Extensive Distribution Research Articles

Targeting Dlat-Trpv3 pathway by hyperforin elicits non-canonical promotion of adipose thermogenesis as an effective anti-obesity strategy

IntroductionPromoting adipose thermogenesis is considered as a promising therapeutic intervention in obesity. However, endeavors to develop anti-obesity medications by targeting the canonical thermogenesis regulatory pathway, particularly β3-adrenergic receptor (β3-AR)-dependent mechanism, have failed due to the off-target effects of β3-AR agonists, exacerbating the risk of cardiovascular disease. Hyperforin (HPF), a natural compound extracted from the traditional herbal St. John’s Wort, binds to Dihydrolipoamide s-acetyltransferase (Dlat) and exerts effective anti-obesity properties through promoting adipose thermogenesis. ObjectivesThe objective of this study was to investigate the oral efficacy and pharmacokinetics profile of HPF, and explore the detailed mechanism by which Dlat modulates HPF-mediated adipose thermogenesis. MethodsTo assess the anti-obesity efficacy of orally administered HPF in vivo, Dlat heterozygous knockout (Dlat+/-) mice and wild-type (WT) mice, both fed a high-fat diet (HFD), underwent a validation process that involved the use of metabolic cages, NMR analysis, and infrared imaging. Sprague Dawley rats were employed to determine the pharmacokinetic parameters of HPF. Seahorse assays, JC-1 staining, qPCR, and immunoblotting were performed to evaluate cellular thermogenic efficacy of HPF and Dlat in vitro. ResultsOur study uncovered a non-canonical thermogenesis pathway involving Dlat, transient receptor potential vanilloid 3 (Trpv3, a calcium channel) and AMPK. Dlat interacted with Trpv3 to activate it, resulting in an increase in intracellular calcium (Ca2+) and the activation of Camkkβ. Camkkβ then stimulated AMPK, leading to elevated Ucp1 expression and initiating adipose thermogenesis. HPF promoted thermogenesis in adipose tissues through enhancing the Dlat-Trpv3 interaction independently of β3­AR, causing minimal cardiac side effects. Notably, HPF’s thermogenic effects were reduced in Dlat+/- mice. Moreover, HPF exerted favorable oral bioavailability, a relatively long half-life, and extensive distribution within adipose tissues. ConclusionIn summary, our study demonstrates that HPF targets a novel mechanism for promoting adipose thermogenesis and exhibits potent and safe anti-obesity efficacy.

Violation of Exclusive Distribution Agreement: Case Study of PT Unilever Indonesia Tbk vs PT Indomarco Prismatama

Breach of exclusive distribution agreement is one of the critical issues that often arise in business relationships between manufacturers and distributors, especially in competitive industries such as fast-moving consumer goods. The case involving PT Unilever Indonesia Tbk and PT Indomarco Prismatama (Indomaret) is a clear example of such a dispute, where the dispute arose from an alleged breach of an exclusive distribution agreement by Indomaret. Unilever claimed that Indomaret, acting as one of their main distributors, had sold Unilever's products outside the terms stipulated in the exclusive agreement, including selling the products below the agreed price or even to third parties not included in the authorized distribution network. This study examines in depth the legal aspects of exclusive distribution agreements in the context of business disputes in Indonesia, with a focus on the Supreme Court's decision number 1559 K/Pdt/2015 which upheld Unilever's claim for breach of contract by Indomaret. Through normative juridical analysis, this research seeks to explore the implications of the ruling for product distribution practices in Indonesia, as well as how such breaches may affect the long-term business relationship between manufacturers and distributors. The analysis shows that exclusive distribution agreements are contractual instruments that have a significant impact on competition in the market. When one party breaches the agreed terms, whether in terms of price, distribution area, or other requirements, the impact is not only limited to legal aspects, but also touches on aspects of reputation and business relationships. In this case, the Supreme Court ruled that PT Indomarco Prismatama was guilty of breach of contract and was required to compensate PT Unilever Indonesia Tbk. This judgment emphasizes the importance of compliance with exclusive distribution contracts and the need for strict sanctions to maintain market integrity. The broader impact of this breach also includes aspects of fair competition. This research highlights how non-compliant distribution practices can affect market dynamics, especially when large distributors such as Indomaret are involved. Under these conditions, exclusive distribution violations can create unfair conditions for other business actors who operate in accordance with existing rules. Therefore, in addition to the legal implications of breach of contract, this study also proposes stricter regulations and effective monitoring mechanisms to prevent such practices from occurring in the future. In addition, this study also provides insights into how the business relationship between producers and distributors should be maintained through a clear and transparent contractual mechanism. One of the key findings of this research is the importance of detailed agreements and strict sanctions against violations, as well as the need for close supervision of contract implementation, especially in highly competitive industries. This applies not only to the consumer goods sector, but also to other sectors that rely on extensive and complex distribution systems. Thus, this research contributes to the understanding of the importance of exclusive distribution agreements in maintaining a balance between the business interests of producers and distributors, as well as in ensuring the creation of a competitive and fair business climate. This research also enriches the literature on business and distribution law in Indonesia, and provides practical insights for companies involved in distribution agreements to avoid potential disputes in the future.

