Fat Body Extracts Research Articles

Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana.

Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.

The prostanoids, thromboxanes, mediate hemocytic immunity to bacterial infection in the lepidopteran Spodoptera exigua

We report on a new insect prostanoid in a lepidopteran insect, Spodoptera exigua. Thromboxane B2 (TXB2) was detected by LC-MS/MS in extracts of larval epidermis, midgut, fat body and hemocytes, with highest amounts in hemocytes (about 300 ng/g tissue with substantial variation). Thromboxane A2 (TXA2) is an unstable intermediate that is non-enzymatically hydrolyzed into the stable TXB2. In S. exigua, both thromboxanes mediate at least two cellular immune responses to bacterial infection, hemocyte-spreading behavior and nodule formation. At the molecular level, a TXA2 synthase (SeTXAS) was identified from a group of 139 S. exigua cytochrome P450 monooxygenases. SeTXAS was highly similar to mammalian TXAS genes and is expressed in all developmental stages and four tested larval tissues. Immune challenge significantly enhanced SeTXAS expression, especially in hemocytes. RNA interference (RNAi) injections using gene-specific double stranded RNA led to reduced SeTXAS expression and suppressed the cellular immune responses, which were rescued following TXA2 or TXB2 injections. Unlike other PGs, TXA2 or TXB2 did not influence oocyte development in adult females. We infer that thromboxanes are present in insect tissues, where they mediate innate immune responses.

Characterising four Sarconesiopsis magellanica (Diptera: Calliphoridae) larval fat body-derived antimicrobial peptides.

BACKGROUND The inappropriate use of antibiotics has led to the accelerated growth of resistance to antibiotics. The search for new therapeutic strategies (i.e., antimicrobial peptides-AMPs) has thus become a pressing need.OBJECTIVE Characterising and evaluating Sarconesiopsis magellanica larval fat body-derived AMPs.METHODS Fat body extracts were analysed by reversed-phase high-performance liquid chromatography (RP-HPLC); mass spectrometry was used for characterising the primary structure of the AMPs so found. ProtParam (Expasy) was used for analysing the AMPs’ physico-chemical properties. Synthetic AMPs’ antibacterial activity was evaluated.FINDINGS Four new AMPs were obtained and called sarconesin III, IV, V and VI. Sarconesin III had an α-helix structure and sarconesins IV, V and VI had linear formations. Oligomer prediction highlighted peptide-peptide interactions, suggesting that sarconesins III, V and VI could form self-aggregations when in contact with the microbial membrane. AMPs synthesised from their native molecules’ sequences had potent activity against Gram-positive bacteria and, to a lesser extent, against Gram-negative and drug-resistant bacteria. Sarconesin VI was the most efficient AMP. None of the four synthetic AMPs had a cytotoxic effect.MAIN CONCLUSIONS S. magellanica larval fat body-derived antimicrobial peptides are an important source of AMPs and could be used in different antimicrobial therapies and overcoming bacterial resistance.

Effects of the entomopathogenic fungus Metarhizium flavoviride on the fat body lipid composition of Zophobas morio larvae (Coleoptera: Tenebrionidae).

Insects employ different defense strategies against fungal infections and chemicals. We aimed to identify the lipid compositions of the fat body of Zophobas morio larvae before and after fungal infection with the entomopathogenic fungus Metarhizium flavoviride. We used gas chromatography-mass spectrometry to analyze lipid extracts of the fat body isolated of Z. morio 2, 5, and 7days after fungal infection (treatment group) and compared it with the lipid extracts in a control group injected with physiological isotonic saline. In all the samples, fatty acids were the most abundant compound found in the fat body extracts, with hexadecanoic acid/C16:0 being the most abundant lipid. However, the types and concentrations of lipids changed after fungal infection, likely as an immune response. The most considerable changes occurred in the concentrations of long-chain fatty acids, i.e., hexadecanoic acid/C16:0, octadecenoic acid/C18:1, and octadecanoic acid/C18:0. Contents of methyl ester increased significantly after infection, but that of other esters, especially octanoic acid decyl ester/OADE, decreased on the 5th day after infection. To the best of our knowledge, this is the first detailed analysis of the changes in the lipid composition of the fat body of Z. morio larvae as a result of fungal infection. Our results suggest that entomopathogenic fungal infection affects the internal lipid composition of insects, potentially as a way of adjusting to such infection. These results can help understand infection processes and defense strategies of insects against fungal infection. Ultimately, they can contribute to the creation of more effective chemicals against pest insects.

