Family Rhabdoviridae Research Articles

Harnessing snakehead rhabdovirus (SHRV) for gene editing by installment of CRISPR/Cas9 in viral genome

As there is no risk of viral genome integration into host chromosome, cytoplasmic RNA viruses can be a safer vehicle to deliver CRISPR/Cas system. Snakehead rhabdovirus (SHRV) is a piscine RNA virus belonging to the family Rhabdoviridae, and, in the present study, we evaluated the availability of SHRV as a tool for CRISPR/Cas9 delivery in mammalian cells. SHRV was grown well in baby hamster kidney (BHK-21) cells at 28 °C, and the replication ability was greatly reduced by temperature up-shift to 37 °C. We rescued a recombinant SHRV that harboring not only the interferon regulatory factor 9 (IRF9) gene-targeting single-guide RNA (sgRNA) but also Cas9 gene in the genome using the reverse genetic technology. The IRF9 gene of BHK-21 cells was knocked-out by the infection with the IRF9 gene-targeting rSHRV. Moreover, the rSHRVs were sharply disappeared in the cells by elevating temperature to 37 °C, suggesting the possible regulation of knockout efficiency before virus infection-caused cell damage. Although further optimization researches are needed to enhance the editing efficiency using the recombinant SHRV, to our knowledge, this is the first report on the possible applicability of piscine RNA virus for the gene editing in mammalian cells.

Cyclophilin A: a possible host modulator in Chandipura virus infection.

Chandipura virus (CHPV), belonging to the genus Vesiculovirus of the family Rhabdoviridae, has been identified as one of the causes of pediatric encephalitis in India. Currently, neither vaccines nor therapeutic drugs are available against this agent. Considering that the disease progresses very fast with a high mortality rate, working towards the development of potential therapeutics against it will have a public health impact. Although the use of viral inhibitors as antiviral agents is the most common way to curb virus replication, the mutation-prone nature of viruses results in the development of resistance to antiviral agents. The recent development of proteomic platforms for analysis of purified viral agents has allowed certain upregulated host proteins that are involved in the morphogenesis and replication of viruses to be identified. Thus, the alternative approach of inhibition of host proteins involved in the regulation of virus replication could be explored for their therapeutic effectiveness. In the current study, we have evaluated the effect of inhibition of cyclophilin A (CypA), an immunophilin with peptidyl-prolyl cis/trans-isomerase activity, on the replication of CHPV. Treatment with cyclosporin A, used in vitro for the inhibition of CypA, resulted in a 3-log reduction in CHPV titer and an undetectable level of CypA in comparison to an untreated control. An in silico analysis of the interaction of the CHPV nucleoprotein with the human CypA protein showed stable interaction in molecular docking and molecular dynamics simulations. Overall, the results of this study suggest a possible role of CypA in facilitating CHPV replication, thus making it one of the potential host factors to be explored in future antiviral studies.Supplementary informationThe online version contains supplementary material available at 10.1007/s00705-021-05237-1.

Complete genome sequence of a novel varicosavirus infecting tall morning glory (Ipomoea purpurea).

A novel varicosa-like virus was identified in a tall morning glory (Ipomoea purpurea) plant by high-throughput sequencing and tentatively named "morning glory varicosavirus" (MGVV). The complete genome of MGVV contains two segments of negative-sense single-stranded RNA of 6409 (RNA1) and 5288 (RNA2) nucleotides. RNA1 encodes a 224.3-kDa large protein (224K), and RNA2 encodes four putative proteins of 48.6 kDa (49K), 46.4 kDa (46K), 35.7 kDa (36K), and 36.8 kDa (37K), respectively. The 224K and 49K proteins show amino acid sequence similarity to the large protein (39.4%) and the 49K protein (22.6%), respectively, of red clover-associated varicosavirus, and the 36K protein shares 19.6% amino acid sequence similarity with protein 3 of lettuce big-vein associated virus. The 46K and 37K proteins share no significant sequence similarity to known functional viral sequences. Phylogenetic analysis based on the large protein of MGVV and other rhabdoviruses showed that MGVV clustered with the varicosaviruses. These analyses indicate that MGVV is a novel member of the genus Varicosavirus in the family Rhabdoviridae.