Sex-specific neurotoxicity and transgenerational effects of an emerging pollutant, tris(1,3-dichloro-2-propyl)phosphate (TDCIPP)

The growing production and usage of flame retardants (FRs) results in their extensive environmental distribution, potentially posing a threat on both ecological and human health. Tris(1,3-dichloro-2-propyl)phosphate (TDCIPP), a commonly used FR, is commonly found in aquatic ecosystems, and aquatic organisms, including fish, may be exposed to TDCIPP during specific stages of their life cycles, or across generations. Here, we aim to identify and compare the neurotoxic effects of TDCIPP on the brains of female and male adult marine medaka (Oryzias melastigma) across three generations (F0 to F3). Sex-specific effects of TDCIPP related to synaptic transmission signaling pathways and regulation of neuronal synaptic plasticity underlying 1917 differentially expressed genes (DEGs) were evident in the brain transcriptomes of F0 females, while only five DEGs were found in F0 males. However, chronic exposure over three generations (F0 to F3) revealed neurotoxic effects of TDCIPP on both sexes with males altering their innate immune response and visual perception upon prolonged exposure. Lastly, female medaka exhibited signals of transgenerational effects at the F3, as shown by increased transcriptional adjustments of 2347 DEGs including epigenetic regulatory genes. This outcome resulted from the ancestral exposure to TDCIPP only in F0, without any direct TDCIPP exposure in F1 and F2. Our findings show that even brief exposure to TDCIPP result in long-lasting effects, posing a significant risk to marine organisms and potentially other vertebrates.

First report of natural infection by cowpea mild mottle virus on Sesbania cannabina and Physalis angulata in China.

Vigna unguiculata (L.) Walp. (cowpea) is an important economic vegetable in Sanya, Hainan Province, China. But it is easily infected by various viral diseases, especially cowpea mild mottle virus (CPMMV), bean common mosaic virus (BCMV) and cowpea polevirus 2 (CPPV2), causing symptoms such as yellowing, dwarfism and mosaic of leaves, affecting photosynthesis of cowpea. Weeds are perfect intermediate hosts for crop viruses. In the cowpea fields of Sanya, there are a large number of weeds growing nearby, including Sesbania cannabina (Retz.) Poir. and Physalis angulata (L.). S. cannabina, a species of legume, has high nutritional value as the one of the most admired green-manuring plants widely used in crop field for gaining yield and decreasing the quantity of chemical fertilizer (Tiwari et al. 2004). P. angulata, commonly known as husk tomato, is an annual Solanaceaea vegetable crop grown for its fruits (Ramakrishna Pillai et al. 2022). In July 2022, S. cannabina and P. angulata surrounding one hectare of cowpea fields of Sanya with chlorotic and asymptomatic (Figure S1) were collected, and then their total RNAs were individually extracted by the TRIzol Reagent (Life, USA), and two cDNA libraries (one including the RNA samples of S. cannabina, another including the RNA sample of P. angulata) were subsequently constructed using VAHTS Universal V8 RNA-seq Library Prep Kit (Vazyme, China). High-throughput sequencing was performed on a DNBSEQ-T7 platform (BGI, China) with the 150 bp paired-end method. A total of 40,134,299 and 149,473,308 clean reads were de novo assembled by SPAdes 3.15.5 to generate contigs, followed by BLAST-x/n search in viral genomes in GenBank. From the RNA-seq library of S. cannabina, we identified one contig (6255 nt) that exhibited 96.45% nucleotide identity to the CPMMV isolate CPMMV-JS (MT366555), covering 6033 bp out of 6255 bp (6033/6255) of the contig. Additionally, we found seven contigs (ranging in length from 1870 nt to 8336 nt) in the RNA-seq library of P. angulata that showed 78.92% to 84.15% nucleotide identity to the CPMMV isolate Brunt (OK558693), with specific alignment lengths varying from 669/795 to 4244/5337. CPMMV was verified by reverse transcription - polymerase chain reaction (RT-PCR) detection using specific primer (F: 5'-CTGGCCAAGTGGTTTGTTTT-3', R: 5'- AACCGGGTTTACAATCCACA -3') (Wei et al. 2020). PCR products were extracted from an agarose gel, cloned into the pMD19-T Vector (Takara, China), and transformed into Escherichia coli DH5α cells (Sangon Biotech, Shanghai). Two clones for each PCR product were sequenced by Sanger sequencing. The amplified 1865 bp fragments of S. cannabina (PP790744) and P. angulata (PP790743) had 98.07% identity (1727 bp out to 1761 bp) and 97.92% sequence identity (1739 bp out to 1776 bp) to CPMMV-JS (MT366555). Afterwards, we collected S. cannabina and P. angulata with similar symptoms around two cowpea fields (each field covers an area of about one hectare) in three districts of Sanya, namely Yazhou, Tianya, and Haitang, and conducted CPMMV detection. We found that CPMMV was detected in all six samples. CPMMV, including genus Carlavirus and family Betaflexiviridae, was first identified on cowpea in Ghana in the 1970s. Since then, it has been shown to have a very extensive geographical distribution and a wide natural host range. CPMMV principally infects Fabaceae, it is also able to infect hosts from Solanaceaea, Nyctaginaceae, Cleomaceae, Asteraceae and Lamiaceae (Celli et al. 2016; Lamas et al. 2017; Zanardo and Carvalho 2017). To our knowledge, this is the first report of natural infection of the S. cannabina and P. angulata by CPMMV, which may represent additional reservoirs of this virus in the region. Meanwhile, investigating CPMMV in S. cannabina and P. angulata is crucial for developing integrated strategies to prevent its transmission to economically important plants such as cowpea.