Morphological and functional characterization of isolated stem cells from the midgut of Chilo suppressalis larvae

Abstract The proliferation and differentiation of stem cell populations allow the midgut to grow/regenerate in lepidopteran insect. Basic epithelial regenerative functions can be assessed in vitro by purifying these stem and mature cell populations. Therefore, we isolated and purified stem and mature cells from the midgut of C. suppressalis larvae by density gradient centrifugation and observed the morphologies of these cells. A flow cytometry method was used to monitor C. suppressalis stem cell proliferation and differentiation under different cell culture conditions. We observed high proportions of the stem and differentiating cells in third- and fourth-instar larvae, respectively, indicating that, in larvae, stem cells rapidly proliferate early in development and are strongly differentiated at late stages. Incubation in medium supplemented with fat body extract and ecdysone resulted in a significantly increased proportion of stem cells, not of the differentiating cells, indicating that co-culture with fat body extract and ecdysone stimulates the proliferation of C. suppressalis stem cells. Viability bioassays showed that Cry1Ab displayed significant cytotoxic effects on the midgut cell culture of C. suppressalis. The proportion of differentiating cells was significantly increased after a 48-h exposure to sublethal doses of Cry1Ab toxin, and peaked at the Cry1Ab concentration of 0.3 μg/ml, demonstrating that epithelial cells with strong regenerative capacity via the differentiation of stem cells. These results improve our understanding of C. suppressalis stem cell biology and illustrate the potential role of the enhanced midgut regeneration induced by stem cell proliferation or differentiation as a reparation mechanism to Bt toxin.

An Evaluation of 1-Deoxynojirimycin Oral Administration in Eri Silkworm through Fat Body Metabolomics Based on (1) H Nuclear Magnetic Resonance.

1-Deoxynojirimycin (DNJ), the main hypoglycemic constituent in mulberry (Morus alba) latex, has been extensively researched. Although there is considerable interest in the biological effects of DNJ, the roles of 1-deoxynojirimycin (DNJ) in glycometabolism and energy metabolism in insects have received little attention. In this paper, 1H nuclear magnetic resonance (1H NMR) based metabonomic was performed to study the effects of the oral supplementation of 0.25% DNJ, 0.5% DNJ, latex, and the mixture of 0.5% DNJ and latex (1 : 1) on the fat body glycometabolism and energy metabolism of the fourth-instar larvae of Eri silkworms, Samia cynthia ricini. Metabolic pattern recognition analysis (partial least square-discriminant analysis, PLS-DA) of fat body extracts indicated that the groups of 0.25% DNJ, 0.5% DNJ, latex, and the mixture of 0.5% DNJ and latex (1 : 1) were significantly different from the control group. Further, compared to the control group, the metabolites levels of lactate, trehalose, succinate, malate, and fumarate were remarkably changed in experimental groups, which were involved in glycolysis, hydrolysis of trehalose, and tricarboxylic acid (TCA) cycle. Our results indicate that DNJ has a positive impact on the reverse energy metabolism of Eri silkworms and metabonomic analysis based on NMR can be used as a tool to identify potential biomarkers.

Evaluating the effect of Sarconesiopsis magellanica (Diptera: Calliphoridae) larvae-derived haemolymph and fat body extracts on chronic wounds in diabetic rabbits.

