Ferguson Plots Research Articles

Molecular weight of major component proteins in crude saline extract of adult Paragonimus westermani

When the component proteins in crude saline extract of 13-week old adult Paragonimus westermani were observed by non-denaturing discontinuous-polyacrylamide gel electrophoresis (Disc-PAGE), 8 distinct bands were clearly recognized. Molecular weight (MW) of each band protein, numbered in sequence from cathodal side which appeared in 10% separating gel, was measured first by Ferguson plot utilizing different gel concentrations from 10% to 4.5%. MW of band 1 protein (known as egg protein) was 440 kDa. And MW of other band proteins were: 386 kDa in band 2, 17.4 kDa in band 3, 17 kDa in band 4, 14.3 kDa in band 5, 46 kDa in band 6, 38 kDa in band 7 and 23 kDa in band 8. When the proteins in the crude extract were separated into fractions by molecular sieve chromatography through 1.6(phi) X 70 cm sized Sephacryl S-300 Superfine column and revisualized by Disc-PAGE in 8% gel, the sequence of eluted proteins was band 1, band 2, band 6, band 7 and bands 3, 4, 5 and 8. This elution profile confirmed MW of each band protein in the crude extract as measured by Ferguson plot.

Estimation of polyacrylamide gel pore size from Ferguson plots of normal and anomalously migrating DNA fragments. I. Gels containing 3 % N, N′‐methylenebisacrylamide

The mobilities of normal and anomalously migrating DNA fragments were determined in polyacrylamide gels of different acrylamide concentrations, polymerized with 3% N,N'-methylenebisacrylamide as the crosslinker. The DNA samples were a commercially available 123-bp ladder and two molecular weight ladders containing multiple copies of two 147-base pair (bp) restriction fragments, obtained from the MspI digestion of plasmid pBR322. One of the 147 bp fragments is known to migrate anomalously slowly in polyacrylamide gels. Ferguson plots were constructed for all multimer ladders, using both absolute mobilities and relative mobilities with respect to the smallest DNA molecule in each data set. If the retardation coefficients were calculated from the relative mobilities, and the rms radius of gyration was used as the measure of DNA size, the Ogston equations were obeyed and the gel fiber parameters could be calculated. The effective pore sizes of the gels were estimated from the gel concentration at which the mobility of a given DNA molecule was reduced to one-half its mobility at zero gel concentration. The estimated pore radii ranged from approximately 130 nm for 3.5% gels to approximately 70 nm for 10.5% gels. These values are much larger than the pore sizes previously determined for the polyacrylamide matrix.

Pressure refilled polyacrylamide columns for the separation of oligonucleotides by capillary electrophoresis

The separation of oligonucleotides by capillary zone electrophoresis (CZE) was studied in fused silica separation capillaries filled by linear (noncrosslinked) polyacrylamide (PAA) solutions, introduced into the capillary from the stock by pressure after each analysis. The time-consuming in-capillary polymerization step could thus be avoided, and fast and reproducible repetition of the analyses was assured. The PAA concentrations varied within the range of 3-10% and both the reproducibility of the analyses and the stability of the solution in the capillary, with and without a chemically treated inner wall, were tested. Ferguson plots were used to assess the size selectivity of the separation.

Simultaneous Ferguson plot analysis, using electrophoresis on a single agarose pore gradient gel, of DNA fragments contained in a mixture

A recent study has demonstrated the feasibility of obtaining Ferguson plots in agarose gel electrophoresis, using a single pore gradient gel. We now report three remedies for defects in the previous experimental approach: (i) UV-absorbing media for density stabilization of the gel is avoided by replacing 5-(N-2,3-dihydroxypropylacetamido)-2,4,6-triiodo-N,N'-bis(2,3-dihy droxypropyl) isophthalamide (Nycodenz) with heavy water; this renders the method applicable to ethidium bromide-labeled DNA. (ii) The density stabilizing medium is kept from having an effect on field strength. (iii) Data collection by uninterrupted time-lapse photography is possible by using an apparatus with a quartz window. These three measures make the method practical for the gel electrophoretic identification and physical characterization of DNA species, potentially up to 50 kb in size.