Cynometroxylon aegyptiacum n. sp. (Fabaceae-Detarioideae) from the Miocene of Egypt with palaeoclimatic and biogeographic insights

A new morphospecies of Cynometroxylon is described from the early Miocene deposits of the Gebel El-Khashab Formation exposed along the Cairo-Bahariya desert road in the north Western Desert of Egypt. It is compared with the 13 currently recognized fossil wood species of Cynometroxylon/Cynometra recorded worldwide. The characteristics of this fossil wood align with those typical of the non-seasonal tropical climate during the Miocene period, indicating its habitat at that time. This habitat is consistent with that of some living species of its analogue Cynometra. Upon reviewing the worldwide biogeography of the genus, its extensive distribution in Africa and Asia was observed. Furthermore, the biogeography of the subfamily Detarioideae was compiled, tracing its evolutionary history back to Africa. This confirms the possibility that family Fabaceae likely originated in Africa during the Late Cretaceous to early Paleogene, with subsequent dispersal into Asia and South America. The present record is indicative of a subtropical to warm tropical climate which prevailed in the Miocene of Egypt.

Characterization of microplastics in soil, leachate and groundwater at a municipal landfill in Rayong Province, Thailand

Recent years have witnessed a dramatic increase in global plastic production, leading to heightened concerns over microplastics (MPs) contamination as a significant environmental challenge. MP particles are ubiquitously distributed across both continental and marine ecosystems. Given the paucity of research on MPs in Thailand, particularly regarding MPs contamination in terrestrial environments, this study focused on investigating the distribution and characteristics of MPs in a landfill area. We collected 15 soil samples, 2 leachate samples, and 7 groundwater samples from both inside and outside a municipal landfill situated in the urbanized coastal region of Rayong Province. Our findings revealed variability in MPs concentration across different sample types. In soil, the MP count ranged from 240 to 26,100 pieces per kg of dry soil, 58.71 % of all sample sizes are lower than 0.5 mm. Similarly, the size found in the leachate sample, and the average MP in the leachate samples was 139 pieces per liter of MPs. The groundwater samples showed a fluctuation in MPs count from 18 to 94 pieces per liter, and the size of MPs ranged mostly from 0.5 to 1 mm. The predominant forms of MPs identified were sheets, followed by fragments, fibers, and granules. According to μ-FTIR analysis, the majority of the MPs were composed of polyethylene and polypropylene, commonly used in plastic packaging and ropes. The observed high concentrations and extensive distribution of MP contamination underscore the urgency for further studies and effective management strategies to mitigate the adverse impacts of this pollution on various organisms and ecosystems.

Cholecystokinin-expressing neurons of the ventromedial hypothalamic nucleus control energy homeostasis.

