Features Of Sickle Cell Disease Research Articles

Sickle cell disease

Sickle cell disease

Kidney abnormalities in sickle cell disease.

Patients with sickle cell disease exhibits numerous kidney structural and functional abnormalities, changes that are seen along the entire length of the nephron. Changes are most marked in patients with homozygous sickle cell anemia, but are also seen in those with compound heterozygous states and the sickle cell trait. The renal features of sickle cell disease include some of the most common reasons for referral to nephrologists, such as hematuria, proteinuria, tubular disturbances and chronic kidney disease. Therapy of these conditions requires specialized knowledge of their distinct pathogenic mechanisms. Spanish Haemathology and Hemotherapy Association has recently publicated their Clinical Practice Guidelines of SCD management. Renal chapter is reproduced in this article for Nefrología difussion.

Características clínicas, moleculares e laboratoriais de crianças com doença falciforme do Rio de Janeiro

Abstract The inclusion of hemoglobin S tests in the neonatal screeningprogram provides an opportunity to better understand the naturalhistory of sickle cell disease in the Brazilian population. Objective:To investigate phenotypic, molecular and laboratory features ofsickle cell disease children in order to identify risk factors related toprognosis. Methods: Sickle cell disease screening was carried outby high performance liquid chromatography. The beta-globin genecluster, methylenetetrahydrofolate reductase (MTHFR-C677T),Factor V Leiden (FV-G1691A) and prothrombin (PT-G20210A)gene mutations were investigated by polymerase chain reaction -restriction fragment length polymorphism. Alpha (3.7kb and 4.2kb)thalassemia deletions were determined by polymerase chain reaction.Results: One hundred and twenty-four children with a mean age of57.3 months (range 1-180) were investigated. One hundred andseven had sickle cell anemia and 17 had hemoglobin SC. Beta-globingene haplotypes were identified for 123 children: 53 (43.1%) Bantu/Bantu, 36 (29.3%) Bantu/Benin, 18 (14.6%) Bantu/atypical, 3 (2.4%)Benin/Benin, 2 (1.6%) CI/ atypical, 7 (5.8%) Bantu/CI; 2 (1.6%)Benin/CI and 2 (1.6%) Benin/atypical. The alpha 3.7 kb thalassemiamutation was found in 118 children, 19 (16.1%) were heterozygousand 3 (2.5%) homozygous. No alpha 4.2 mutation was found. Among

Endothelial nitric oxide synthase and nitric oxide regulate endothelial tissue factor expression in vivo in the sickle transgenic mouse

Activation of the coagulation system is a characteristic feature of sickle cell anemia, which also includes clinical thrombosis. The sickle transgenic mouse abnormally expresses tissue factor (TF) on the pulmonary vein endothelium. Knowing that this aberrancy is stimulated by inflammation, we sought to determine whether nitric oxide (NO) contributes to regulation of endothelial TF expression in the sickle mouse model. We used the NY1DD sickle mouse, which exhibits a low-TF to high-TF phenotype switch on exposure to hypoxia/reoxygenation. Manipulations of NO biology, such as breathing NO or addition of arginine or L-NAME (N-nitro-L-arginine-methyl-ester) to the diet, caused significant modulations of TF expression. This was also seen in hBERK1 sickle mice, which have a different genetic background and already have high-TF even at ambient air. Study of NY1DD animals bred to overexpress endothelial nitric oxide synthase (eNOS; eNOS-Tg) or to have an eNOS knockout state (one eNOS(-/-) animal and several eNOS(+/-) animals) demonstrated that eNOS modulates endothelial TF expression in vivo by down-regulating it. Thus, the biodeficiency of NO characteristic of patients with sickle cell anemia may heighten risk for activation of the coagulation system.