α-Lipoic Acid Exerts Its Antiviral Effect against Viral Hemorrhagic Septicemia Virus (VHSV) by Promoting Upregulation of Antiviral Genes and Suppressing VHSV-Induced Oxidative Stress

Viral hemorrhagic septicemia virus (VHSV), belonging to the genus Novirhabdovirus, Rhabdoviridae family, is a causative agent of high mortality in fish and has caused significant losses to the aquaculture industry. Currently, no effective vaccines, Food and Drug Administration-approved inhibitors, or other therapeutic intervention options are available against VHSV. α-Lipoic Acid (LA), a potent antioxidant, has been proposed to have antiviral effects against different viruses. In this study, LA (CC50 = 472.6 μmol/L) was repurposed to exhibit antiviral activity against VHSV. In fathead minnow cells, LA significantly increased the cell viability post-VHSV infection (EC50 = 42.7 μmol/L), and exerted a dose-dependent inhibitory effect on VHSV induced-plaque, cytopathic effects, and VHSV glycoprotein expression. The time-of-addition assay suggested that the antiviral activity of LA occurred at viral replication stage. Survival assay revealed that LA could significantly upregulated the survival rate of VHSV-infected largemouth bass in both co-injection (38.095% vs. 1.887%, P < 0.01) and post-injection manner (38.813% vs. 8.696%, P < 0.01) compared with the control group. Additional comparative transcriptome and qRT-PCR analysis revealed LA treatment upregulated the expression of several antiviral genes, such as IRF7, Viperin, and ISG15. Moreover, LA treatment reduced VHSV-induced reactive oxygen species production in addition to Nrf2 and SOD1 expression. Taken together, these data demonstrated that LA suppressed VHSV replication by inducing antiviral genes expression and reducing VHSV-induced oxidative stress. These results suggest a new direction in the development of potential antiviral candidate drugs against VHSV infection.Supplementary InformationThe online version contains supplementary material available at 10.1007/s12250-021-00440-5.

Evaluation on the antiviral activity of Bacillus velezensis extract against spring viremia of carp virus

Spring viremia of carp virus (SVCV), a member of the family Rhabdoviridae, can cause acute haemorrhagic and contagious viraemia in cyprinids. In this study, the ethyl acetate extract from Bacillus velezensis JW supernatant (EJW) was explored for anti-SVCV activity in vitro and in vivo. EJW showed a highly efficient anti-SVCV activity with an inhibitory rate more than 95% at the concentration of 30 mg/L, and mainly inhibited the early events of SVCV replication (except adsorption) in epithelioma papulosum cyprini (EPC) cells. What's more, in the treatment of EJW, SVCV glycoprotein and nucleoprotein gene expression were significantly inhibited in kidney and spleen of common carps at 2 and 4 d, and the survival rate of SVCV-infected common carp was increased up to 14%. Furthermore, the expression levels of IFN-Ι, IFNφ2β, TNFα and MDA5 genes were up-regulated, which showed that EJW could enhance the expression of antiviral immune genes. Altogether, EJW is suggested as a promising antiviral strategy against SVCV and can be further explored for controlling the virus infection in aquaculture farms.

Vesicular Stomatitis Virus: From Agricultural Pathogen to Vaccine Vector.