Protein kinases associated with proliferation and differentiation in murine erythroleukaemic cells

1. 1. The changes in electrophoretic distribution of cytosolic protein kinases have been studied in relation to proliferation, differentiation and transformation in murine erythroleukaemic cells, using a non-denaturing polyacrylamide gel electrophoresis system. 2. 2. Native molecular masses of the major forms were determined by Ferguson plots. 3. 3. A two dimensional electrophoresis method was developed for determination of the subunit molecular masses. 4. 4. These studies suggest that the major bands of activity contain components which may correspond to cGMP dependent protein kinase, cAMP dependent protein kinase and protein kinase C. 5. 5. On hexamethylene bisacetamide induced differentiation of the cells, changes in proportions of the different forms were observed.

Free mobility determination by electrophoresis in polyacrylamide containing agarose at a nonrestrictive concentration

In the determination of the free mobility, related to the surface net charge, by quantitative gel electrophoresis, the previous arbitrary extrapolation of Ferguson plots from the lowest gel concentrations that give a mechanically stable gel to 0% T has recently been replaced by measurement of mobilities across that concentration range, using the addition of 0.5% agarose to polyacrylamide at the various low concentrations in application to a DNA fragment 155 bp in size (Orbán, L. et al., in preparation). The present study applies that approach to several proteins and DNA fragments smaller than 1300 bp, using 0.4% agarose in polyacrylamide gels of varying concentration. The intercepts of the plots with the mobility axis provide experimental data by which the free mobility in polyacrylamide gel electrophoresis can be estimated for molecules not significantly retarded in their migration at the agarose concentration admixed to polyacrylamide. Across the gel concentration range below 3% T, in the presence of agarose, the Ferguson plots of proteins and DNA fragments are convex. It was shown by mass spectrometry that this convex curvature of the plots in the mixed polymer is not significantly due to low polymerization efficiency in the concentration range of liquid polyacrylamide (below 3%T).

Separation of DNA restriction fragments by high performance capillary electrophoresis with low and zero crosslinked polyacrylamide using continuous and pulsed electric fields

This paper presents results on the separation of DNA restriction fragments by high performance capillary electrophoresis (HPCE). Capillaries containing polyacryl- amide with low amounts of crosslinking agent ( i.e. 0.5% C) were first studied. The greater molecular accessibility offered with columns of low crosslinking, relative to higher crosslinked gels ( e.g. 5%C), permitted high efficiency separations of double stranded DNA fragments up to 12 000 base pairs in length. Capillaries containing no crosslinking agent, i.e. linear polyacrylamide, were then examined. Ferguson plots ( i.e. log mobility vs. %T) were used to assess the size selectivity of linear polyacryl- amide capillaries. In another study, it was determined that the relative migration of DNA species was a strong function of applied electric field and molecular size. Lower fields yielded better resolution than higher fields for DNA molecules larger than about 1000 base pairs, albeit at the expense of longer separation time. Based on these results, we have examined pulsed field HPCE and have demonstrated the use of this approach to enhance separation.

Triple helix formation by oligopurine-oligopyrimidine DNA fragments: Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

The electric field dependence of DNA mobilities in agarose gels: A reinvestigation

The electric field dependence of the electrophoretic mobility of linear DNA fragments in agarose gels was reinvestigated in order to correct the observed mobilities for the different temperatures actually present in the gel during electrophoresis in different electric field gradients. When corrected to a common temperature, the electrophoretic mobilities of DNA fragments less than or equal to 1 kilobase pairs (kbp) in size were independent of electric field strength at all field strengths from 0.6 to 4.6 V/cm if the gels contained less than or equal to 1.4% agarose. The mobilities of larger DNA fragments increased approximately linearly with electric field strength. If the agarose concentration was higher than 2%, the mobilities of all DNA fragments increased with increasing electric field strength. The electric field dependence of the mobility was larger in gels cast and run in Tris-borate buffer (TBE) than in gels cast and run in Tris-acetate buffer (TAE), and was more pronounced in gels without ethidium bromide incorporated in the matrix. Ferguson plots were constructed for the various DNA fragments, both with and without extrapolating the temperature-corrected mobilities to zero electric field strength. Linear Ferguson plots were obtained for all fragments less than or equal to 12 kbp in size in agarose gels less than or equal to 1.4% in concentration if the mobilities were first extrapolated to zero electric field strength. Concave upward curvature of the Ferguson plots was observed for DNA fragments greater than or equal to 2 kbp in size at finite electric field strengths. Convex downward curvature of the Ferguson plots was observed for DNA fragments greater than or equal to 1 kbp in size in agarose gels greater than or equal to 2% in concentration. The mobilities of the various DNA fragments, extrapolated to zero agarose concentration and zero electric field strength, decreased with increasing DNA molecular weight; extrapolating to zero molecular weight gave an "intrinsic" DNA mobility of 2.7 x 10(-4) cm2/Vs at 20 degrees C. The pore sizes of LE agarose gels cast and run in TAE and TBE buffers were estimated from the mobility of the DNA fragments.(ABSTRACT TRUNCATED AT 400 WORDS)