Chronic haemolytic anaemia because of pyruvate kinase (PK) deficiency in a child heterozygous for haemoglobin S and no clinical features of sickle cell disease

Chronic haemolytic anaemia because of pyruvate kinase (PK) deficiency in a child heterozygous for haemoglobin S and no clinical features of sickle cell disease

Effect of sodium butyrate on lung vascular TNFSF15 (TL1A) expression: Differential expression patterns in pulmonary artery and microvascular endothelial cells

Vascular endothelial growth inhibitor TNFSF15 ( TL1A), a ligand for TNFRSF25 ( DR3) and decoy receptor TNFRSF6B ( DcR3), is expressed in human pulmonary arterial (HPAEC) and lung microvascular (HMVEC) endothelial cells where it might modulate inflammation and sickle vasculopathy. Pulmonary disease, endothelial abnormalities and inflammation are prominent features of sickle cell disease (SCD). Butyrate has opposing effects on endogenous TNFSF15 expression in pulmonary endothelium, acting as an inhibitor in HPAEC and an inducer in HMVEC. Similar effects were observed with a known cytokine TNF-α in these two cell types. Furthermore the TNFSF15 promoter utilized different combinations of cis-elements for its expression in these two cell types. AP1-like and G-rich sequence elements were critical for promoter activity in large vessel HPAEC while AP1-like and NF-κB consensus sequence elements were required in small vessel HMVEC. The requirement of an NF-κB sequence element by the TNFSF15 promoter in HMVEC but not in HPAEC supported the notion that HMVEC might be a target of inflammation and vasoocclusion in SCD. The dual effects of butyrate-dependant TNFSF15 regulation in lung endothelium may help in identify inflammatory pathways and understand the role of HMVEC in pathogenesis of vasoocclusion in SCD.

Sickle Red Cell–Endothelium Interactions

Periodic recurrence of painful vaso-occlusive crisis is the defining feature of sickle cell disease. Among multiple pathologies associated with this disease, sickle red cell-endothelium interaction has been implicated as a potential initiating mechanism in vaso-occlusive events. This review focuses on various interrelated mechanisms involved in human sickle red cell adhesion. We discuss in vitro and microcirculatory findings on sickle red cell adhesion, its potential role in vaso-occlusion, and the current understanding of receptor-ligand interactions involved in this pathological phenomenon. In addition, we discuss the contribution of other cellular interactions (leukocytes recruitment and leukocyte-red cell interaction) to vaso-occlusion, as observed in transgenic sickle mouse models. Emphasis is given to recently discovered adhesion molecules that play a predominant role in mediating human sickle red cell adhesion. Finally, we analyze various therapeutic approaches for inhibiting sickle red cell adhesion by targeting adhesion molecules and also consider therapeutic strategies that target stimuli involved in endothelial activation and initiation of adhesion.

Sickle cell disease and the kidney

The renal features of sickle cell disease (SCD) include some of the most common reasons for referral to nephrologists, such as hematuria, proteinuria, tubular disturbances and chronic kidney disease. Therapy of these conditions requires specialized knowledge of their distinct pathogenic mechanisms. Painless hematuria is usually benign--unless massive--and can be treated with hydration alone if renal medullary carcinoma has been ruled out. Tubular functional defects, which tend to reduce urinary concentrating capacity, generally require no specific treatment. Proteinuria might indicate the development of chronic sickle cell nephropathy, which can be treated effectively. Measurement of glomerular filtration rate in SCD is problematic, which makes identification and monitoring of chronic kidney disease difficult in patients with SCD. Although managing and predicting the outcomes of chronic kidney disease in the SCD setting is challenging, affected individuals do benefit from transplantation. This Review summarizes the presentation, processes, pathology, modifiers, diagnosis and treatment of the renal effects of SCD.