The hypothalamus is the primary center of the brain that regulates energy homeostasis. The ventromedial hypothalamus (VMH) plays a central role in maintaining energy balance by regulating food intake, energy expenditure, and glucose levels. However, the cellular and molecular mechanisms underlying its functions are still poorly understood. Cholecystokinin (CCK) is one of many genes expressed in this hypothalamic nucleus. Peripheral CCK regulates food intake, body weight, and glucose homeostasis. However, current research does not explain the function of CCK neurons in specific nuclei of the hypothalamus and their likely roles in network dynamics related to energy balance and food intake. This study uses genetic and pharmacological methods to examine the role of CCK-expressing neurons in the VMH (CCKVMH). Namely, using a previously generated BAC transgenic line expressing Cre recombinase under the CCK promoter, we performed targeted manipulations of CCKVMH neurons. Histological and transcriptomic database analysis revealed extensive distribution of these neurons in the VMH, with significant heterogeneity in gene expression related to energy balance, including co-expression with PACAP and somatostatin. Pharmacogenetic acute inhibition via Designer Receptors Exclusively Activated by Designer Drugs (DREADDs) resulted in increased food intake and altered meal patterns, characterized by higher meal frequency and shorter intermeal intervals. Furthermore, diphtheria toxin-mediated ablation of CCKVMH neurons led to significant weight gain and hyperphagia over time, increasing meal size and duration. These mice also exhibited impaired glucose tolerance, indicative of disrupted glucose homeostasis. Our findings underscore the integral role of CCKVMH neurons in modulating feeding behavior, energy homeostasis, and glucose regulation. This study enhances our understanding of the neurohormonal mechanisms underlying obesity and metabolic disorders, providing potential targets for therapeutic interventions.

Experimental Study on Mechanical Characteristics of Stabilized Soil with Rice Husk Carbon and Calcium Lignosulfonate.

In cold regions, the extensive distribution of silt exhibits limited applicability in engineering under freeze-thaw cycles. To address this issue, this study employed rice husk carbon and calcium lignosulfonate to stabilize silt from cold areas. The mechanical properties of the stabilized silt under freeze-thaw conditions were evaluated through unconfined compressive strength tests and triaxial shear tests. Additionally, scanning electron microscopy was utilized to analyze the mechanisms behind the stabilization. Ultimately, a damage model for rice husk carbon-calcium lignosulfonate stabilized silt was constructed based on the Weibull distribution function and Lemaitre's principle of equivalent strain. The findings indicate that as the content of rice husk carbon and calcium lignosulfonate increases, the rate of improvement in the compressive strength of the stabilized silt progressively accelerates. With an increase in the number of freeze-thaw cycles, the deviatoric stress of the stabilized soil gradually diminishes; the decline in peak deviatoric stress becomes more gradual, while the reduction in cohesion intensifies. The decrease in the angle of internal friction is relatively minor. Microscopic examinations reveal that as the number of freeze-thaw cycles increases, the soil pores tend to enlarge and multiply. The established damage model for stabilized silt under freeze-thaw cycles and applied loads demonstrates a similar pattern between the experimental and theoretical curves under four different confining pressures, reflecting an initial rapid increase followed by a steady trend. Thus, it is evident that the damage model for stabilized silt under freeze-thaw conditions outperforms traditional constitutive models, offering a more accurate depiction of the experimental variations observed.

Using eDNA Sampling to Identify Correlates of Species Occupancy Across Broad Spatial Scales

ABSTRACTAimSpecies presence–absence data can be time‐consuming and logistically difficult to obtain across large spatial extents. Yet these data are important for ensuring changes in species distributions are accurately monitored and are vital for ensuring appropriate conservation actions are undertaken. Here, we demonstrate how environmental DNA (eDNA) sampling can be used to systematically collect species occupancy data rapidly and efficiently across vast spatial domains to improve understanding of factors influencing species distributions.LocationSouth‐eastern Australia.MethodsWe use a widely distributed, but near‐threatened species, the platypus (Ornithorhynchus anatinus), as a test case and undertake an environmentally stratified systematic survey to assess the presence–absence of platypus eDNA at 504 sites across 584,292 km2 of south‐eastern Australia, representing ~37% of the species' extensive distribution. Site occupancy‐detection models were used to analyse how landscape‐ and site‐level factors affect platypus occupancy, enabling us to incorporate uncertainty at the different levels inherent in eDNA sampling (site, water sample replicate and qPCR replicate).ResultsPlatypus eDNA was detected at 272 sites (~54%) with platypuses more likely to occupy sites in catchments with increased runoff and less zero‐flow days, and sites with access to banks suitable for burrowing. Platypuses were less likely to occupy sites in catchments with a high proportion of shrubs and grasslands, or agricultural land use.Main ConclusionsThese data provide an important large‐scale validation of the landscape‐ and site‐level factors influencing platypus occupancy that can be used to inform future conservation efforts. Our case study shows that systematically designed, stratified eDNA surveys provide an efficient means to understand how environmental characteristics affect species occupancy across broad environmental gradients. The methods employed here can be applied to aquatic and semi‐aquatic species globally, providing unprecedented opportunities to understand biodiversity status and change and provide insights for current and future conservation actions.