We evaluated extracts taken from S. magellanica third instar larvae fat body and haemolymph using a diabetic rabbit model and compared this to the effect obtained with the same substances taken from Lucilia sericata larvae. Alloxan (a toxic glucose analogue) was used to induce experimental diabetes in twelve rabbits. Dorsal wounds were made in each animal and they were infected with Staphylococcus aureus and Pseudomonas aeruginosa. They were then treated with haemolymph and lyophilized extracts taken from the selected blowflies' larvae fat bodies. Each wound was then evaluated by using rating scales and histological analysis. More favourable scores were recorded on the PUSH and WBS scales for the wounds treated with fat body derived from the larvae of both species compared to that obtained with haemolymph; however, wounds treated with the substances taken from S. magellanica had better evolution. Histological analysis revealed that treatment led to tissue proliferation and more effective neovascularisation in less time with both species' fat body extracts compared to treatment with just haemolymph. The results suggest the effectiveness of the substances evaluated and validate them in the animal model being used here as topical agents in treating chronic wounds.

Overexpression and functional characterization of an Aspergillus niger phytase in the fat body of transgenic silkworm, Bombyx mori

In a previous study, we isolated 1,119 bp of upstream promoter sequence from Bmlp3, a gene encoding a member of the silkworm 30 K storage protein family, and demonstrated that it was sufficient to direct fat body-specific expression of a reporter gene in a transgenic silkworm, thus highlighting the potential use of this promoter for both functional genomics research and biotechnology applications. To test whether the Bmlp3 promoter can be used to produce recombinant proteins in the fat body of silkworm pupae, we generated a transgenic line of Bombyx mori which harbors a codon-optimized Aspergillus niger phytase gene (phyA) under the control of the Bmlp3 promoter. Here we show that the Bmlp3 promoter drives high levels of phyA expression in the fat body, and that the recombinant phyA protein is highly active (99.05 and 54.80 U/g in fat body extracts and fresh pupa, respectively). We also show that the recombinant phyA has two optimum pH ranges (1.5-2.0 and 5.5-6.0), and two optimum temperatures (55 and 37 °C). The activity of recombinant phyA was lost after high-temperature drying, but treating with boiling water was less harmful, its residual activity was approximately 84% of the level observed in untreated samples. These results offer an opportunity not only for better utilization of large amounts of silkworm pupae generated during silk production, but also provide a novel method for mass production of low-cost recombinant phytase using transgenic silkworms.

The potential role of adiponectin- and resistin-like peptides in the regulation of lipid levels in the hemolymph of over-wintering adult females of Osmia bicornis

The presence and potential role of adiponectin- and resistin-like peptides in mobilizing free lipids of hemolymph during over-wintering was studied in females of the European solitary red mason bee Osmia bicornis L. (Hymenoptera: Megachilidae). The levels of both peptides (as demonstrated both by RIA/ELISA and Western blots) were highest in fat body tissue homogenates during early pre-wintering (September) followed by a gradual and significant decline during wintering and post-wintering months (November–March). There was a gradual reduction of the lipid levels in hemolymph and adiponectin-like and resistin-like peptide content in fat body. Thus, the total lipid content in hemolymph and the adiponectin-like and resistin-like peptides in fat body homogenates was positively correlated. Our experiments also demonstrated that injections of various concentrations of fat body extracts as well as various doses of adiponectin and resistin increased the lipid levels in hemolymph in O. bicornis females at the three different periods of over-wintering time. In particular, injections of fat body extract and adiponectin resulted in the strongest mobilization of lipids especially in the first two periods of over-wintering: pre-wintering and wintering. Resistin also elicited an increase of lipid levels in hemolymph, but its effectiveness was lower compared to fat body extract and adiponectin. Taken together, our results strongly suggest the presence of adiponectin-like and resistin-like peptides in the fat body of O. bicornis and postulate a dynamic physiological role for these peptides during the process of over-wintering.

