Glucose Tolerance Fasting Research Articles

The Role of Lifestyle in the Prevention and Treatment of Insulin Resistance: A Review of Clinical and Intervention Studies

Introduction Insulin resistance (IR) is a metabolic disorder characterized by reduced tissue sensitivity to insulin, resulting in impaired glucose homeostasis. IR plays a pivotal role in the development of type 2 diabetes, metabolic syndrome, and associated cardiovascular complications. Effective strategies for the prevention and treatment of IR focus on lifestyle modification, including physical activity and stress management. Aim of the Study The aim of this study is to evaluate the role of lifestyle factors in the prevention and treatment of insulin resistance (IR) based on the analysis of clinical and interventional studies, with a particular focus on dietary interventions, physical activity programs, stress reduction techniques, and sleep quality improvement recommendations. Materials and Methods A review of clinical and interventional studies was conducted using databases such as PubMed. The analysis included studies evaluating the impact of specific lifestyle interventions on markers of insulin resistance (IR), such as fasting insulin levels, HOMA-IR indices and glucose tolerance. Particular attention was paid to randomized controlled trials (RCTs) and meta-analyses published between 2020 and 2024. Summary Studies have shown that diets such as the Mediterranean and DASH, combined with regular aerobic and resistance exercises, significantly improve insulin sensitivity. Additionally, stress-reduction techniques like mindfulness and yoga, along with adequate sleep quality, enhance positive metabolic effects. These findings highlight the need for a multifaceted approach to treating insulin resistance, incorporating dietary and behavioral changes. The review also points out research gaps and emphasizes the necessity of long-term studies to refine lifestyle recommendations for diverse populations

Access to high-fat diet results in increased sensitivity to the psychostimulant effects of MDPV in mice.

The current study investigated the effects of high-fat diet on acute response to 3,4-methylenedioxypyrovalerone (MDPV) in mice. MDPV is a beta-cathinone derivative endowed with psychostimulant activity. Similarly to recreational substances, consumption of palatable food stimulates the mesolimbic dopaminergic system, resulting in neuroadaptive changes. Adolescent C57BL/6N mice were fed either control diet (CD), 10% of kcal from fat, or high-fat diet (HFD), 60% of kcal from fat. After eight weeks, one group of HFD-fed mice had their diet changed to CD for an additional two weeks. Fasting glucose levels and glucose tolerance were measured to detect impairment in glucose metabolism. Subsequently, the mice were treated with either MDPV (1mg/kg) or saline, and their locomotor activity was measured. Using reverse transcriptase quantitative polymerase chain reaction (RT-qPCR), the expression of dopamine receptor D1 (Drd1), dopamine receptor D2 (Drd2), and FBJ osteosarcoma oncogene B (FosB) genes was measured in the striatum of mice. Feeding with HFD caused obesity and glucose intolerance in mice. Restriction of fat reduced body mass and reversed impairment of glucose metabolism. HFD-fed mice responded to MDPV with higher potency than CD-fed counterparts, with an increased incidence of stereotypies. A change of diet partially reversed this effect. Downregulation of Drd2 was observed in the mice that switched from HFD to CD, whereas treatment with MDPV caused upregulation of FosB only in the CD-fed mice. Current results suggest that obesity may increase sensitivity to psychostimulant effects of MDPV and elevate the risk of addiction as mice fed with HFD responded to acute treatment with MDPV with higher potency and showed tolerance of FosB induction in response to the drug.

Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood

To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.

Fecal microbiota transplantation as a potential therapeutic approach to improve impaired glucose tolerance via gut microbiota modulation in rat model.