Changing climate intensifies downstream eutrophication by enhancing nitrogen availability from tropical forests

The contribution of diffuse nutrient exports from forests to downstream water bodies is significant owing to their extensive spatial distribution across watersheds. However, the intricacies of coupling mechanism between diffuse nutrient exports and meteorological factors driving downstream eutrophication remain poorly understood. Multiple methods involving field sampling, laboratory analysis, and model simulation were utilized to investigate the impact of diffuse nutrient exports from tropical forests on chlorophyll a concentration dynamic in the downstream reservoir. A strong positive correlation was observed between air temperature and chlorophyll a concentration, indicating the direct influence of climatic factors on microalgal biomass. The significant positive linear relationship was also observed between diffuse nitrate exports and chlorophyll a concentration, with a regression coefficient of 0.36 (P < 0.001), underscoring the role of nitrogen inputs in stimulating microalgal growth. The interplay between diffuse nitrate exports and meteorological factors was shown to regulate chlorophyll a concentration fluctuation. Additionally, the structural equation model revealed that increasing temperature and decreasing precipitation could elevate chlorophyll a concentration by enhancing nitrogen availability. Monte Carlo simulation results further revealed that temperature and precipitation were the most influential factors affecting chlorophyll a concentration during dry and rainy seasons, with sensitivity values of 0.94 and − 0.76, respectively. Notably, the eutrophication status was projected to deteriorate from light to moderate under diminishing precipitation conditions. These findings underscore the urgency of addressing eutrophication risks in reservoirs surrounded by tropical forests and the implementation of effective nitrate mitigation strategies is imperative, which offers theoretical guidance for the management of eutrophic water restoration within tropical rainforest regions under changing climate conditions.

Sulfide trace element enrichments in the metamorphic basement-hosted Xinhua Pb-Zn-Cu vein-type deposit, eastern Guizhou province (SW China)

Cambrian carbonate formations are widespread in the western Hunan-eastern Guizhou region (southwestern China), which hosts many Mississippi Valley-Type (MVT) lead–zinc (Pb-Zn) deposits. Regional Pb-Zn mineralization is well developed in the low-grade metamorphic rocks of the basal Proterozoic Banxi Group. The mineralization is associated with quartz veins and generally distributed along NE-trending fault zones. Moreover, these deposits have an extensive distribution and high grade, and are associated with Cu-Ag endowment. However, geological and geochemical research on these Pb-Zn vein-type deposits is relatively limited, and their relationship with the regional MVT mineralization remains unclear. The representative Xinhua deposit in Danzhai district is selected as the study subject. We conducted in situ trace element analyses on the sphalerite and chalcopyrite from the various metallogenic stages, and compared them with published sphalerite trace element data from the MVT Pb-Zn deposits in the western Hunan-eastern Guizhou metallogenic belt. Seven orebodies in Xinhua Pb-Zn deposit have been discovered so far, with a metal resource of over 120,000 metric tonnes of Zn + Pb. Field geology and microscopic petrography have revealed two mineralization stages: An early-stage black sphalerite (Sp-I) followed by reddish-brown sphalerite (Sp-II) mineralization, which corresponds to the main chalcopyrite mineralization stage, and a later-stage light-yellow sphalerite (Sp-III), Cu ore-barren mineralization.LA-ICPMS data indicate that the sphalerite from Xinhua has similar trace element compositions to those from the MVT Pb-Zn deposits in the region. They are relatively enriched in Ga, Cd, and Ge, while depleted in Fe, Co, and Mn. Critical metal Ge and Ga are particularly enriched in sphalerite, especially in Sp-I (Ge max 937 ppm, Ga max 824 ppm). The substitution mechanism of Ge and Ga in sphalerite are likely 2Cu+ + Ge4+ ↔ 3Zn2+ and Cu+ + Ga3+ ↔ 2Zn2+. Indium and Sn are mainly present in Sp-I and Sp-III. Chalcopyrite contains Zn and Sn both exceeding 100 ppm. Contents of Se, Ag, In, and Sn in chalcopyrite are significantly higher than those in sphalerite. Calculation of the sphalerite trace element geothermometer (GGIMFis) suggests that the average sphalerite ore-forming temperatures are 164 °C (Sp-I), 156 °C (Sp-II), and 205 °C (Sp-III), implying medium- to low-temperature mineralization. This indicates a possible influx of high-temperature, in-bearing fluid during the late-stage mineralization.In summary, the faults-controlled vein-type Pb-Zn deposits (e.g., Xinhua) may have been products of the same Kwangsian orogeny as other strata bound MVT deposits, and the Xinhua deposit features two mineralization stages with multiple ore metal sources. During the ore-forming fluid ascent, some ore-forming materials may have precipitated in the fluid conduits. And exposed after the erosion of the shallower stratiform orebodies and strata. Consequently, the Xinhua Pb-Zn deposit represents the preserved ore-fluid conduit phase (in the basement strata) of the MVT mineralization.

