OCT4 Protein Expression Research Articles

Identification of the proliferative activity of germline progenitor cells in the adult ovary of the bat Artibeus jamaicensis.

Until a few years ago, it was assumed that oocyte renewal did not take place in the ovary of adult organisms; however, the existence of germline progenitor cells (GPCs), which renew the ovarian follicular reserve, has now been documented in mammals. Specifically, in the adult ovary of bats, the presence of cells located in the cortical region with characteristics similar to GPCs, called adult cortical germ cells (ACGC), has been observed. One of the requirements that a GPC must fulfil is to be able to proliferate mitotically, so the evaluation of cell proliferation in ACGC is of utmost importance in order to be able to relate them to a parental lineage. Currently, there are several methods to determine cell proliferation, including BrdU labelling or the use of endogenous proliferation markers. Thus, the aim of this work was to evaluate the proliferative activity of ACGC in the adult ovary of the bat Artibeus jamaicensis, using different proliferation markers and correlating these with the protein expression of the transcription factor Oct4 and the germ line marker Ddx4. We found that the expression pattern of the proliferation markers BrdU, PCNA, Ki-67 and pH3 occurs at different times of the cell cycle, so co-localization of two or more of these markers allows us to identify proliferating cells. This allowed us to identify ACGC with proliferative capacity in the adult ovary of A. jamaicensis, suggesting that GPCs renew the follicle reserve during the adult life of the organism.

Interference of FZD2 suppresses proliferation, vasculogenic mimicry and stemness in glioma cells via blocking the Notch/NF‑κB signaling pathway.

Frizzled family protein 2 (FZD2) is widely associated with tumor development and metastasis. The present study aimed to gain an insight into the role and regulatory mechanism of FZD2 in glioma. The expression level of FZD2 in normal astrocyte and glioma cells was determined by reverse transcription-quantitative PCR and western blotting, and cell transfection was conducted for FZD2 expression knockdown. Malignant behaviors including cell proliferation, migration and invasion, vasculogenic mimicry (VM) and cell stemness were determined using Cell Counting Kit-8, 5-Ethynyl-2'-deoxyuridine (EdU) staining, colony formation, wound healing, Transwell, 3D culturing and sphere formation assays. The expression levels of proteins related to stemness, epithelial-mesenchymal transition (EMT) and Notch/NF-κB signaling were measured by western blotting. Then, the Notch agonist, Jagged-1 (JAG), was adopted for rescue experiments. The results demonstrated that FZD2 was highly expressed in glioma cells. Interference of FZD2 expression suppressed the proliferation of glioma cells, as evidenced by the reduced cell viability and the number of EdU+ cells and colonies. Meanwhile, the reduced sphere formation ability and decreased protein expression of Nanog, Sox2 and Oct4 following FZD2 knockdown confirmed that FZD2 repressed cell stemness in glioma. Additionally, FZD2 knockdown suppressed the migration, invasion, EMT and VM formation capabilities of glioma cells, and also blocked the Notch/NF-κB signaling pathway. Furthermore, activation of Notch by JAG treatment partially reversed the aforementioned FZD2 knockdown-mediated changes in glioma cell malignant behaviors. In conclusion, FZD2 may contribute to glioma progression through activating the Notch/NF-κB signaling pathway, providing a plausible therapeutic target for the treatment of glioma.

Oxidative stress and regulation of adipogenic differentiation capacity by sirtuins in adipose stem cells derived from female patients of advancing age

Patient age is critical for mesenchymal stem cell quality and differentiation capacity. We demonstrate that proliferation and adipogenic capacity of subcutaneous adipose stem cells (ASCs) from female patients declined with advanced age, associated with reduction in cell nucleus size, increase in nuclear lamina protein lamin B1/B2, and lamin A, upregulation of senescence marker p16INK4a and senescence-associated β-galactosidase activity. Adipogenic induction resulted in differentiation of adipocytes and upregulation of adipogenic genes CCAAT enhancer binding protein alpha, fatty acid binding protein 4, lipoprotein lipase, and peroxisome proliferator-activated receptor-γ, which was not affected by the Sirt-1 activator YK-3-237 or the Sirt-1 inhibitor EX-527. Protein expression of the stem cell markers Oct4 and Sox2 was not significantly downregulated with advanced patient age. Mitochondrial reactive oxygen species were increased in ASCs from old-aged patients, whereas protein expression of NADPH oxidases NOX1 and NOX4 was downregulated, and dual oxidase isoforms remained unchanged. Generation of nitric oxide and iNOS expression was downregulated. Protein expression of Sirt-1 and Sirt-3 decreased with patient age, whereas Sirt-2 and Sirt-5 remained unchanged. Induction of adipogenesis stimulated protein expression of Sirt-1 and Sirt-3, which was not affected upon pre-incubation with the Sirt-1-activator YK-3-237 or the Sirt-1-inhibitor EX-527. The Sirt-1 inhibitor Sirtinol downregulated adiponectin protein expression and the number of adipocytes, whereas YK-3-237 exerted stimulatory effects. In summary, our data demonstrate increased oxidative stress in ASCs of aging patients, and decline of adipogenic capacity due to Sirt-1- mediated adiponectin downregulation in elderly patients.