To investigate the impact of diet-induced gut microbiota alterations on type 2 diabetes and assess the therapeutic potential of Fecal Microbiota Transplantation (FMT) in restoring a balanced gut microenvironment. To induce type 2 diabetes, rats were fed a high-sugar high-fat diet (HSFD) for 90 days. After diabetes induction, animals were divided into an HSFD control group, a metformin group (100mg/kg), and an FMT group (100mg/kg), receiving treatment for an additional 90 days. Fasting blood glucose levels, glucose tolerance, serum markers (HbA1C, free fatty acids, lipopolysaccharides, pro-inflammatory and anti-inflammatory cytokines), and gut microbiota profiles via cecal metagenome sequencing were analyzed post-treatment. FMT effectively restored gut microbiota composition to a profile similar to healthy controls, rebalancing the Firmicutes/Bacteroidetes ratio and increasing beneficial taxa, including Prevotella ruminicola, Akkermansia muciniphila, Roseburia, and Faecalibacterium prausnitzii. These microbial shifts corresponded with significant metabolic improvements: FMT reduced inflammatory markers (LPS and FFA), lowered HbA1c, and improved glucose tolerance. Enhanced gut barrier integrity observed in FMT-treated animals likely contributed to reduced endotoxemia and systemic inflammation, distinguishing FMT's metabolic effects from those of metformin. Notably, FMT addressed the dysbiosis associated with HSFD, promoting microbial resilience and mitigating the metabolic disruptions linked to type 2 diabetes. These findings underscore the potential of FMT as a targeted therapeutic approach to modulate gut microbiota composition and mitigate metabolic dysregulation induced by high sugar high fat diet.

Nutraceuticals and Supplements in Management of Prediabetes and Diabetes.

Dysglycemia is a condition preceding diabetes mellitus. The two situations inherent in this condition are called impaired fasting glucose (IFG) and impaired glucose tolerance (IGT). If one of these situations is found in the patient, after the advice of an appropriate diet and physical activity, the addition of nutraceuticals or supplements can be considered, which can stop or delay the progression to diabetes mellitus over time. The purpose was to compile a systematic review about the use of nutraceuticals for treating diabetes and prediabetes and to offer a valuable resource for colleagues working on this crucial subject, thereby improving patient health. The added value of the paper compared to other reviews is that it was written by experts appointed by five different scientific societies dealing with diabetes, nutrition, and complications.

Unlocking Therapeutic Potential: Camphorquinone's Role in Alleviating Non-Alcoholic Fatty Liver Disease via SIRT1/LKB1/AMPK Pathway Activation.

Non-alcoholic fatty liver disease (NAFLD) is a pathological condition that increase the risk of simple steatosis to hepatocellular carcinoma. This study aimed to investigate the biological effects of camphorquinone (CQ) in a high-fat diet (HFD)-fed and low dose streptozotocin (STZ)-induced mouse model, widely used to mimic the concurrent development of NAFLD pathological conditions in vivo, and a free fatty acid-induced hepatic steatosis cell model in vitro. CQ (10 or 30 mg/kg/day; i.p.) was injected for three weeks, and fasting blood glucose levels, glucose tolerance, and liver lipid metabolism were assessed. CQ administration alleviated the increase in body and liver weights and improved glucose tolerance in NAFLD mice model. CQ also reduced the gene expression levels of lipid biosynthesis and inflammation markers, while increasing the levels of fatty acid oxidation markers in liver tissues and HepG2 cells. These beneficial effects of CQ were mediated via activation of the sirtuin 1 (SIRT1)/adenosine monophosphate-activated protein kinase (AMPK) signalling pathway in vitro and in vivo. Collectively, our data suggest that CQ improves liver lipid metabolism and reduces blood glucose levels via activation of the SIRT1/serine/threonine kinase 11 (STK11/LKB1)/AMPK axis.

Cost-effectiveness of prevention program for type 2 diabetes mellitus in high risk patients in the Republic of Srpska, Bosnia and Herzegovina.

The Republic of Srpska (RS), as a part of the Western Balkans (WB) region, has a higher diabetes prevalence than the EU. This study aims to assess the cost-effectiveness of early treatment of high-risk patients with pre-diabetes and undiagnosed diabetes in our setting. We designed a Markov chain Monte Carlo (MCMC) model which reflects the current International Diabetes Federation (IDF) three-step plan for the prevention of T2DM in those at increased risk. The model captures the evolution of the disease in FINDRISC high-risk patients from normal glucose tolerance (NGT) to impaired fasting glucose (IFG) or impaired glucose tolerance (IGT) and then to T2DM and its complications. We developed two MCMC models, in order to follow the progression of the disease in high-risk cases, ie, when early treatment is undertaken or when it is not undertaken. The health costs and quality adjusted life years (QALY) were discounted at an annual rate of 3%. The key model parameters were varied in one-way and probabilistic sensitivity analysis. Early treatment resulted in increased life expectancy, postponement of the onset of diabetes and increased QALY for all patients. The discounted incremental cost-effectiveness-ratios (ICER) in NGT, IFG, IGT, and T2DM patients were -289.9, 9724.03, -1478.59 and 4084.67 €. In high-risk IGT patients, ICER was the most favorable, being both a cost saving and QALY gaining, with the consistent results confirmed by the sensitivity analysis. The results recommend the acceptance of a new health policy of identifying IGT patients with the use of FINDRISC questionnaire and plasma glucose measurements; providing them with a lifestyle change program; and implementing intensive diabetes treatment, as their disease progresses. Our results are especially significant for the Western Balkan countries, since this was the first cost-effectiveness study of T2DM prevention in this region.