Pharmacological activity, phytochemistry, and organ protection of lithospermic acid.

Lithospermic acid (LA) is a water-soluble phenolic acid compound extracted and separated from the dried root and the rhizome of Salviamiltiorrhiza Bge (Labiatae), possessing multiple biological activities. Firstly, in terms of pharmacological activities, LA has been proven to possess anti-inflammatory, antioxidant, autophagy activation, and antiapoptotic properties. Secondly, the pharmacokinetic characteristics of LA show rapid and extensive distribution in various tissues after intravenous administration, followed by rapid elimination and excretion. Additionally, potential therapeutic effects of LA have been found in various diseases such as thrombosis, Parkinson's disease, hepatitis B, diabetes, and psoriasis, among others. Particularly, LA has shown promising prospects in the treatment of clinical heart diseases and has been included in new drug formulations for the treatment of chronic angina, demonstrating superior efficacy compared to current cardiovascular drugs. In conclusion, this review comprehensively introduces the pharmacological mechanisms, pharmacokinetics, and protective effects in diseases of LA. These information can lay a theoretical foundation for the future development and new clinical applications of LA.

Analisis Perusahaan PT Garuda Food Putra Putri Jaya Tbk

This study aims to analyze the company's strategy of PT Garuda Food Putra Putri Jaya Tbk in facing the dynamics of the food and beverage industry in Indonesia. Using matrix analysis methods such as SPACE, BCG, IE, and Grand Strategy Matrix, the study found that companies implement aggressive strategies that take advantage of internal strengths such as product diversification and extensive distribution networks. In addition, the company is also taking advantage of the industry's growth and increasing consumer awareness of health. The results of the study also show the importance of risk management faced by companies. Strategy recommendations include vertical integration, market development, and product development, in order to strengthen the company's position and achieve sustainable growth in a competitive market.

Distribution extension of a vent scale worm Branchinotoglumabipapillata (Polychaeta, Polynoidae) in the Indian Ocean.

Branchinotogluma Pettibone, 1985 is the most species-rich genus within the subfamily Lepidonotopodinae Pettibone, 1983, comprising 18 valid species from chemosynthesis-based ecosystems in the Pacific and Indian Oceans. Here, we report a new distributional record of Branchinotoglumabipapillata Zhou, Wang, Zhang & Wang, 2018, at the hydrothermal vent sites on the northern Central Indian Ridge (nCIR). This record represents the northernmost occurrence of B.bipapillata in the Indian Ocean. We conducted a comparative study of the nCIR population and other documented populations using distributional information, morphological traits, and genetic markers (two mitochondrial [COI, 16S rRNA] and one nuclear [18S rRNA] genes). While most morphological characters of B.bipapillata were consistent with those found in the Southwest Indian Ridge (SWIR), variations were noted in the segment with the last branchiae. Molecular data revealed that all populations of B.bipapillata form a single clade, indicating a wide distribution from the SWIR to nCIR, covering ~4,000 km across various ridges in the Indian Ocean. This study presents extensive distribution of a vent species with well-connected populations throughout the Indian Ocean, distinguishing it from many other vent species affected by the dispersal barrier in the Indian Ocean.