The Ryanodine Receptor-Ca2+ Release Channel Complex of Skeletal Muscle Sarcoplasmic Reticulum: Evidence for a Cooperatively Coupled, Negatively Charged Homotetramer

Abstract The subunit structure of the rabbit skeletal muscle ryanodine receptor-Ca2+ release channel complex was examined following solubilization of heavy sarcoplasmic reticulum membranes in two zwitterionic detergents, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid (Chaps) and Zwittergent 3-14. High and low affinity [3H]ryanodine binding was retained upon solubilization of the complex in Chaps but was lost in Zwittergent 3-14. The purified complex migrated as a single peak with an apparent sedimentation coefficient of approximately 30 and approximately 9 S upon density gradient centrifugation and with isoelectric points of 3.7 and 3.9 upon two-dimensional gel electrophoresis in Chaps and Zwittergent 3-14, respectively. Electron microscopy of negatively stained samples indicated that the distinct four-leaf clover structure of the ryanodine receptor observed in Chaps disappeared following Zwittergent treatment of the 30 S complex and instead showed smaller, round particles. Ferguson plot analysis following sodium dodecyl sulfate-polyacrylamide gel electrophoresis of partial and fully cross-linked and incompletely denatured complexes suggested a stoichiometry of four Mr approximately 400,000 peptides/30 S ryanodine receptor oligomer. [3H]Ryanodine binding to the membrane-bound receptor in 50 microM--1 mM free Ca2+ revealed the presence of both high affinity (KD = 8 nM, Hill coefficient (nH) = 0.9) and low affinity (nH approximately 0.45) sites with a ratio of 1:3. Reduction in free Ca2+ to less than or equal to 0.1 microM or trypsin digestion of the membranes resulted in loss of high affinity but not low affinity ryanodine binding (Hill KD = 5,000 nM, nH = 0.9). Addition of 20 mM caffeine to the nanomolar Ca2+ medium decreased the Hill KD to 1,000 nM without changing the Hill coefficient. Occupation of the low affinity sites altered the rate of [3H]ryanodine dissociation from the high affinity sites. Single channel recordings of the purified ryanodine receptor channel incorporated into planar lipid bilayers also indicated the existence of high and low affinity sites for ryanodine, occupation of which resulted in formation of a subconducting and completely closed state of the channel, respectively. These results are compatible with a subunit structural model of the 30 S ryanodine receptor-Ca2+ release channel complex which comprises a homotetramer of negatively charged and allosterically coupled polypeptides of Mr approximately 400,000.

Electrophoretic analysis of large molecular weight forms of the estrogen receptor in MCF-7 human breast cancer cells