Double-blind Randomized placebo-controlled Trials on controlling blood glucose level using the extract from <i>Opuntia ficus-indica</i> var. saboten

Objectives: The aim of this study was to evaluate the effects of Opuntia ficus-indica var. saboten extract on blood glucose regulation in both healthy individuals and those with impaired fasting glucose (IFG). Additionally, the study assessed the safety of <i>Opuntia</i> extract regarding liver and kidney function over a 12-week period.Methods: A double-blind, randomized, placebo-controlled clinical trial was conducted with 85 participants, including 47 healthy individuals and 38 individuals with impaired fasting glucose (IFG) or impaired glucose tolerance (IFG). Participants were randomly assigned to receive either Opuntia extract or a placebo for 12 weeks. Blood glucose control was evaluated using fasting blood glucose (FBS), oral glucose tolerance tests (OGTT), HbA1c, insulin, and C-peptide levels. Safety assessments included liver function tests (AST, ALT, <i>γ</i>-GTP, ALP) and kidney function tests (BUN, creatinine). Data were analyzed using independent and paired t-tests, with a significance level of p<0.05.Results: A total of 85 participants were initially enrolled, and after excluding 13 participants due to dropout, consent withdrawal, or protocol violations, the final statistical analysis was conducted with 72 participants. In the IFG group, Opuntia extract significantly reduced fasting blood glucose levels compared to the placebo group (p=0.010). Additionally, Opuntia extract reduced postprandial blood glucose levels at 120 minutes during the OGTT in healthy participants (p=0.047). No significant changes were observed in HbA1c, insulin, or C-peptide levels. Importantly, no adverse effects on liver or kidney function were detected in either group during the 12-week intervention.Conclusions: The administration of <i>Opuntia ficus-indica var. saboten</i> extract for 12 weeks demonstrated significant blood glucose-lowering effects in individuals with impaired glucose tolerance, without causing any liver or kidney toxicity. These findings suggest that <i>Opuntia</i> extract may be a safe and effective natural option for blood glucose regulation, particularly in pre-diabetic individuals. Further large-scale studies are recommended to confirm these results and explore its potential clinical applications.

Trends in Children’s Dietary Inflammatory Index and association with prediabetes in U.S. adolescents

Background and ObjectivesPrediabetes is a high-risk state for diabetes. We aimed to illustrate secular trends in the Children’s Dietary Inflammation Index (C-DII) among U.S. adolescents and assess its association with prediabetes.MethodsAdolescents aged 12–18 years were collected from the National Health and Nutrition Examination Survey, 2001–2018. Prediabetes was defined based on Hemoglobin A1c, fasting glucose, and glucose tolerance levels. Risk was quantified by odds ratio (OR) and 95% confidence interval (CI).ResultsA total of 13,684 adolescents were analyzed, representing a weighted total population of 33,351,181. C-DII scores declined significantly from 2001 to 2012 and increased from 2013 to 2018. The relationship between C-DII and prediabetes was roughly linear. When assigning the low C-DII scores as the reference, adolescents with medium and high C-DII scores were 1.22 (adjusted 95% CI: 1.04–1.44) and 1.25 (0.99–1.60) times more likely to have prediabetes. In subgroup analyses, the risk for prediabetes was significantly enhanced in boys (adjusted OR = 1.26 and 1.45 for medium and high C-DII scores, 95% CI: 1.05–1.51 and 1.09–1.92), and in adolescents living in poor families for medium (1.34 and 1.44, 1.08–1.67 and 1.07–1.95).ConclusionsOur findings indicate a V-shaped secular trend in C-DII scores from 2001 to 2018 in U.S. adolescents, with the nadir in 2011–2012, and the risk for prediabetes was significantly increased by over 20% in adolescents possessing medium or high C-DII scores.