Spatial–Temporal Patterns in the Enteric Pathogen Contamination of Soil in the Public Environments of Low- and Middle-Income Neighborhoods in Nairobi, Kenya

Public spaces in countries with limited societal development can be contaminated with feces containing pathogenic microbes from animals and people. Data on contamination levels, spatial distribution, and the diversity of enteric pathogens in the public settings of low- and middle-income neighborhoods are crucial for devising strategies that minimize the enteric infection burden. The objective of this study was to compare spatial–temporal differences in the detection rate and diversity of enteric pathogens in the public spaces of low- and middle-income neighborhoods of Nairobi, Kenya. TaqMan array card (TAC) molecular assays were employed to analyze soil samples for 19 enteropathogens, along with a selective bacterial culture for pathogenic Enterobacteriaceae. An observational assessment was conducted during every site visit to document the hygienic infrastructure and sanitation conditions at the sites. We detected at least one pathogen in 79% (127/160) and ≥2 pathogens in 67.5% (108/160) of the soil samples tested. The four most frequently detected pathogens were EAEC (67.5%), ETEC (59%), EPEC (57.5%), and STEC (31%). The detection rate (91% vs. 66%) and mean number of enteric pathogens (5 vs. 4.7) were higher in low-income Kibera than in middle-income Jericho. The more extensive spatial distribution of pathogens in Kibera resulted in increases in the detection of different enteric pathogens from within-site (area &lt; 50 m2) and across-site (across-neighborhood) movements compared to Jericho. The pathogen detection rates fluctuated seasonally in Jericho but remained at sustained high levels in Kibera. While better neighborhood conditions were linked with lower pathogen detection rates, pathogenic E. coli remained prevalent in the public environment across both neighborhoods. Future studies should focus on identifying how the sources of pathogen contamination are modified by improved environmental sanitation and hygiene and the role of these contaminated public environments in enteric infections in children.

Genetic architectures of the human hippocampus and those involved in neuropsychiatric traits

BackgroundThe hippocampus, with its complex subfields, is linked to numerous neuropsychiatric traits. While most research has focused on its global structure or a few specific subfields, a comprehensive analysis of hippocampal substructures and their genetic correlations across a wide range of neuropsychiatric traits remains underexplored. Given the hippocampus’s high heritability, considering hippocampal and subfield volumes (HASV) as endophenotypes for neuropsychiatric conditions is essential.MethodsWe analyzed MRI-derived volumetric data of hippocampal and subfield structures from 41,525 UK Biobank participants. Genome-wide association studies (GWAS) on 24 HASV traits were conducted, followed by genetic correlation, overlap, and Mendelian randomization (MR) analyses with 10 common neuropsychiatric traits. Polygenic risk scores (PRS) based on HASV traits were also evaluated for predicting these traits.ResultsOur analysis identified 352 independent genetic variants surpassing a significance threshold of 2.1 × 10−9 within the 24 HASV traits, located across 93 chromosomal regions. Notably, the regions 12q14.3, 17q21.31, 12q24.22, 6q21, 9q33.1, 6q25.1, and 2q24.2 were found to influence multiple HASVs. Gene set analysis revealed enrichment of neural differentiation and signaling pathways, as well as protein binding and degradation. Of 240 HASV-neuropsychiatric trait pairs, 75 demonstrated significant genetic correlations (P < 0.05/240), revealing 433 pleiotropic loci. Particularly, genes like ACBD4, ARHGAP27, KANSL1, MAPT, ARL17A, and ARL17B were involved in over 50 HASV-neuropsychiatric pairs. Leveraging Mendelian randomization analysis, we further confirmed that atrophy in the left hippocampus, right hippocampus, right hippocampal body, and right CA1-3 region were associated with an increased risk of developing Parkinson’s disease (PD). Furthermore, PRS for all four HASVs were significantly linked to a higher risk of Parkinson’s disease (PD), with the highest hazard ratio (HR) of 1.30 (95% CI 1.18–1.43, P = 6.15 × 10⁻⁸) for right hippocampal volume.ConclusionsThese findings highlight the extensive distribution of pleiotropic genetic determinants between HASVs and neuropsychiatric traits. Moreover, they suggest a significant potential for effectively managing and intervening in these diseases during their early stages.

Mitochondrial data unravels the human-mediated introduction of Mediodactylus kotschyi (Squamata: Gekkonidae) to the Central Balkan Peninsula