Acute splenic sequestration in an adult with hemoglobin S-C disease

Acute splenic sequestration crisis is a common, potentially life-threatening complication of sickle cell anemia in children that is uncommon in adults.We present the case of a 44-year-old gentleman with undiagnosed hemoglobin S-C disease who developed intense back pain, marked abdominal distension, systemic inflammatory response syndrome, and multisystem organ failure that first presented as acute splenic sequestration crisis. The hemoglobinopathy SC is a disease caused by heterozygous-globin chain mutations with over-lapping clinical features of sickle cell disease with changes in the frequency of these manifestations reflected by the combination of characteristics of hemoglobin C and hemoglobin S. In hemoglobin S-C disease, autosplenectomy is rare and splenomegaly usually persists until adulthood;vasoocclusive complications are seen less habitually and become evident at a later time compared with sickle cell disease. The diagnosis of hemoglobin S-C disease is essentially done by exclusion. Transfusion of red blood cells is the treatment of choice, but splenectomy is indicated if transfusion therapy fails. A review of the literature and keypoints for the emergency practitioner are included.

High oxygen environment during pregnancy rescues sickle cell anemia mice from prenatal death

Several mouse models of sickle cell disease have been developed for the study of the pathophysiology of sickle cell disease and the investigation of drug and gene therapies. In previous years, we produced a sickle cell anemia mouse model in which the endogenous mouse α- and β-globin genes were knocked out and replaced by the human α- and β s-globin transgenes. The β s-globin gene was contained in a 240 kb YAC that preserved the entire native genomic context of the β-globin locus. These mice have hemolytic anemia, reticulocytosis and irreversible sickle cells in the peripheral blood, as well as other pathological features of sickle cell disease. However, in the embryo, the γ-globin, like the mouse embryonic globin, declined quickly, and was replaced by β s-globin expression from 12 days of gestation. The low level of fetal hemoglobin expression in utero led to intrauterine sickling and fetal death so that very few live-born sickle cell anemia mice could be obtained. To rescue these mice from intrauterine death, we investigated the effect of placing the pregnant mothers in a high O 2 environment. From the tenth day of gestation onwards, we placed the mothers into a chamber containing 50% O 2 and kept them with the newborn pups in it for another 10 days after birth. The frequency of sickle cell anemia mice we obtained was increased from less than 2% to 35%. The survived sickle cell anemia mice develop congestion, atrophy, and infarcts in multiple organs similar to those found in patients with sickle cell disease. We conclude that a high oxygen environment can be used to obtain more sickle cell anemia mice in those models that have a high perinatal mortality. The higher yield of these mice has facilitated physiological and therapeutic studies of sickle cell anemia.

Blocking Adhesion of Sickle Erythrocytes to Endothelial P-Selectin Using an RNA Aptamer.