Defects of WFS1-mediated peptide hormones secretion contribute to the manifestations of Wolfram syndrome

AimsThe study aims to investigate whether WFS1 is involved in the regulation of the exportation and secretion of other peptide hormones, as well as to elucidate the precise molecular mechanisms underlying WS caused by pathogenic mutations in the WFS1 gene. Materials and methodsThe plasma proteome from the WS patients (n = 2, male) and WFS1-deficient mice (n = 5, male) were analyzed using liquid-chromatography tandem mass spectrometry (LC-MS/MS), while age- and gender-matched healthy individuals and wildtype (WT) mice serve as controls. WFS1-deficient mice were intraperitoneally injected with IGF1 starting from 4 weeks of age. Body weight was monitored every 2 days, fasting blood glucose and glucose tolerance test were performed on the day 30 and day 40 after injection of IGF1, respectively. BiFC (bimolecular fluorescence complementation) and Co-immunoprecipitation (IP) were used to analyze the interaction between WFS1 and peptide hormones. Confocal microscopy was employed to analyze the colocalization of IGF1 with ER and Golgi. Key findingsPeptide hormones are deficient in both the plasma of WS patients and WFS1-deficient mice. WFS1 binds to and mediates the secretion of these peptide hormones, suggesting that WFS1 serves as a general COPII vesicular receptor for sorting peptide hormones. Interestingly, the WFS1 pathogenic mutations significantly disrupt its interaction with these peptide hormones. Furthermore, intraperitoneal administration of IGF1 partially attenuates high blood glucose levels in WFS1-deficient male mice. SignificanceThis study suggests that WS is characterized by defective peptide hormone secretion and proposes administration of these deficient peptide hormones as a promising treatment regimen for WS.

Evaluation of Antidiabetic Activity of Abutilon crispum on Normal and Streptozotocin-induced Diabetic Albino Wistar Rats

Background Diabetes mellitus is a disorder that affects the majority of individuals in the world. Objectives The objective of the current study is to estimate the antidiabetic effect of methanol extract of Abutilon crispum entire plant, which is broadly cultivated in India’s arid and desert areas. This current investigation aims to estimate the efficacy of methanol extract of A. crispum to prevent streptozotocin-induced diabetes mellitus in Albino Wistar strain rats. Materials and Methods In the current examination, methanol extract of the whole plant of A. crispum with doses of 250 and 500 mg/kg/b.wt (body weight) is administered through the oral route to the streptozotocin-prompted diabetic animals where n = 6. We evaluated the differences in food and water intake, body weight levels, fasting glucose, and oral glucose tolerance test (OGTT). When methanol extract of A. crispum was used to evaluate the OGTT for diabetic animals, levels of glucose were found to be pointedly lower when administered with 500 mg/kg b.wt as this is compared to the control group. A. crispum had specifically declined the levels of glucose elevated in diabetic rats. A. crispum is a vital alternative source for managing blood glucose levels in diabetes mellitus that have increased during the condition and need to be further reduced by oral medications that cause hypoglycemia. Biochemical parameters were estimated as a part of the investigation. Results The results demonstrated that the dried methanol extract of A. crispum (250 mg/kg/bwt and 500 mg/kg/bwt) considerably declined those levels of blood glucose during the treatment period when compared to glibenclamide (10 mg/kg), enhanced the metabolism, improved the health of animals and enhanced the OGTT. Conclusion As a result, we can conclude that the whole plant of A. crispum methanol extract contains antidiabetic effects, as well as, hypoglycemic activities.

Glucose inhibitor tubes in Croatian laboratories: are we doing well?