Abstract Kotschy’s gecko, Mediodactylus kotschyi, is native to the Eastern part of the Mediterranean Basin and a successful colonizer, with an extensive distribution across the Balkans and outside its native range. In Serbia, it was presumed native in Prizren (Kosovo and Metohija province) and introduced across the remaining territory. To explore the origin of Serbian Kotschy’s gecko, we collected specimens from most of the Serbian populations where the species was recorded and assessed their phylogenetic relationships based on three mtDNA markers (COI, cytb, 16S rRNA) under Maximum Likelihood (ML) and Bayesian Inference (BI) approaches. First, our results support that the specimens found in Serbia belong to M. kotschyi. Second, all populations except Prizren belong to the subspecies M. kotschyi skopjensis. Furthermore, the Italian populations are sister to the specimens from Prizren, suggesting a Balkan origin for these populations, which settled in Apulia likely through ancient human-mediated dispersion. The small genetic differentiation found suggests that Kotschy’s gecko rapidly colonized the Central Balkans, originating from Northern Greece and North Macedonia. The results also suggest a story of multiple, complex (most likely) human-mediated introductions. However, further studies should be conducted to properly elucidate the colonization pathways, and to truly disentangle the potential fast natural range expansion from an anthropogenic dispersion of this gecko species.

About the origin and environment of Panthera spelaea (Goldfuss, 1810)

Current phylogenies focus on the phyletic relationships between sister taxa of species, but none point to an ancestral species that gave rise to Panthera spelaea. The knowledge of its origins is progressing, but the question remains of whether this ancestral form is Eurasian or African, and at what period in the Plio-Pleistocene the divergence may have taken place. In this collective work on Panthera spelaea, the Eurasian species par excellence, the question of whether Panthera gombaszogensis may have evolved into Panthera spelaea is once again raised and examined in the light of current data. In the absence of decisive new data, it may be useful to reverse the problem and start from hypotheses. The environment plays a fundamental role in the evolution of species, and the hypothesis adopted must necessarily take this into account. Panthera gombaszogensis morphology, extensive distribution, and great adaptability to a variety of ecosystems suggest that it is a potential Eurasian ancestor of the cave lion. Chronology, whose role remains decisive, makes this possible.

Advanced exploration of rare metal mineralization through integrated remote sensing and geophysical analysis of structurally-controlled hydrothermal alterations

Fusing multi-source (remote sensing and geophysical) data and diverse approaches validation in targeting hydrothermal alteration and structural anomalies enhances the potential for accurately detecting and characterizing mineralization zones. Sentinel 2 data and ASTER were processed for lithological and hydrothermal alteration mapping in the rare metal-rich Umm Naggat area (Egypt). Different image processing techniques were implemented, including false color composites, minimum noise fraction, band rationing, band math, mineral indices, relative absorption band depth, and constrained energy minimization. The rare metal-bearing Umm Naggat younger granite (NYG) pluton was lithologically discriminated and intra-differentiated to mafic-rich biotite granites, mafic-poor alkali feldspar granites, and albitized granites. Extensive hydrothermal alterations, such as albitization, ferrugination, propylitization, argillization, and phyllitization, overprint the NYG pluton. Normalized standard deviation, automatic lineament extractions, and trend analysis highlighted the key structural directions (NW, NNW, NNE, and NE) and distinguished the NYG pluton as a moderate to high structural density zone. The high structural density and intensive alteration zones are spatially associated and more localized within the NYG pluton than the surrounding rocks. Spatial overlay analysis confirmed that the hydrothermal alterations and fluid circulation systems are structurally-controlled. Furthermore, the hydrothermal alteration mapping and structural analysis outcomes were verified by combining fieldwork, slab polishing, petrographic investigations, and mineral chemistry through semi-quantitative scanning electron microscopy with energy dispersive spectroscopy (SEM-EDS) and quantitative electron probe microanalysis (EPMA) analysis. As a result, the hydrothermal genesis of rare metal-bearing minerals (Nb-rutile, Nb-ilmenite, and columbite) close to or incorporated within alteration minerals (chlorite, muscovite, and hematite) is confirmed from the alteration zones (propylitic, phyllic, and ferruginated). In addition, biotite muscovitization and chloritization significantly contribute to the secondary rare metal enrichment. The current study emphasizes the extensive distribution of secondary rare metal-bearing minerals within the entire NYG pluton (not only limited to the northern albitized granite as depicted by previous studies), which might shed light on these hydrothermally-altered younger granites as a new potential source for Nb and Ta in Egypt.

Intoxicação por &lt;i&gt;Palicourea marcgravii&lt;/i&gt; em bovinos no Brasil

Palicourea marcgravii is considered the most important toxic plant that causes sudden death in cattle in Brazil, due to its extensive national distribution, high toxicity, good palatability and cumulative effect, being responsible for deaths and economic losses in Brazilian livestock every year. Its active toxic principle is monofluoroacetic acid which inhibits the Krebs cycle, interrupting the metabolism of carbohydrates, fats and proteins. There´s not treatment for the poisoning due to its superacute progression, and prevention is based on the construction of fences around forested areas, cutting access to the plants.