Vaso-occlusive crises are a major clinical feature of sickle cell disease (SCD), and the adhesion of sickle erythrocytes (SS-RBCs) to vascular endothelium is crucial to the generation of vaso-occlusion. SS-RBCs express many adhesion molecules. Adhesive SS-RBCs bind to endothelial cell P-selectin and other adhesion molecules, as well as extracellular matrix proteins. Thrombin causes endothelial retraction with exposure of proadhesive extracellular matrix components as well as upregulation of endothelial expression of P-selectin. Other investigators have shown that SS-RBCs can bind to P-selectin, thus suggesting that P-selectin is a suitable target against which to develop reagents to prevent or treat vaso-occlusive crises in SCD. Aptamers are oligonucleotides that bind to molecular targets in a manner conceptually similar to antibodies and have been identified against a wide range of therapeutic targets. RNA aptamers that bind to human P-selectin, inhibit P-selectin binding to its ligand sialyl Lewis X, and inhibit neutrophil-platelet adhesion have previously been identified (Antisense Nucleic Acid Drug Dev , 8:265, 1998). We have now tested one of these high-affinity P-selectin aptamers (clone PF377: ACGCUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAGCGCAACCAGUAACACC) for its ability to prevent cellular adhesion of SS-RBCs to endothelial cells. Aptamer clone PF377 bound P-selectin with a Kd of 6nM and a Bmax of 87%. To measure its anti-adhesion activity, an in vitro flow chamber assay was adopted. The anti-adhesion activity of aptamer clone PF377 was confirmed using primary human umbilical vein endothelial cells (HUVECs) treated with IL-13 (50ng/mL) for 48hrs, followed by stimulation with histamine (25μM for 12mins at RT) immediately prior to a flow chamber assay. Aptamer clone PF377 at 60nM had anti-adhesion activity similar to heparin (a previously identified inhibitor of SS-RBC adhesion to P-selectin) and 9E1 (an inhibitory antibody to P-selectin), whereas Bi 9.3t (a non-functional aptamer to thrombin, used as a negative control, 60nM) and AC1.2 (a non-inhibitory antibody to P-selectin), did not prevent adhesion (Figure). Normalized % inhibition by aptamer clone (PF377) at 60nM at 1 dynes/cm2 was 99% (Figure). In conclusion, we observed significant anti-adhesion activity of P-selectin aptamer clone PF377, and this aptamer is now suitable for modification to enhance stability and bioavailability. Since we previously reported strong anti-adhesion activity of integrin αvβ3 aptamer clone 17.16 (Blood , 108:206a, 2006), in vivo experiments in mice are currently employing intravital microscopy to measure anti-adhesion activity of aptamer clone 17.16, PF377, and both in combination. The development of combinatorial blocking aptamers against various adhesion molecules, including αvβ3 and P-selectin, represents a novel potential therapeutic option for patients with SCD. [Display omitted]

Mixed haematopoietic chimerism for sickle cell disease prevents intravascular haemolysis

Mixed haematopoietic chimerism for sickle cell disease prevents intravascular haemolysis

Musculoskeletal Manifestations of Sickle Cell Disease

Sickle cell disease results from the presence of abnormal beta globin chains within hemoglobin and may be manifested in anemia, vaso-occlusion, and superimposed infection. The gene that causes sickle cell disease is particularly prevalent in populations of African origin; approximately 8% of African Americans and 40% of the members of some African tribes carry the gene for hemoglobin S. Over time, the disease produces various musculoskeletal abnormalities as a result of chronic anemia; these include marrow hyperplasia, reversion of yellow marrow to red marrow, and, occasionally, extramedullary hematopoiesis. Familiarity with the imaging features of sickle cell disease is important for the diagnosis and management of complications. Ischemia and infarction are common complications that may have long-term effects on the growth of bone; these conditions have characteristic radiographic appearances. Infection may be more difficult to identify. Both infection and infarction may occur in muscle and soft tissue alone, without involving bone. However, osteomyelitis must be diagnosed early and treated immediately to prevent bone destruction and deformity; therefore, care must be taken to achieve an accurate diagnosis by identifying or excluding bone involvement. The clinical and radiographic features of acute osteomyelitis may be particularly difficult to distinguish from those of bone infarction. In that context, magnetic resonance (MR) imaging may be useful. At MR imaging, findings of cortical defects, adjacent fluid collections in soft tissue, and bone marrow enhancement are suggestive of infection.

High Oxygen Environment during Pregnancy Rescues Sickle Cell Animia Mouse from Prenatal Death.