Reliable and accurate measurement of blood glucose concentration is of crucial importance for making clinical decisions in diagnosis diabetes, gestational diabetes and impaired fasting glucose tolerance. Survey was performed in form of questionnaire. Questionnaire was sent to all Croatian laboratories (N = 204) in electronic form using SurveyMonkey cloud-based software (SurveyMonkey, Inc., San Mateo, USA) as an extra-analytical module of the Croatian EQA (External Quality Assessment) provider Croatian center for external quality assessment (CROQALM) in June 2023. In total 148 (73%) of laboratories responded to the survey. Large proportion of laboratories never use glucose inhibitor tubes for random glucose measurement (more than half) or for glucose function tests (one quarter). Only three laboratories use recommended glycolysis inhibitor citrate. Many other inhibitors are also used, even if some of them are not recommended for plasma glucose measurement. Glucose is almost never (93%) sampled on ice when glucose inhibitor tube is not available. Laboratories in Croatia do not follow the recommended procedures regarding glycolysis inhibitors for glucose determination.

8000 Intestinimonas Butyriciproducens As A New Preventive Therapy For Type 2 Diabetes: a Proof Of Concept Randomized Controlled Trial

Abstract Disclosure: V. Antoniotti: None. M. Caputo: None. E. Mollero: None. A. Antonioli: None. S. Tini: None. M. Manfredi: None. S. Gul: None. N. Bui: None. J. Seegers: None. W. De Vos: None. G. Aimaretti: None. F. Prodam: None. Background. The incidence of type 2 Diabetes Mellitus (T2D) is increasing worldwide. Prevention is possible by changing lifestyle but it’s not effective alone in real life, due to poor compliance over time. New strategies are necessary, mostly for high-risk individuals. Therapeutic microbiology is a further proposed target, and butyrate-producing bacteria can improve metabolic parameters in obese patients. Our study aims to evaluate the effect of Intestinimonas butyriciproducens as a preventive therapy for T2D in prediabetes thanks to its effects in decreasing Advanced Glycation End Products (AGEs), converting sugars and proteins in butyrate, and increasing insulin sensitivity.Methods. The trial is a double-blind, randomized, placebo-controlled (phase 1) and open-label pilot study with two different doses (phase 2) of 26 weeks. I. butyriciproducens (105 CFU/day) or placebo were given for 12 weeks, then subjects in placebo will start the treatment (105 CFU/day), and the other group will increase the dose (108 CFU/day) for 14 weeks. Overweight or obese patients with impaired fasting glucose (IFG) or impaired glucose tolerance (IGT) were included. Patients were assessed for clinical, biochemical, and microbiota parameters at the time of recruitment (V1), after phase 1 (V7) and phase 2 (V10), during which the eating and lifestyle habits were also evaluated. No dietary advice was given. Results. Nineteen have completed the study. Treated patients during the first phase had a significant improvement in glucose-insulin metabolism demonstrated through the HOMA Disposition Index (p= 0.0075). Lipid profile also ameliorates in patients treated at a low dose and then at a high dose, particularly decreasing triglycerides (phase 1: p= 0.0212; phase 2: p= 0.0261). The weight and BMI of patients were stable throughout the period of study. Data from Flash glucose Monitoring (FGM) show a more stable glucose, mainly at the end of the study. Serum AGE concentrations showed a trend towards a decrease in treated patients, whereas IL-10 slowly increased without changes in IL-6 and IL-17.Lastly, 10 out of 19 patients after 26 weeks of treatment had a remission in IFG or IGT (52.6%). Conclusions. Intestinimonas butyriciproducens seems to improve insulin sensitivity and triglycerides in treated patients. Intestinimonas butyriciproducens could be a new strategy in the work-up of T2D prevention. Presentation: 6/1/2024

Retinal microcirculation changes in prediabetic patients with short-term increased blood glucose using optical coherence tomography angiography.