Lucifensin II, a Defensin of Medicinal Maggots of the BlowflyLucilia cuprina(Diptera: Calliphoridae)

A novel homolog of insect defensin, designated lucifensin II (Lucilia cuprina Wiedemann [Diptera: Calliphoridae] defensin), was purified from hemolymph extract from larvae of the blowfly L. cuprina. The full-length primary sequence of this peptide of 40 amino acid residues and three intramolecular disulfide bridges was determined by electrospray ionization-orbitrap mass spectrometry and Edman degradation and is almost identical to the previously identified sequence of lucifensin (Lucilia sericata Meigen defensin). Lucifensin II sequence differs from that of lucifensin by only one amino acid residue, that is, by isoleucine instead of valine at position 11. The presence of lucifensin II also was detected in the extracts of other larval tissues, such as gut, salivary glands, fat body, and whole body extract.

Rapid cold-hardening blocks cold-induced apoptosis by inhibiting the activation of pro-caspases in the flesh fly Sarcophaga crassipalpis

Apoptosis plays important roles in the selective elimination of sub-lethally damaged cells due to various environmental stresses. The rapid cold-hardening (RCH) response protects insects from the otherwise lethal consequences of injury due to cold-shock. We recently demonstrated that cold shock induces apoptotic cell death in insects and that RCH functions to specifically block cold-shock-induced apoptosis. In the present study we used isolated fat body, midgut, muscle, and Malpighian tubules from adult flesh flies Sarcophaga crassipalpis to test the following hypotheses: (1) cold-induced apoptosis varies among different tissues and (2) RCH blocks the apoptotic pathway by preventing the activation of pro-caspases. Cold-shock induced substantial amounts of apoptotic cell death that matched with tissue damage as determined using vital dyes. RCH treatment significantly reduced apoptotic cell death in all tested tissues. Caspase-3 (executioner) activity was 2-3 times higher in the cold- and heat-shocked groups than in control and RCH groups. Likewise, the activity of caspase-9 (initiator) showed a similar trend as for caspase-3 in all tissues but midgut. In addition, cold-shock and heat-shock treatments also increased caspase-2 activity 2-3 folds in both soluble and membrane fractions of fat body and muscle extracts compared to controls.

Vitellogenesis in the hematophagous Dipetalogaster maxima (Hemiptera: Reduviidae), a vector of Chagas’ disease

Oocyte extracts of anautogenous Dipetalogaster maxima were chromatographed on an ion-exchange column in order to purify vitellin (Vt), the main insect yolk protein precursor. Purified Vt (Mr ∼443kDa) was composed of four subunits with approximate molecular weights of 174, 170, 50, and 44kDa. Polyclonal anti-Vt antibody, which cross-reacted equally with fat body extracts and hemolymph vitellogenin (Vg), was used to measure the kinetics of Vg expression in the fat body and the levels in hemolymph. In addition, morphological and immunohistochemical changes that took place in the ovary during vitellogenesis were analyzed. The study was performed between 2 and 8 days post-ecdysis and between 2 and 25 days post-blood feeding. During the post-ecdysis period, D. maxima showed decreased synthesis of Vg and concomitantly, low levels of Vg in hemolymph (4.5×10−3μg/μl at day 4). After a blood meal, Vg synthesis in the fat body and its levels in hemolymph increased significantly, reaching an average of 19.5μg/μl at day 20. The biochemical changes observed in the fat body and hemolymph were consistent with the histological and immunohistochemical finds. These studies showed noticeable remodeling of tissue after blood feeding.