The denatured and nondenatured forms of the estrogen receptor (ER) in MCF-7 human breast cancer cells have been characterized by gel electrophoresis using the covalently attaching ligand [ 3H]tamoxifen aziridine ([ 3H]TA). A comparison of the ER binding properties of the recently introduced commercial preparation (Amersham) of [ 3H]TA with the prototype showed no quantitative or qualitative differences, with both preparations binding efficiently and selectively at either 4°C or 37°C. The nuclear and cytosolic labeled ER, when analyzed by denaturing SDS-PAGE, migrate as 67,000 dalton proteins. [ 3H]TA labeled ER from cytosol prepared in low salt buffer without protease inhibitors migrates on 5%, 6%, or 7% nondenaturing PAGE as two discrete forms. The molecular weights of these two species, determined by Ferguson plot analysis with multiple standard protein markers, are 260,000 and 67,000 daltons, respectively. The 260 kDa form is dissociated by 0.4 M KC1 into the 67 kDa form, suggesting that the larger form is composed of one or more noncovalently attached subunit proteins. When enzyme inhibitors leupeptin and molybdate are included in cytosol prepared in low salt, two high molecular weight [ 3H]TA labeled peaks are identified, the first 600,000 and the second 430,000 daltons. These two forms migrate together on 4%, 5%, and 6% non-SDS, non-denaturing gels, and are not dissociated when cytosol is made 0.4 M in KC1. These findings indicate that the ER of these human breast cancer cells exists in one or more large discrete forms of mol. wt 430,000–600,000 daltons. These forms are not dissociated by high salt but may be digested by proteases to the subunit 67,000 dalton form. These findings support the proposal that the ER is present as a large molecular weight “holoreceptor”, and may be important for our understanding the metabolism and function of the ER in estrogen target tissues and human breast cancer.

A thin-layer multistrip agarose gel electrophoresis apparatus for Ferguson plot analysis at the sub-microgram load level

A method for the simultaneous horizontal agarose gel electrophoresis on thin layer strips of different gel concentrations was developed for the purpose of generating Ferguson plots at the sub-microgram load level. Seven independent gel strips on a common GelBond support formed by filling channels created by a comb-shaped spacer (polycarbonate) in a vertical multistrip cassette. Electrophoresis on a horizontal Peltier-cooled surface employed commercial apparatus (E-C Apparatus Corp.) with a modified cover which is airtight and holds anodic and cathodic voltage measurement probes for each strip. The application of the apparatus to Ferguson plot analysis in a single experiment wa exemplified on the RNA-containing turnip crinkle virus (TCV) at a load of 50 ng/gel strip, using an optimized silver staining method (a modification of a procedure of FMC Corp. BioProducts) for detection. Within the range of 3.5 to 12.5 V/cm, the plot was found to be independent of field strength. Mobility is also independent of the concentration of detergent (CHAPS) up to 10 mM.

Sieving of ionic constituents across moving boundaries in gel electrophoresis.

The representative beta-hydroxyethylmorpholinium-chloride-bicinate moving boundary with a trailing ion net mobility relative to Na+ of 0.41, detected by precipitation of chloride with silver nitrate, exhibits a decreasing chloride mobility at increasing polyacrylamide gel concentrations from 3.5 to 45%T, 5%CBis. This decrease, largely due to an increase of field strength at constant current, is described by a convex* plot of log (mobility) vs. %T (Ferguson plot) and signifies that chloride/bicinate are sieved by the gel. In agarose gels, the same plot of mobility vs. gel concentration is constant below 7% gel concentration, since in those gels field strength and migration rate remain the same within that gel concentration range. Both in polyacrylamide and in agarose gels the displacement rate of the chloride-bicinate boundary as a function of the time of electrophoresis or distance migrated remains invariant within 15%. The plot of log (mobility) vs. gel concentration extrapolated to 0%T is 5.85 and 5.41 (10(-5) cm2s-1V-1) for polyacrylamide and for agarose (SeaKem HGT-P,FMC) gels, respectively. The slightly decreased mobility intercept at 0%T for agarose is presumably due either to the electroendosmotic properties of agarose HGT-P and/or failure to Sufficiently take into account the flattening of the Ferguson plot in the polyacrylamide concentration range below 3% in which a transition from a gel to a fluid (sol) medium takes place.

A thin-layer multistrip polyacrylamide gel electrophoresis apparatus for Ferguson plot analysis at the submicrogram load level.

A procedure was developed for casting thin-layer multistrip polyacrylamide gels and using them for the simultaneous gel electrophoresis at several gel (Ferguson plot analysis) at the sub-microgram load level, using silver staining, autoradiography and, potentially, blotting for detection. The lower viscosity of polymerization mixtures, compared to agarose gelation mixtures, required the redesign of the multistrip cassette with separation of channels by rubber gaskets and the application of a cassette press. The lowered viscosity also required addition of 35% sucrose and an increased rate of polymerization in application to multistrip gels formed on a common NetFix backing. The present design allows one to obtain Ferguson plots exemplified by those of 32P-labeled DNA followed by autoradiographic detection.