Retinal microcirculation alterations are early indicators of diabetic microvascular complications. Optical coherence tomography angiography (OCTA) is a noninvasive method to assess these changes. This study analyzes changes in retinal microcirculation in prediabetic patients during short-term increases in blood glucose using OCTA. To investigate the changes in retinal microcirculation in prediabetic patients experiencing short-term increases in blood glucose levels using OCTA. Fifty volunteers were divided into three groups: Group 1 [impaired fasting glucose (IFG) or impaired glucose tolerance (IGT)], Group 2 (both IFG and IGT), and a control group. Retinal microcirculation parameters, including vessel density (VD), perfusion density (PD), and foveal avascular zone (FAZ) metrics, were measured using OCTA. Correlations between these parameters and blood glucose levels were analyzed in both the fasting and postprandial states. One hour after glucose intake, the central VD (P = 0.023), central PD (P = 0.026), and parafoveal PD (P < 0.001) were significantly greater in the control group than in the fasting group. In Group 1, parafoveal PD (P < 0.001) and FAZ circularity (P = 0.023) also increased one hour after glucose intake. However, no significant changes were observed in the retinal microcirculation parameters of Group 2 before or after glucose intake (P > 0.05). Compared with the control group, Group 1 had a larger FAZ area (P = 0.032) and perimeter (P = 0.018), whereas Group 2 had no significant differences in retinal microcirculation parameters compared with the control group (P > 0.05). Compared with Group 1, Group 2 had greater central VD (P = 0.013) and PD (P = 0.008) and a smaller FAZ area (P = 0.012) and perimeter (P = 0.010). One hour after glucose intake, Group 1 had a larger FAZ area (P = 0.044) and perimeter (P = 0.038) than did the control group, whereas Group 2 showed no significant differences in retinal microcirculation parameters compared with the control group (P > 0.05). Group 2 had greater central VD (P = 0.042) and PD (P = 0.022) and a smaller FAZ area (P = 0.015) and perimeter (P = 0.016) than Group 1. At fasting, central PD was significantly positively correlated with blood glucose levels (P = 0.044), whereas no significant correlations were found between blood glucose levels and OCTA parameters one hour after glucose intake. A short-term increase in blood glucose has a more pronounced effect on retinal microcirculation in prediabetic patients with either IFG or IGT.

High-Protein Mulberry Leaves Improve Glucose and Lipid Metabolism via Activation of the PI3K/Akt/PPARα/CPT-1 Pathway.

High-Protein Mulberry is a novel strain of mulberry. High-Protein Mulberry leaves (HPM) were the subject of this study, which aimed to investigate its efficacy and underlying mechanisms in modulating glucose and lipid metabolism. A six-week intervention using db/db mice was carried out to assess the effects of HPM on serum lipid levels, liver function, and insulin (INS) levels. qRT-PCR and Western Blotting were employed to measure key RNA and protein expressions in the PI3K/Akt and PPARα/CPT-1 pathways. UHPLC-MS and the Kjeldahl method were utilized to analyze the component content and total protein. Additionally, network pharmacology was employed to predict regulatory mechanism differences between HPM and Traditional Mulberry leaves. The results of the study revealed significant improvements in fasting blood glucose, glucose tolerance, and insulin resistance in mice treated with HPM. HPM notably reduced serum levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), aspartate aminotransferase (AST), alanine aminotransferase (ALT), and INS, while increasing high-density lipoprotein cholesterol (HDL-C) levels. The treatment also effectively mitigated liver fatty lesions, inflammatory infiltration, and islet atrophy. HPM activation of the PI3K/Akt/PPARα/CPT-1 pathway suggested its pivotal role in the regulation of glucose and lipid metabolism. With its rich composition and pharmacodynamic material basis, HPM displayed a greater number of targets associated with glucose and lipid metabolism pathways, underscoring the need for further research into its potential therapeutic applications.

External validation of Finnish diabetes risk score (FINDRISC) and Latin American FINDRISC for screening of undiagnosed dysglycemia: Analysis in a Peruvian hospital health care workers sample.

To evaluate the external validity of Finnish diabetes risk score (FINDRISC) and Latin American FINDRISC (LAFINDRISC) for undiagnosed dysglycemia in hospital health care workers. We carried out a cross-sectional study on health workers without a prior history of diabetes mellitus (DM). Undiagnosed dysglycemia (prediabetes or diabetes mellitus) was defined using fasting glucose and two-hour oral glucose tolerance test. LAFINDRISC is an adapted version of FINDRISC with different waist circumference cut-off points. We calculated the area under the receptor operational characteristic curve (AUROC) and explored the best cut-off point. We included 549 participants in the analysis. The frequency of undiagnosed dysglycemia was 17.8%. The AUROC of LAFINDRISC and FINDRISC were 71.5% and 69.2%; p = 0.007, respectively. The optimal cut-off for undiagnosed dysglycemiaaccording to Index Youden was ≥ 11 in LAFINDRISC (Sensitivity: 78.6%; Specificity: 51.7%) and ≥12 in FINDRISC (Sensitivity: 70.4%; Specificity: 53.9%). The discriminative capacity of both questionnaires is good for the diagnosis of dysglycemia in the healthcare personnel of the María Auxiliadora hospital. The LAFINDRISC presented a small statistical difference, nontheless clinically similar, since there was no difference by age or sex. Further studies in the general population are required to validate these results.