Several mouse models for sickle cell disease have been developed for the studies of the pathophysiology of sickle cell disease and the investigations of drug and gene therapies. In previous years, we have also succeeded in producing a sickle cell anemia mouse model. In this model the endogenous mouse α and β globin genes were knocked out and replaced by the human α and βs globin transgenes. The βs globin gene is contained in a 240kb YAC that preserves the entire native genomic context of the β-globin locus. These mice have anemia, reticulocytosis and irreversible sickle cells in the peripheral blood, as well as other pathological features of sickle cell disease. However, their γ globin switches to βs globin expression from around 12 days of gestation. The low level of fetal hemoglobin expression in utero led to intrauterine sickling and fetal death so that very few live-born sickle cell anemia mice could be obtained. To rescue these mice from intrauterine death we investigated the effect of placing the pregnant mothers into a high O2 environment. From the tenth day of gestation onwards, we placed the mothers into a chamber containing 50% O2 and kept the newborn pups in it for another 10 days after birth. The frequency of sickle cell anemia mice we obtained was increased from 0.2% to 32%. Moreover, 55% to 88% of the newborn sickle cell anemia mice survived in the oxygen treated group, whereas none of the sickle cell anemia mice survived in regular air breeding conditions. The survived sickle cell anemia mice develop congestion, atrophy, and infarcts in multiple organs by histological analysis. These pathological finding are very similar to those find in patients with sickle cell disease. We conclude that a high oxygen environment can be used to obtain more sickle cell anemia mice in those models that have a high perinatal mortality. The higher yield of these mice will facilitate physiological and therapeutic studies of sickle cell anemia.

Blocking Adhesion of Sickle Erythrocytes to Endothelial αVβ3 Using RNA Aptamer.

Vaso-occlusive crises are a major clinical feature of sickle cell disease (SCD), and the adhesion of sickle erythrocytes (SS-RBC) to vascular endothelium is crucial to the generation of vaso-occlusion. The αvβ3 integrin is a major endothelial ligand for SS-RBC. Soluble thrombospondin has been thought to serve as a bridging molecule between erythrocyte CD36 and endothelial αvβ3, and high-molecular-weight multimers of von Willebrand factor also promote SS-RBC adhesion to endothelial αvβ3. Our group recently identified SS-RBC adhesion to endothelium via ICAM-4 (LW, CD242)-αvβ3 interactions (Blood , 104, 3774, 2004), suggesting that αvβ3 is a critical target against which to develop reagents to prevent or treat vaso-occlusive crises in SCD. Aptamers are oligonucleotides that bind to molecular targets in a manner conceptually similar to antibodies and have been identified against a wide range of therapeutic targets. RNA aptamers that bind to human integrin αIIbβ3/αvβ3 and inhibit integrin binding to the ligands vitronectin and fibrinogen have previously been identified (Biochem Biophys Res Commun, 338, 956, 2005). We have now tested one of these high-affinity αvβ3 aptamers (clone 17.16: UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC) for its ability to prevent adhesion of SS-RBC to endothelial cells. Aptamer clone 17.16 bound αIIbβ3 with a Kd of 7–10nM, and the binding was blocked by both Abciximab, a monoclonal antibody against human integrin αIIbβ3/αvβ3 via a common binding motif RGD (arginine-glycine-aspardic acid), and Eptifibatide, a small molecule that binds to the RGD moiety, suggesting the sharing of the binding site at the RGD moiety. To measure its anti-adhesion activity, an in vitro flow chamber assay was adopted. We first induced enhanced expression of αvβ3 on the immortalized HUVEC cell line EC-RF24, using each of the following: TNF-α (10ng/mL for 18.5 hrs at 37°C), thrombin (1nM for 5 min at 37°C), or histamine (25mM for 12 min at RT), and αvβ3 expression by treated and nontreated cells was measured by flow cytometry. The anti-adhesion activity of aptamer clone 17.16 was then confirmed using HUVECs treated with thrombin (1nM for 5mins at 37°C) using a flow chamber assay. Aptamer clone 17.16 (30nM) had anti-adhesion activity similar to LM609, an inhibitory antibody to αvβ3, whereas human complement 8 aptamer (Blood , 106, 57a, 2005, negative control, 30nM) did not have anti-adhesion activity. The anti-adhesion activity of aptamer clone 17.16 (30nM) was enhanced by a dose escalation to 60nM and 120nM. At 2 dynes/cm2, maximal inhibition of adhesion was 57%. In conclusion, we observed significant anti-adhesion activity of αvβ3 aptamer clone 17.16, and it has currently reached a stage suitable for modification to enhance stability and bioavailability. In addition, in vivo experiments in mice will employ intravital microscopy to measure anti-adhesion activity in vivo. [Display omitted]