Program in BASIC for Ferguson plot analysis, using a personal computer: application to gel electrophoresis in a continuous buffer.

A program in BASIC suitable for personal computers is described which is applicable to gel electrophoresis conducted in a single (continuous) buffer. The curve fitting is to a polynomial function, allowing for an objective selection of the most appropriate curve type and order--linear, convex or concave--in the particular application. Results do not differ significantly from previous programs for evaluation of linear Ferguson plots or of curve fitting to an exponential function for evaluating convex plots, executed on mainframe computers such as the DEC-10 (Digital) and IBM 370 computers. Thus, the program combines original versatility with, for the first time, the possibility for widespread application of Ferguson plot analysis on personal computers.

Gel electrophoretic analysis of DNA branched junctions

Gel electrophoresis has provided much of the detailed information we have about the properties of DNA junctions, stable branched molecules formed from oligonucleotide or polynucleotide strands. Here we review these applications, and present the results of an electrophoretic investigation of conformationally restricted junctions formed by covalently connecting two different pairs of strands in a junction with four arms. Native gel electrophoresis is employed to establish the formation and stoichiometry of the multistrand complexes. Ferguson analysis of native gel mobility shows that junctions have retardation coefficients that are distinct from those of linear DNA duplexes. Denaturing gel electrophoresis is the primary tool for characterizing junctions that have been covalently linked together to form both linear and macrocyclic oligomers of junctions (oligojunctions). Radioactively labelled strands enable one to monitor the progress of the ligation reaction: both linear and closed cyclic molecules result, and these can be distinguished by applying Ferguson analysis to denaturing gels. Combinations of exonuclease III, restriction enzymes and sequencing reactions have been applied to oligojunction molecules, and the results are all analyzed on denaturing gels. Junctions containing intramolecular "tethers" that restrict the conformation freedom of the complex comprise a new system for analyzing the conformations of branched molecules. In these tethered junctions, the ability of arms to move relative to each other is restricted substantially by covalently connecting pairs of arms in the original complex with short, flexible loops. The two tethers used here constrain the helical domains of the structure to be roughly parallel or anti-parallel. In this article, we use Ferguson analysis to compare two tethered junctions with an untethered junction. At high gel concentrations, the mobility of the untethered complex is found to be closer to that of the molecule tethered anti-parallel than to the one tethered parallel. Curvature in the Ferguson plots for all three of these junctions is detected over a range of compositions. At low gel concentrations, differences in electrophoretic mobility persist, suggesting that the untethered junction differs in charge as well as conformational freedom from the tethered analogs. We expect that studies of this kind will be able to define the conformational repertoire of junctions of different kinds, and to explore the effects of electrophoresis on these states.

Analysis of steric partition behavior of molecules in membranes using statistical physics. Application to gel chromatography and electrophoresis

The principles of statistical physics are used to formulate general expressions for the steric partition behavior of molecules in both random and ordered membrane structures that may be applied to any shape of the solute and/or the volume-excluding element of the membrane. These expressions fully define partitioning in terms of the volume excluded to point molecules and to finite-sized molecules. The mean effective exclusion volume for a molecule is calculated as a function of a global interaction energy, which varies with position, conformation, and orientation of the molecule. It allows consideration of electrostatic and other nonsteric factors. To test the model, specific partition functions are derived for several simple geometries describing the membrane and solute. Frequently, the derived expressions agree with past analyses; however, a new expression describing partitioning within an random network of fibers is derived. It agrees with past results only in the limit of low exclusion volumes. With greater volume exclusions, past results greatly overestimate the partition function. It is applied to gel electrophoresis and chromatography and survives testing with available experimental data. Unlike past analyses, it predicts nonlinear Ferguson plots for agarose gel electrophoresis. In addition, an analytical expression predicting the minimum radius of a sphere excluded from a random fiber matrix is derived, tested, and found to agree with experimental data.

Decay studies of 237Np with an iron-free π√2 double-focusing β-ray spectrometer of improved efficiency : S.A. Woods, P. Christmas, P. Cross, S.M. Judge and W. Gelletly, Nucl. Instr. and Meth. A264 (1988) 333–356.