Magnesium from Deep Seawater as a Potentially Effective Natural Product against Insulin Resistance: A Randomized Trial.

Background and Objectives: Deep seawater has been shown to restore pancreatic function in obese diabetic mice and considerably improve the homeostatic model assessment for insulin resistance, total cholesterol, and low-density lipoprotein cholesterol concentrations in patients with impaired fasting glucose or glucose tolerance. In this study, the effect of 12-week daily consumption of magnesium (Mg2+)-containing deep seawater mineral extracts on blood glucose concentration and insulin metabolism-associated indicators was investigated in patients with impaired glucose tolerance. Materials and methods: In this 12-week randomized, double-blind trial, patients (n = 37) with impaired glucose tolerance consumed deep seawater mineral extracts. Changes in blood glucose concentration and related indicators were compared between the treatment group and placebo group (n = 38). Results: The fasting insulin, C-peptide, homeostatic model assessment for insulin resistance, quantitative insulin sensitivity check index, homeostatic model assessment of beta-cell function, and Stumvoll insulin sensitivity index values in the deep seawater mineral extract group showed improvements compared with the placebo group. However, no significant differences between groups were observed in fasting blood glucose, postprandial blood glucose, glycated hemoglobin, or incremental area under the curve values. Conclusions: Oral supplementation with deep seawater mineral extracts enriched in Mg2+ markedly improves insulin sensitivity in patients with pre-diabetes. This study illustrates the potential clinical application of natural Mg2+ from deep seawater to alleviate insulin resistance in patients with pre-diabetes. Trial registration: This trial was retrospectively registered with Clinical Research information Service (CRIS), No. KCT0008695, on 8 August 2023.

Blood glucose outcomes of anti-retroviral therapy naïve Ugandan people with HIV with pre-diabetes mellitus initiated on dolutegravir for 48 weeks

BackgroundThe Uganda ministry of Health recommends frequent blood glucose monitoring for the first six months on dolutegravir, in people with HIV (PWH) having pre-diabetes mellitus (pre-DM). We sought to determine if indeed PWH with pre-diabetes started on dolutegravir had worse blood glucose outcomes at 48 weeks compared to those with normal blood glucose.MethodsIn this matched cohort study, we compared 44 PWH with pre-DM and 88 PWH with normal blood glucose at baseline. The primary outcome was change in mean fasting blood glucose (FBG) from baseline to week 48 and 2-hour blood glucose (2hBG) from baseline to week 36 compared between the two groups.ResultsThere was significant increase in FBG in PWH with normal blood glucose (mean change in FBG(FBG): 3.9 mg/dl, 95% confidence interval (95% CI): (2.2, 5.7), p value (p) = < 0.0001) and decrease in those with pre-DM (FBG: -6.1 mg/dl, 95%CI (-9.1, -3.2), p = < 0.0001) at 48 weeks. 2hBG was significantly lower than at baseline in both groups with the magnitude of reduction larger in those with pre-DM at 12 weeks (adjusted differences in mean drop in 2hBG (a2hBG): -19.69 mg/dl, 95%CI (-30.19, -9.19), p = < 0.0001) and 36 weeks (a2hBG: -19.97 mg/dl, 95%CI (-30.56, -9.39), p = < 0.0001).ConclusionWe demonstrated that Ugandan ART naïve PWH with pre-diabetes at enrollment have consistent improvement in both fasting blood glucose and glucose tolerance over 48 weeks on dolutegravir. Intensified blood glucose monitoring of these patients in the first six months of dolutegravir may be unnecessary.