Allosteric regulation of 6-phosphofructo-1-kinase activity of fat body and flight muscle from the bloodsucking bug Rhodnius prolixus

6-Phosphofructo-1-kinase (phosphofructokinase; PFK) activity from Rhodnius prolixus, a haematophagous insect which is usually a poor flyer, was measured and compared in two metabolically active tissues - flight muscle and fat body. The activity of this important regulatory glycolytic enzyme was much more pronounced in muscle (15.1 +/- 1.4 U/mg) than in fat body extracts (3.6+/-0.4 U/mg), although the latter presented higher levels of enzyme per protein content, as measured by western-blotting. Muscle extracts are more responsible than fat body to ATP and fructose 6-phosphate, both substrates of PFK. Allosteric regulation exerted by different effectors such as ADP, AMP and fructose 2,6-phosphate presented a singular pattern for each tissue. Optimal pH (8.0-8.5) and sensitivity to pH variation was very similar, and citrate was unable to inhibit PFK activity in both extracts. Our results suggest the existence of a particular PFK activity for each tissue, with regulatory patterns that are consistent with their physiological roles.

Growth and mitogenic effects of arylphorin in vivo and in vitro

In insects, developmental responses are organ- and tissue-specific. In previous studies of insect midgut cells in primary tissue cultures, growth-promoting and differentiation factors were identified from the growth media, hemolymph, and fat body. Recently, it was determined that the mitogenic effect of a Manduca sexta fat body extract on midgut stem cells of Heliothis virescens was due to the presence of monomeric alpha-arylphorin. Here we report that in primary midgut cell cultures, this same arylphorin stimulates stem cell proliferation in the lepidopterans M. sexta and Spodoptera littoralis, and in the beetle Leptinotarsa decemlineata. Studies using S. littoralis cells confirm that the mitogenic effect is due to free alpha-arylphorin subunits. In addition, feeding artificial diets containing arylphorin increased the growth rates of several insect species. When tested against continuous cell lines, including some with midgut and fat body origins, arylphorin had no effect; however, a cell line derived from Lymantria dispar fat body grew more rapidly in medium containing a chymotryptic digest of arylphorin.

Midgut Cell Culture from Larvae of <I>Dendroctonus valens</I> (Coleoptera: Scolytidae)

Isolated cellular nidi stem cells from the anterior and posterior midgut of larvae of the red turpentine beetle, Dendroctonus valens LeConte, proliferate and differentiate in vitro when cultured in RPMI 1640 medium, in the presence of 20-hydroxyecdysone, fat body extract from Zophobas morio (Blanchard) (Coleoptera: Tenebrionidae) pupae, and conditioned medium. Our data suggest that the stem cells did not increase exponentially as in typical cultures. However, the early presence of stem cells in larval cultures indicates that the proliferation process is higher than in cultures from adult D. valens. After 2 wk in culture, up to 10% of cells were observed in various stages of differentiation. The mean duration of midgut cultures was 82 d.

BOMBYXIN STIMULATES PROLIFERATION OF CULTURED STEM CELLS DERIVED FROM HELIOTHIS VIRESCENS AND MAMESTRA BRASSICAE LARVAE1

Bombyxin stimulated proliferation of cultured midgut stem cells that were derived from two noctuiid moth larvae, Heliothis virescens and Mamestra brassicae. Bombyxin exhibited the highest activity at 10(-12) M. The number of cells increased for 3 d after the addition of bombyxin. Although a single addition of bombyxin did not maintain proliferation, a second addition, made 3 d after the first treatment, retained the effect. Results suggest that the decline of effect after the first addition was not due to the loss of sensitivity of the cultured cells but to the loss of effect of the growth factor added. Addition of bombyxin at more than 10(-10) M was less effective. Bombyxin did not affect the number of cultured midgut cells without pupal fat body extract (FBX). The data suggest that FBX contains the factors that maintain sensitivity of midgut cells to proliferate in the presence of bombyxin. Bombyxin must be a unique growth factor that stimulates proliferation of midgut stem cells in vitro from lepidopteran larvae.