Vesicular stomatitis virus (VSV), which belongs to the Vesiculovirus genus of the family Rhabdoviridae, is a well studied livestock pathogen and prototypic non-segmented, negative-sense RNA virus. Although VSV is responsible for causing economically significant outbreaks of vesicular stomatitis in cattle, horses, and swine, the virus also represents a valuable research tool for molecular biologists and virologists. Indeed, the establishment of a reverse genetics system for the recovery of infectious VSV from cDNA transformed the utility of this virus and paved the way for its use as a vaccine vector. A highly effective VSV-based vaccine against Ebola virus recently received clinical approval, and many other VSV-based vaccines have been developed, particularly for high-consequence viruses. This review seeks to provide a holistic but concise overview of VSV, covering the virus’s ascension from perennial agricultural scourge to promising medical countermeasure, with a particular focus on vaccines.

Identification of the genome sequence of Zostera associated varicosavirus 1, a novel negative-sense RNA virus, in the common eelgrass (Zostera marina) transcriptome.

Varicosaviruses (the genus Varicosavirus) are bipartite, negative-sense, single-stranded RNA viruses that infect plants. We analyzed a transcriptome dataset isolated from the common eelgrass (Zostera marina) and identified a novel varicosavirus named Zostera associated varicosavirus 1 (ZaVV1). The ZaVV1 genome consists of two genomic segments: RNA1 (6,632-nt) has an open reading frame (ORF) encoding a large multi-functional polymerase protein (L), while RNA2 (4,304-nt) has four ORFs: one for a nucleocapsid protein and three for proteins with unknown functions (P2, P3, and P4). Sequence comparison and phylogenetic analysis using L proteins showed that ZaVV1 is a novel member of the genus Varicosavirus of the family Rhabdoviridae. The conserved regulatory elements involved in transcription termination/polyadenylation and transcription initiation were identified in the ZaVV1 gene-junction regions with the consensus sequence 3'-UAUUAUUCUUUUUGCUCU-5' (in the negative-sense genome). The ZaVV1 genome sequence may be useful for studying the phylogenetic relationships of varicosaviruses and genome evolution of rhabdoviruses. Keywords: Zostera associated varicosavirus 1; Varicosavirus; Rhabdoviridae; common eelgrass; Zostera marina.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Rice Stripe Mosaic Disease: Characteristics and Control Strategies.

Rice stripe mosaic disease (RSMD) is caused by the rice stripe mosaic virus (RSMV; genus Cytorhabdovirus, family Rhabdoviridae). In recent years, significant progress has been made in understanding several aspects of the disease, especially its geographical distribution, symptoms, vectors, gene functions, and control measures. Since RSMD was first detected in southern China in 2015, it has been found in more and more rice growing areas and has become one of the most important rice diseases in southern China. RSMV is transmitted by the leafhopper Recilia dorsalis in a persistent-propagative manner, inducing yellow stripes, a slight distortion of leaves, increased tillers, and empty grains in rice plants. The virus has a negative-sense single-strand RNA genome of about 12.7 kb that encodes seven proteins: N, P, P3, M, G, P6, and L. Several molecular and serological tests have been developed to detect RSMV in plants and insects. The disease cycle can be described as follows: RSMV and its vector overwinter in infected plants; viruliferous R. dorsalis adults transmit the virus to spring rice and lay eggs on the infected seedlings; the next generation of R. dorsalis propagate on infected seedlings, become viruliferous, disperse, and cause new disease outbreaks. Control measures include monitoring and accurate forecasting, selecting disease-resistant varieties, improving cultivation systems, covering rice seedling nurseries with insect-proof nets, and using pesticides rationally. Inappropriate cultivation systems, pesticide overuse, and climatic conditions contribute to epidemics by affecting the development of vector insects and their population dynamics.