Anti-hyperglycemic effect of Commelina diffusa extracts on diabetic mice model

This study aimed to investigate the blood glucose stabilising effect of extracts from Commelina diffusa Burm.f. on glucose tolerance test and diabetes test in white mice by streptozotocin. The diabetic mice were induced to hyperglycemia by intraperitoneal injection of streptozotocin in a single dose (170 mg/kg). Water extract, 96% ethanol extract, and 50% ethanol extract of C. diffusa were given orally for 7 days and the reference drug glibenclamide was given orally once on the 7th experimental day. The hypoglycemic effect was evaluated by quantifying fasting plasma glucose concentration and glucose tolerance test. The results of 96% ethanol extract of C. diffusa at two oral doses of 0.21 and 0.42 g/kg showed a more typical hypoglycemic effect than the water extract (0.36 and 0.72 g/kg) and 50% ethanol extract (0.49 and 0.98 g/kg) in both fasting blood glucose and glucose tolerance tests. The hypoglycemic effect of 96% ethanol extract of C. diffusa was equivalent to glibenclamide at a dose of 5 mg/kg measured in fasting state and was weaker than glibenclamide in the glucose tolerance test.

Association between myosteatosis and impaired glucose metabolism: A deep learning whole-body magnetic resonance imaging population phenotyping approach.

There is increasing evidence that myosteatosis, which is currently not assessed in clinical routine, plays an important role in risk estimation in individuals with impaired glucose metabolism, as it is associated with the progression of insulin resistance. With advances in artificial intelligence, automated and accurate algorithms have become feasible to fill this gap. In this retrospective study, we developed and tested a fully automated deep learning model using data from two prospective cohort studies (German National Cohort [NAKO] and Cooperative Health Research in the Region of Augsburg [KORA]) to quantify myosteatosis on whole-body T1-weighted Dixon magnetic resonance imaging as (1) intramuscular adipose tissue (IMAT; the current standard) and (2) quantitative skeletal muscle (SM) fat fraction (SMFF). Subsequently, we investigated the two measures for their discrimination of and association with impaired glucose metabolism beyond baseline demographics (age, sex and body mass index [BMI]) and cardiometabolic risk factors (lipid panel, systolic blood pressure, smoking status and alcohol consumption) in asymptomatic individuals from the KORA study. Impaired glucose metabolism was defined as impaired fasting glucose or impaired glucose tolerance (140-200mg/dL) or prevalent diabetes mellitus. Model performance was high, with Dice coefficients of ≥0.81 for IMAT and ≥0.91 for SM in the internal (NAKO) and external (KORA) testing sets. In the target population (380 KORA participants: mean age of 53.6±9.2years, BMI of 28.2±4.9kg/m2, 57.4% male), individuals with impaired glucose metabolism (n=146; 38.4%) were older and more likely men and showed a higher cardiometabolic risk profile, higher IMAT (4.5±2.2% vs. 3.9±1.7%) and higher SMFF (22.0±4.7% vs. 18.9±3.9%) compared to normoglycaemic controls (all P≤0.005). SMFF showed better discrimination for impaired glucose metabolism than IMAT (area under the receiver operating characteristic curve [AUC] 0.693 vs. 0.582, 95% confidence interval [CI] [0.06-0.16]; P<0.001) but was not significantly different from BMI (AUC 0.733 vs. 0.693, 95% CI [-0.09 to 0.01]; P=0.15). In univariable logistic regression, IMAT (odds ratio [OR]=1.18, 95% CI [1.06-1.32]; P=0.004) and SMFF (OR=1.19, 95% CI [1.13-1.26]; P<0.001) were associated with a higher risk of impaired glucose metabolism. This signal remained robust after multivariable adjustment for baseline demographics and cardiometabolic risk factors for SMFF (OR=1.10, 95% CI [1.01-1.19]; P=0.028) but not for IMAT (OR=1.14, 95% CI [0.97-1.33]; P=0.11). Quantitative SMFF, but not IMAT, is an independent predictor of impaired glucose metabolism, and discrimination is not significantly different from BMI, making it a promising alternative for the currently established approach. Automated methods such as the proposed model may provide a feasible option for opportunistic screening of myosteatosis and, thus, a low-cost personalized risk assessment solution.