Protein content and electrophoretic profile of fat body and ovary extracts from workers of Melipona quadrifasciata anthidioides (Hymenoptera, Meliponini)

Workers of Melipona quadrifasciata anthidioides (Lepeletier, 1836) develop their ovaries and lay eggs, therefore the production of vitellogenin is expected. In electrophoretic profiles only fat body extracts from nurse workers and ovary extracts from newly-emerged workers show protein with molecular mass similar to vitellogenin. However, an increase in the protein content was detected in forager fat body. This increase was attributed to storage of vitellogenin or other proteins in the previous phase and not discharged into the hemolymph or to an effect of the increased titre of juvenile hormone in this phase of worker life over the fat body functioning.

Stimulation of midgut stem cell proliferation by Manduca sexta alpha-arylphorin.

Extracts of the green-colored perivisceral fat body of newly ecdysed Manduca sexta pupae stimulate mitosis in midgut stem cells of Heliothis virescens cultured in vitro. Using a combination of cation- and anion-exchange chromatography, we have isolated a protein from these fat body extracts that accounts for the observed stem cell proliferation. SDS-PAGE analysis of the protein results in a single band of 77 kDa. Sequences of tryptic peptides from this protein are identical to internal sequences of the storage hexamer alpha-arylphorin. The alpha-arylphorin isolated by our procedure represents a small fraction of the total arylphorin present in the fat body extract. However, it alone seems responsible for the stimulation of mitotic activity in H. virescens midgut stem cells.

Suppression of the prophenoloxidase system in Rhodnius prolixus orally infected with Trypanosoma rangeli

Investigations were carried out to compare aspects of the prophenoloxidase (proPO)-activating pathway in Rhodnius prolixus hemolymph in response to oral infection and inoculation of the insects with two developmental forms of Trypanosoma rangeli epimastigotes strain H14. In vivo experiments demonstrated that in control insects fed on uninfected blood, inoculation challenge with short epimastigotes resulted in high phenoloxidase (PO) activity. In contrast, previous feeding on blood containing either short or long epimastigotes was able to suppress the proPO activation induced by thoracic inoculation of the short forms. In vitro assays in the presence of short epimastigotes demonstrated that control hemolymph or hemolymph provided by insects previously fed on blood containing epimastigotes incubated with fat body homogenates from control insects significantly increased the PO activity. However, fat body homogenates from insects previously fed on blood containing epimastigotes, incubated with hemolymph taken from insects fed on control blood or blood infected with epimastigotes, drastically reduced the proPO activation. The proteolytic activity in the fat body homogenates of control insects was significantly higher than in those obtained from fat body extracts of insects previously fed on blood containing epimastigotes. These findings indicate that the reduction of the proteolytic activities in the fat body from insects fed on infected blood no longer allows a significant response of the proPO system against parasite challenge. It also provides a better understanding of T. rangeli infection in the vector and offer novel insights into basic immune processes in their invertebrate hosts.

Effects of a fat body extract on larval midgut cells and growth of lepidoptera.

Treatment with fat body extract (FBX) from pupae of the tobacco hornworm, Manduca sexta, caused mortality in larvae of two pest lepidopterans, the gypsy moth, Lymantria dispar, and the cotton leafworm, Spodoptera littoralis. In FBX-treated larvae, the feeding rate was depressed, causing reduced weight gain and then larval death. Their midgut showed formation of multicellular layers of midgut epidermis, indicating stem-cell hyperplasia. Hence, the integument of FBX-treated larvae had a double cuticle, indicating induction of premature molting. But radioimmunoassay measurements confirmed that the amount of ecdysteroids in FBX was too low to be responsible for the molt-inducing effects observed after treatment with FBX. With midgut stem cell cultures in vitro, addition of FBX to the culture medium stimulated cell proliferation and differentiation in a concentration-dependent manner. This effect was compared with those of insect molting hormones, ecdysone and 20-hydroxyecdysone; an ecdysteroid agonist, RH-2485; and a purified protein from FBX (multiplication factor). This article describes the mode of action of FBX and possible interplay between fat body factor(s) and insect hormones in the development and metamorphosis of the insect midgut.