Chandipura virus dysregulates the expression of hsa-miR-21-5p to activate NF-\u03baB in human microglial cells

BackgroundChandipura virus (CHPV) is a negative single-stranded RNA virus of the Rhabdoviridae family. CHPV infection has been reported in Central and Western India. CHPV causes acute encephalitis with a case fatality rate of 70 % and mostly affects children below 15 years of age. CHPV infection in brain leads to neuronal apoptosis and activation of the microglial cells. The microRNAs (miRNAs) are small endogenous non-coding RNA that regulate the gene expression. Viral infections perturb the expression pattern of cellular miRNAs, which may in turn affect the expression pattern of downstream genes. This study aims to investigate hsa-miR-21-5p mediated regulation of PTEN, AKT, NF-ĸBp65, IL-6, TNF-α, and IL-1β, in human microglial cells during CHPV infection.MethodsTo understand the role of hsa-miR-21-5p in CHPV infection, the human microglial cells were infected with CHPV (MOI-0.1). Real-time PCR, western blotting, Luciferase assay, over-expression and knockdown techniques were used to understand the role of hsa-miR-21-5p in the regulation of PTEN, AKT and, NF-ĸBp65, IL-6, TNF-α, and IL-1β in this study.ResultsThe hsa-miR-21-5p was found to be upregulated during CHPV infection in human microglial cells. This led to the downregulation of PTEN which promoted the phosphorylation of AKT and NF-ĸBp65. Over-expression of hsa-miR-21-5p led to the decreased expression of PTEN and promoted further phosphorylation of AKT and NF-ĸBp65 in human microglial cells. However, the inhibition of hsa-miR-21-5p using hsa-miR-21-5p inhibitor restored the expression.ConclusionsThis study supports the role of hsa-miR-21-5p in the regulation of pro-inflammatory genes in CHPV infected human microglial cells.

Isolation and characterisation of a novel rhabdovirus from snakehead fish showing surface ulcerations and mortality from India: First report

A novel viral agent was isolated from striped snakehead (Channa striata Bloch, 1793) suffering from mortality with dermal ulcerations and haemorrhagic areas in South India. The virus growth was well supported in striped snakehead (SSN-1) and sea bass caudal peduncle (SBCP2a) cell lines at 27 °C while EPC cells were refractory to the virus. Transmission electron microscopy of the infected cells revealed bullet shaped virions with the size ranging from 150 to190 nm length and 46 to 60 nm width. RT-PCR targeting block III fragment of the rhabdovirus L polymerase gene amplified an expected genomic portion of 483 bp. Phylogenetic analysis indicated 91% homology to the equivalent region of the reported snakehead rhabdovirus L polymerase. Experimental infection studies using cell culture grown virus induced 100% morality in juvenile snakehead in five days. Fish showed listlessness, neural pathology and lethargy before dying. Clinical signs included haemorrhages at the fin bases, exophthalmia, darkening of the skin, vascular congestion around the eyes and reddish iris and surface ulcers. The virus caused extensive necrosis of kidney, spleen and liver. The clinical pathology along with the morphology and phylogenetic homogeneity indicates that the virus belongs to the genus Novirhabdovirus under the family Rhabdoviridae. The present study forms the first report of isolation of a fish rhabdovirus in India.

Can Rabies Vaccines be given with or after COVID-19 Vaccines and Vice Versa?

Rabies is a dreaded disease and kills about 59,0001 persons every year. The ongoing COVID-19 pandemic has also killed about 3.9 million2 people since it started last year in 2020. The recent fast track development of vaccines against COVID-19 has emerged as a hope to contain the pandemic. Questions are being asked about whether one can take rabies vaccine with or after COVID-19 vaccination and vice versa. Rabies is caused by a single-stranded RNA virus belonging to Lyssavirus genus of the family Rhabdoviridae. These viruses are enveloped and have a single-stranded RNA genome with negative-sense and cause neurological symptoms and encephalitis. The Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) is a positive-sense, single-stranded RNA virus that causes the potentially lethal COVID-19 respiratory tract infection. This new SARS-CoV-2 virus belongs to the genus Betacoronavirus, which also includes Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-1) and Middle East Respiratory Syndrome Coronavirus (MERS-CoV). The doctors fear any adverse cross-reaction between the two vaccines because both rabies and COVID-19 viruses are RNA viruses.

