specific gene expression in the testis to achieve normal male fertility. X-chromosome specific TATA binding protein (TBP)-associated factor 7L (hTAF7L) is one of the transcriptional regulator genes considered essential for spermatogenesis. The aim of this study was to evaluate the role of variants/mutations in the testis-specific hTAF7L gene in non-obstructive azoospermia and severe oligozoospermia male infertility. We studied 156 idiopathic non-obstructive azoospermic, severe oligozoospermic infertile males and 50 fertile proven controls. Infertile males and control subjects were genotyped for variants of the hTAF7L gene using polymerase chain reaction and a direct Sanger sequencing approach. The odds ratio evaluated the association of hTAF7L gene variants with idiopathic male infertility. The variants found in the hTAF7L gene were subjected to an in-silico analysis study. In infertile study subjects, we observed 11 single base pair nucleotide changes at various exons and three frameshift variants at exon 10 in the hTAF7L gene. We also found more than one variant in some non-obstructive azoospermia and severe oligozoospermia infertile males along with control subjects. All these variants changed the amino acid sequences in the hTAF7L gene. However, similar changes were also seen in fertile subjects, and the differences were not statistically significant. In-silico tools also predicted that the variants were likely to be benign. The variants in cDNA of the hTAF7L gene were typical SNPs. It is found that the hTAF7L gene is highly polymorphic and these missense variants are not directly associated with male infertility. However, we feel that more studies are needed to elucidate the role of multiple variants of the hTAF7L gene in the process of normal spermatogenesis.

Anisothermal flow dynamics in ventilated open space involved with indoor comfort

Energy cooling systems or thermal buildings are increasingly fertile subject for reducing the energy demand or for the indoor air quality coupled with energy demand. This work is devoted to studying cooling ability within an open domain. The space model is considered as a cavity heated on one external sidewall and cooled by three vertical boards which separate the room into four sub-domains. A complex flow structure is obtained in the present “cooperating” case, in which dynamic and buoyancy forces are added together on the active wall. It shows that the natural convection and the forced flow (injection) act directly on the resulting patterns, heat exchange, mixing ability, which control the thermal field homogeneity and the cooling necessity. The computation results show the influence of the parameters and the vertical boards on heat transfer in the enclosure. Under the wide range of Rayleigh (Ra) and Reynolds (Re) numbers, the features of dynamic and thermal fields permit to categorize the different convection phenomena. The intensity of mixing was quantified versus Ra and Re and we find the conditions and threshold of the different domains (diffusive, natural, forced and mixed convection).