Deconstructing sickle cell disease: Reappraisal of the role of hemolysis in the development of clinical subphenotypes

Hemolysis, long discounted as a critical measure of sickle cell disease severity when compared with sickle vaso-occlusion, may be the proximate cause of some disease complications. New mechanistic information about hemolysis and its effects on nitric oxide (NO) biology and further examination of the subphenotypes of disease requires a reappraisal and deconstruction of the clinical features of sickle cell disease. The biology underlying clinical phenotypes linked to hemolysis may increase our understanding of the pathogenesis of other chronic hemolytic diseases while providing new insights into treating sickle cell disease. The pathophysiological roles of dysregulated NO homeostasis and sickle reticulocyte adherence have linked hemolysis and hemolytic rate to sickle vasculopathy. Nitric oxide binds soluble guanylate cyclase which converts GTP to cGMP, relaxing vascular smooth muscle and causing vasodilatation. When plasma hemoglobin liberated from intravascularly hemolyzed sickle erythrocytes consumes NO, the normal balance of vasoconstriction:vasodilation is skewed toward vasoconstriction. Pulmonary hypertension, priapism, leg ulceration and stroke, all subphenotypes of sickle cell disease, can be linked to the intensity of hemolysis. Hemolysis plays less of a role in the vaso-occlusive-viscosity complications of disease like the acute painful episode, osteonecrosis of bone and the acute chest syndrome. Agents that decrease hemolysis or restore NO bioavailability or responsiveness may have potential to reduce the incidence and severity of the hemolytic subphenotypes of sickle cell disease. Some of these drugs are now being studied in clinical trials.

Virus de l'immunodéficience humaine et virus des hépatites virales C et B chez les patients drépanocytaires au CHU Campus de Lomé (Togo)

Context. – The clinical features of sickle cell disease (SCD) are vaso-occlusive and/or hemolytic crises which treatment may require blood transfusions. Objective. – This study aimed to determine the prevalence of HIV, Hepatitis C Virus (HCV) and Hepatitis B Virus (HBV) infections in a population of SCD patients. Methods. – All the samples were analyzed by Elisa technique. We studied 119 sera for HIV using Elisa and a confirmation test in case of positive Elisa. We screened 91 sera for HCV and 119 sera for HBV. Results. – The prevalence was 5.04% for HIV, 6.5% for HCV and 20.2% for HBs Ag. Homozygous (SS) patients were more infected than compound heterozygous patients SC, (p < 0.02). 24.6% of the children (0 to 15 years of age) were infected as well as adults (35.5%). The Relative Risk to be contaminated was 7.14 for HIV, 4.29 for HCV and 5.43 for HBV in transfused compared to non transfused SCD patients. Conclusions. – This high infectious risk in SCD patients should lead us to elaborate a better strategy to increase the safety of blood transfusion in Togo.

Phenotype/genotype relationships in sickle cell disease: a pilot twin study

The roles of genetic and non-genetic factors in the haematology, growth and clinical features of sickle cell disease have been studied in nine identical twin pairs (six homozygous sickle cell disease, three sickle cell-haemoglobin C disease). A comparison group of 350 age-gender matched sibling pairs, selected to have an age difference of <5 years, was used for assessing the concordance of numerical data. Attained height, weight at attained height, fetal haemoglobin, total haemoglobin, mean cell volume, mean cell haemoglobin and total bilirubin levels showed significantly greater correlation in identical twins than in siblings. Twins showed similarities in the prevalence and degree of splenomegaly, susceptibility to priapism, and in onset of menarche, but other clinical complications were discordant in prevalence and severity. These findings suggest that physical growth and many haematological characteristics are subject to genetic influences, but that non-genetic factors contribute to the variance in disease manifestations.