Mosquito-borne arboviruses in Uganda: history, transmission and burden.

Mosquito-transmitted arboviruses constitute a large proportion of emerging infectious diseases that are both a public health problem and a threat to animal populations. Many such viruses were identified in East Africa, a region where they remain important and from where new arboviruses may emerge. We set out to describe and review the relevant mosquito-borne viruses that have been identified specifically in Uganda. We focused on the discovery, burden, mode of transmission, animal hosts and clinical manifestation of those previously involved in disease outbreaks. A search for mosquito-borne arboviruses detected in Uganda was conducted using search terms 'Arboviruses in Uganda' and 'Mosquitoes and Viruses in Uganda' in PubMed and Google Scholar in 2020. Twenty-four mosquito-borne viruses from different animal hosts, humans and mosquitoes were documented. The majority of these were from family Peribunyaviridae, followed by Flaviviridae, Togaviridae, Phenuiviridae and only one each from family Rhabdoviridae and Reoviridae. Sixteen (66.7 %) of the viruses were associated with febrile illnesses. Ten (41.7 %) of them were first described locally in Uganda. Six of these are a public threat as they have been previously associated with disease outbreaks either within or outside Uganda. Historically, there is a high burden and endemicity of arboviruses in Uganda. Given the many diverse mosquito species known in the country, there is also a likelihood of many undescribed mosquito-borne viruses. New generation diagnostic platforms have great potential to identify new viruses. Indeed, four novel viruses, two of which were from humans (Ntwetwe and Nyangole viruses) and two from mosquitoes (Kibale and Mburo viruses) including the 2010 yellow fever virus (YFV) outbreak were identified in the last decade using next generation sequencing. Given the unbiased approach of detection of viruses by this technology, its use will undoubtedly be critically important in the characterization of mosquito viromes which in turn will inform other diagnostic efforts.

Analysis of the dark proteome of Chandipura virus reveals maximum propensity for intrinsic disorder in phosphoprotein

Chandipura virus (CHPV, a member of the Rhabdoviridae family) is an emerging pathogen that causes rapidly progressing influenza-like illness and acute encephalitis often leading to coma and death of the human host. Given several CHPV outbreaks in Indian sub-continent, recurring sporadic cases, neurological manifestation, and high mortality rate of this infection, CHPV is gaining global attention. The ‘dark proteome’ includes the whole proteome with special emphasis on intrinsically disordered proteins (IDP) and IDP regions (IDPR), which are proteins or protein regions that lack unique (or ordered) three-dimensional structures within the cellular milieu. These proteins/regions, however, play a number of vital roles in various biological processes, such as cell cycle regulation, control of signaling pathways, etc. and, therefore, are implicated in many human diseases. IDPs and IPPRs are also abundantly found in many viral proteins enabling their multifunctional roles in the viral life cycles and their capability to highjack various host systems. The unknown abundance of IDP and IDPR in CHPV, therefore, prompted us to analyze the dark proteome of this virus. Our analysis revealed a varying degree of disorder in all five CHPV proteins, with the maximum level of intrinsic disorder propensity being found in Phosphoprotein (P). We have also shown the flexibility of P protein using extensive molecular dynamics simulations up to 500 ns (ns). Furthermore, our analysis also showed the abundant presence of the disorder-based binding regions (also known as molecular recognition features, MoRFs) in CHPV proteins. The identification of IDPs/IDPRs in CHPV proteins suggests that their disordered regions may function as potential interacting domains and may also serve as novel targets for disorder-based drug designs.

Sequences of Previously Unknown Rhabdoviruses Detected in Bat Samples from the Republic of the Congo.