A method for the simultaneous horizontal agarose gel electrophoresis on thin layer strips of different gel concentrations was developed for the purpose of generating Ferguson plots at the sub-microgram load level. Seven independent gel strips on a common GelBond support formed by filling channels created by a comb-shaped spacer (polycarbonate) in a vertical multistrip cassette. Electrophoresis on a horizontal Peltier-cooled surface employed commercial apparatus (E-C Apparatus Corp.) with a modified cover which is airtight and holds anodic and cathodic voltage measurement probes for each strip. The application of the apparatus to Ferguson plot analysis in a single experiment wa exemplified on the RNA-containing turnip crinkle virus (TCV) at a load of 50 ng/gel strip, using an optimized silver staining method (a modification of a procedure of FMC Corp. BioProducts) for detection. Within the range of 3.5 to 12.5 V/cm, the plot was found to be independent of field strength. Mobility is also independent of the concentration of detergent (CHAPS) up to 10 mM.

The purification and characterization of mannosidase IA from rat liver Golgi membranes.

Rat liver Golgi membranes contain two alpha 1,2-specific mannosidases (IA and IB) (Tulsiani, D. R. P., Hubbard, S. C., Robbins, P. W., and Touster, O. (1982) J. Biol. Chem. 257, 3660-3668). Mannosidase IA has now been purified to apparent homogeneity by detergent extraction and (NH4)2SO4 precipitation, followed by Sephacryl S-300, ion-exchange, and hydroxylapatite chromatography. The enzyme was homogeneous by nondenaturing polyacrylamide gel electrophoresis with different gel concentrations, and Ferguson plot analysis indicated an Mr of 230,000 for the native enzyme. Although electrophoresis under denaturing conditions generally gave a subunit Mr of 57,000, electrophoresis of less than 1 microgram of protein yielded a faint doublet of Mr 57,000 and 58,000. Thus, the enzyme appears to be a tetramer with four very similar subunits. The enzyme bound to concanavalin A-Sepharose 4B only when it was kept in contact with the lectin for 16 h. Endoglycosidase H treatment resulted in loss of its binding to the lectin, without leading to a detectable change in the size of the enzyme subunit. On electrophoretic gels, the enzyme gave a faint positive stain with periodic acid-Schiff's base. The enzyme contained about 0.9% hexose by direct analysis. It did not bind to affinity resins specific for neuraminic acid, galactose, or N-acetylglucosamine. All these studies suggest that the enzyme is a glycoprotein containing only one or two clusters of high mannose oligosaccharide. Mannosidase IA is active toward oligosaccharides containing alpha 1,2-linked mannosyl residues. [3H]Man9GlcNAc, [3H] Man8GlcNAc, [3H]Man7GlcNAc, and [3H]Man6GlcNAc are good substrates. Man9GlcNAc, the best substrate, yields Man8, Man7, and Man6 derivatives with structures suggesting that the sequence of release of mannose residues is rather specific. Immunoprecipitation studies using polyclonal antibody (IgG) prepared against homogeneous mannosidase IA cross-reacted with mannosidase IB, a result suggesting that these two enzymes share antigenic determinants. However, no cross-reactivity was observed with rat liver cytosolic and lysosomal alpha-D-mannosidases or with Golgi mannosidase II.

Malate dehydrogenase isozymes in flax genotroph leaves: differences in apparent molecular weight and charge between and within L and S.

Ferguson plots demonstrated that corresponding malate dehydrogenase (MDH) isozymes of Durrant's L and S flax genotrophs differ in apparent molecular weight (MW) and also in net negative charge. The MW differences explain heritable differences in electrophoretic relative mobility (Rm) between corresponding L and S isozymes. The MW for each MDH isozyme was higher for L than for S and resulted in a slower Rm for L. The net negative charge for each isozyme was higher for L than for S. MDH isozymes also differ in MW within L and S. MW was lower for isozymes in leaves from the bottom of the stem than in leaves from the top of the stem, particularly in L. Integration of information on the MDH isozyme system in the flax genotrophs and information on the peroxidase system suggests the possibility that common modifier loci may control Rm in both enzymes.