Evidence for ineffective erythropoiesis in severe sickle cell disease

AbstractPeripheral destruction of sickled erythrocytes is a cardinal feature of sickle cell disease (SCD). Less well established is the potential contribution of ineffective erythropoiesis to the pathophysiology of this hemoglobinopathy. Since patients with SCD frequently develop mixed hematopoietic chimerism after allogeneic nonmyeloablative stem cell transplantation, we used this opportunity to directly compare the differentiation and survival of SCD and donor-derived erythropoiesis in vivo. Donor and recipient erythropoiesis was compared in 4 patients with SCD and 4 without SCD who developed stable mixed hematopoietic chimerism following transplant. Molecular analysis of chimerism in peripheral blood and bone marrow demonstrated higher expression of donor-derived β-globin RNA relative to the level of donor-derived genomic DNA in patients with SCD. Analysis of chimerism in immature (glycophorin A–positive [GYPA+], CD71hi) and mature (GYPA+, CD71neg) erythroblasts confirmed the intramedullary loss of SS erythroblasts with progressive maturation. In patients with SCD, relative enrichment of donor erythroid precursors began to appear at the onset of hemoglobinization. Ineffective erythropoiesis of homozygous hemoglobin S (SS) progenitors thus provides a maturation advantage for homozygous hemoglobin A (AA) or heterozygous hemoglobin S/hemoglobin A (SA) donor erythroid precursor cells that results in greater donor contribution to overall erythropoiesis following stem-cell transplantation and improvement of clinical disease.

Hearing loss and auditory function in sickle cell disease

Sickle cell disease was first reported in 1910 by J. Herrick, and since then, various associated conditions and complications have been described. Sickle cell disease is a hereditary disorder characterized by abnormality of the hemoglobin in the red blood cell. During periods of decreased oxygen tension in the red blood cell's environment, the abnormal hemoglobin within the red blood cell polymerizes and causes it to assume its sickled shaped. This morphological change and its associated physiological changes drastically reduce the ability of red blood cells to navigate and deliver oxygen throughout the body. Sickle cell disease is a significant health problem affecting 1 in 400 African-Americans in the United States. One in 10 African-Americans in the United States has sickle cell trait. A variety of hemoglobinapathies are classified as sickle cell disease. Variants that simultaneously occur with hemoglobin S in high frequency are hemoglobins C and β Thalassemia, and less frequently hemoglobin E. Sickle cell disease is characterized by chronic hemolytic anemia, end-organ damage, a heightened susceptibility to infections, and intermittent episodes of vascular occlusion causing both acute and chronic pain. Neurological symptoms are frequent in patients diagnosed with sickle cell disease. Considering the vaso-occlusive nature of sickle cell disease, the potential for auditory damage is not unexpected. However, the incidence of subjective hearing impairment among sickle cell anemia subjects is very low; therefore, the interest in hearing loss associated with the disease is not in its symptomatology, but in its pathogenesis. The relationship between sickle cell anemia and hearing loss is documented, but little is known about the relationship. Numerous investigations have assessed peripheral auditory sensitivity with a wide disparity of results. In the article, we will discuss: • The genetic characteristics and the pathophysiology of sickle cell disease; • The prevalence and predominate site of hearing loss and/or auditory dysfunction during sickle cell crisis and with the disease under control (non-crisis); • A model for appropriate audiological assessment and treatment of sickle cell disease patients, including published results of investigations utilizing this model. In view of the diversity of results and speculative etiology presented here and in the literature, the relationship between sickle cell anemia, auditory sensitivity, and auditory function warrants additional investigation. Learning outcomes: As a result of this activity, the participant will read descriptions of the genetic and pathophysiological characteristics of sickle cell disease. The participant will examine evidence of the prevalence of hearing loss and auditory dysfunction in the sickle cell population, as well as the overall hearing health risk for sickle cell patients in comparison to the risk for the normal hemoglobin population. The participant will examine a model for appropriate audiological assessment of treatment of patients with sickle cell disease.