The family Rhabdoviridae contains diverse viruses, including vector-borne and nonvector-borne viruses, some that are human pathogens, including rabies virus and also nonpathogenic viruses. Bats, which are a known reservoir of viruses with zoonotic potential including coronaviruses, also carry multiple rhabdoviruses such as but not limited to lyssaviruses. We collected samples from 193 insectivorous and frugivorous bats in the Republic of the Congo and tested them for rhabdovirus RNA. Four samples were found positive for viral RNA representing sequences of four different, not previously described rhabdoviruses. Although phylogenetic and taxonomic placement of the novel sequences is uncertain, similarities with previously detected rhabdovirus sequences in bats suggest that these could represent vertebrate viruses. Considering the pathogenic risks some rhabdoviruses pose for humans, these results highlight the need for more research and surveillance regarding rhabdoviruses and bats.

New Pathogenic Viruses of Natural Foci in Primorye Isolated over the 80-Year History of the Institute: A Review of Virological Studies

Background: The discovery of a new viral disease called tick-borne encephalitis (TBE) in the Far East in 1937 triggered the thematic virology research on the Eurasian continent. The purpose of our study was to conduct a virological and epidemiological monitoring of tick-borne viral infections in the Primorsky Krai over an 80-year period. Materials and methods: Several hundreds of strains belonging to the viruses of the TBE complex (Flaviviridae family) and other families have been isolated; their biological, antigenic and molecular genetic characteristics have been studied. Results: The most complete picture of the Far Eastern population of the TBE virus was obtained in the 1990s based on whole genome sequencing of 50 TBEV strains isolated from patients with different clinical manifestations of the disease and from ixodid ticks. It was established that all the strains belong to the same Far Eastern subtype of TBEV with three clusters (Oshima-, Sofjin-, and Senzhang-). In 1972, the Powassan virus was first isolated from Haemaphisalis longicornis ticks on the Eurasian continent. Phylogenetic analysis based on the whole genome characteristics of the Spassk-9, Nadezdinsk-1991 and Partizansk-2006 strains, as well as the characteristics of five fragments of other Powassan virus strains, indicated that they all belong to the Powassan virus lineage I. The first comparative description of three strains Primorye-155-77, Primorye-20-79 and Primorye-185-91 of the Louping ill virus was given. A comprehensive study of the isolated Ozernoe strain of a deceased female patient enabled identification of the first clinical case of the lyssavirus disease in the Asian part of Russia. This strain is genetically close and has a common ancestor with the Irkut strain and is attributed to pathogens of the genus Lyssavirus, family Rhabdoviridae. Conclusion: Isolation of a highly pathogenic lyssavirus and several viruses of the TBE complex indicates the importance of such virology surveillance and proves the necessity of its continuation.

Virome Diversity among Mosquito Populations in a Sub-Urban Region of Marseille, France.

Some mosquito species have significant public health importance given their ability to transmit major diseases to humans and animals, making them the deadliest animals in the world. Among these, the Aedes (Ae.) genus is a vector of several viruses such as Dengue, Chikungunya, and Zika viruses that can cause serious pathologies in humans. Since 2004, Ae. albopictus has been encountered in the South of France, and autochthonous cases of Dengue, Chikungunya, and Zika diseases have recently been reported, further highlighting the need for a comprehensive survey of the mosquitoes and their associated viruses in this area. Using high throughput sequencing (HTS) techniques, we report an analysis of the DNA and RNA viral communities of three mosquito species Ae. albopictus, Culex (Cx.) pipiens, and Culiseta (Cs.) longiareolata vectors of human infectious diseases in a small sub-urban city in the South of France. Results revealed the presence of a significant diversity of viruses known to infect bacteria, plants, insects, and mammals. Several novel viruses were detected, including novel members of the Rhabdoviridae, Totiviridae, Iflaviviridae, Circoviridae, and Sobemoviridae families. No sequence related to major zoonotic viruses transmitted by mosquitoes was detected. The use of HTS on arthropod vector populations is a promising strategy for monitoring the emergence and circulation of zoonoses and epizooties. This study is a contribution to the knowledge of the mosquito microbiome.

Knowledge, attitudes and practices regarding rabies among community members: a cross-sectional study in Songan Village, Bali, Indonesia.

Rabies is a preventable yet endemic zoonotic disease caused by a neurotrophic virus, a member of Rhabdoviridae family. Rabies remains a public health threat in Indonesia, specifically Bali Province. The present study aimed to understand the knowledge, attitudes and practices (KAP) regarding rabies among community members in Songan Village, Bali, Indonesia. We conducted a cross-sectional survey using a structured questionnaire among 175 community members residing in the administrative area of public health centre of Kintamani V in Songan Village of Bangli District, from December 2019 to February 2020. Statistical analyses were performed with SPSS software, version 21. Of the 175 community members, 53 (30.3%) owned a dog. Majority of the respondents were Hindu (98.8%), female (56.0%), aged ≥ 29 years old (54.9%), with an educational background of higher secondary (28.6%), residing in Songan A and B residential village (86.9%), working as farmers (50.9%), with the level of income less than district minimum wage (71.4%). The KAP scores mean ± standard deviation were 6.93 ± 1.83 and 8.04 ± 1.07 (out of 10), respectively. Multivariable logistic regression models were constructed and the KAP of the community members was found to be significantly influenced by occupation (p-value < 0.05). Albeit community members demonstrated some level of KAP regarding rabies, overall, this study revealed critical gaps in their fundamental knowledge of rabies, the prevention in dogs, and the local rules and regulations concerning rabies. In accordance with One Health Approach, further enforcement on the collaborative efforts for comprehensive education programmes, scheduled mass vaccination for dogs, and promotion for healthier attitudes and practices are recommended.

Joá yellow blotch-associated virus, a new alphanucleorhabdovirus from a wild solanaceous plant in Brazil.

We identified a novel plant rhabdovirus infecting native joá (Solanum aculeatissimum) plants in Brazil. Infected plants showed yellow blotches on the leaves, and typical enveloped bacilliform rhabdovirus particles associated with the nucleus were seen in thin sections by electron microscopy. The virus could be graft-transmitted to healthy joá and tomato plants but was not mechanically transmissible. RT-PCR using degenerate plant rhabdovirus L gene primers yielded an amplicon from extracted total RNA, the sequence of which was similar to those of alphanucleorhabdoviruses. Based on close sequence matches, especially with the type member potato yellow dwarf virus (PYDV), we adopted a degenerate-primer-walking strategy towards both genome ends. The complete genome of joá yellow blotch-associated virus (JYBaV) is comprised of 12,965 nucleotides, is less than 75% identical to that of its closest relative PYDV, and clusters with PYDV and other alphanucleorhabdoviruses in L protein phylogenetic trees, suggesting that it should be taxonomically classified in a new species in the genus Alphanucleorhabdovirus, family Rhabdoviridae. The genome organization of JYBaV is typical of the 'PYDV-like' subgroup of alphanucleorhabdoviruses, with seven genes (N-X-P-Y-M-G-L) separated by conserved intergenic regions and flanked by partly complementary 3' leader and 5' trailer regions.

First detection of orchid fleck virus in orchids in Mexico.

For the first time, an isolate of the dichorhavirus orchid fleck virus (OFV, family Rhabdoviridae) was found infecting an orchid plant in Mexico. The infected sample of Epidendrum veroscriptum was collected in a nursery in Lagunillas, municipality of Zihuateutla, Edo. Puebla. Mites gathered on this plant were analyzed by light and scanning electron microscopy, which consistently indicated the presence of adults of the species Brevipalpus californicus, the common vector of OFV. Viral identification was based on symptoms, cytopathology, and reverse transcriptase-PCR/sequencing of genome fragments of the RNA1 and 2 molecules. Since isolates of OFV causing citrus leprosis have been previously detected in the Mexican states of Chiapas, Querétaro, and Jalisco, we promote a pertinent discussion and thought-provoking questions regarding the epidemiology and putative evolution of OFV.