201 Clear Cell Meningioma Tumorigenesis Is Characterized by Expression of Human Endogenous Retroviruses

INTRODUCTION: Human endogenous retroviruses (HERVs) are transcriptionally silenced genetic remnants of ancient exogenous retroviruses in differentiated cells yet critical to early tissue development. We recently found that aberrant expression of HERV-K envelope protein, caused by SMARCB1 mutation, is critical for tumorigenesis in atypical teratoid rhabdoid tumor (AT/RT). Clear cell meningioma (CCM) demonstrates analogous altered chromatin remodeling via SMARCE1 loss of function and syncytial histopathologic features thereby indicating a putative role for HERV expression in CCM tumorigenesis. METHODS: Eight CCM samples were evaluated for SMARCE1 status. We then quantified expression of HERV-K envelope and OCT-4 protein, a marker of pluripotency, by immunohistochemistry and compared them using linear regression. Active HERV transcript production was evaluated by RNA in-situ hybridization. Finally, we induced SMARCE1 loss in neural stem cells (NSC’s) and assessed expression of multiple HERV transcripts. We further modeled SMARCE1 knock-down in vivo in a chicken embryo model to evaluate timing of aberrant HERV expression and CCM development. RESULTS: All CCM tumor samples demonstrated loss of SMARCE1 and expression of HERV-K-Env and OCT-4 proteins and HERV transcripts. Expression was more robust in syncytial tumor-initiating cells and surrounding extracellular vesicles. HERV-K-Env expression positively correlated with OCT-4 expression (Pearson’s R = 0.7461, p = 0.033). Finally, SMARCE1 knock-down in NSC's and chicken embryos resulted in expression of multiple HERVs, supporting SMARCE1 loss of function as the mechanism of increased HERV expression in our CCM cohort. CONCLUSIONS: As mediated by loss of SMARCE1 function, HERV transcription allows for pathogenic exportation of HERV proteins to surrounding cells to maintain pluripotency in both in vitro and in vivo models. Aberrant HERV expression may therefore represent a targetable anticancer pathway for CCM and similar CNS tumors.

Toxic effect and mechanism of Tripterygium glycosides on ovarian germline stem cells of mice in vitro by Notch signaling pathway

The ovarian germline stem cells(OGSCs) cultured in the optimized culture system were used as the research object to observe the effect of Tripterygium glycosides(TG) on OGSCs and explore the mechanism of reproductive toxicity by the Notch signaling pathway. Cell counting kit-8(CCK-8) was used to observe the viability level of OGSCs in mice cultured in vitro by TG of 3.75, 7.5, and 15 μg·mL~(-1). Immunofluorescence technology and reverse transcription-polymerase chain reaction(RT-PCR) were used to detect the protein and gene expression level of OGSCs marker mouse vasa homologue(MVH) and octamer-binding transcription factor 4(Oct4) by TG of 3.75 μg·mL~(-1). RT-PCR detected the gene expression of neurogenic locus Notch homolog protein 1(Notch1), Hes family BHLH transcription factor 1(Hes1), and jagged canonical Notch ligand 1(Jagged1). The RNA was extracted for transcriptome analysis to analyze the mechanism of action of TG intervention on OGSCs. 3.75 μg·mL~(-1) of TG was combined with 40 ng·mL~(-1) Notch signaling pathway γ-secretagocin agonist jagged canonical notch ligand(Jagged) for administration. CCK-8 was used to detect the viability level of OGSCs. Double immunofluorescence technology was used to detect the protein co-expression of MVH with Hes1, Notch1, and Jagged1. The results showed that compared with the blank group, the TG administration group significantly inhibited the activity of OGSCs(P<0.01 or P<0.001). It could reduce the protein and gene expression of OGSC markers, namely MVH and Oct4(P<0.05, P<0.01, or P<0.001). It could significantly inhibit the gene expression of Notch1, Hes1, and Jagged1(P<0.001). Transcriptomic analysis showed that TG affected the growth and proliferation of OGSCs by intervening Jagged1, a ligand associated with the Notch signaling pathway. The experimental results showed that the combination of Notch signaling pathway γ-secretagorein agonist Jagged could significantly alleviate the decrease in OGSC viability induced by TG(P<0.001) and significantly increased the OGSC viability compared with the TG group(P<0.001). It also could significantly increase the co-expression of MVH/Jagged1, MVH/Hes1, and MVH/Notch1 proteins(P<0.01 or P<0.001). It suggested that TG play the role of γ-secretagorease inhibitors by downregulating the OGSC markers including MVH and Oct4 and Notch signaling pathway molecules such as Notch1, Hes1, and Jagged1, participate in the OGSC pathway, and mediate reproductive toxicity caused by the Notch signaling pathway.

Downregulated circRNA_CDKN1A promotes gallbladder cancer progression through activation of the NF-κB pathway.

This study uncovered the potential clinical value and molecular driving mechanisms of circular RNAs (circRNAs) in gallbladder cancer (GBC). Differentially expressed circRNAs in GBC cells were screened by high-throughput sequencing. CircRNA_CDKN1A (circBase ID: hsa_circ_0076194) was knocked out in BGC-SD cells through transfection with sh-circRNA_CDKN1A. Then, proliferation was investigated via CCK8 and EdU assays, apoptosis via flow cytometry, migration via wound healing assays, and invasion via Transwell assays. Bioinformatics analysis of circRNA_CDKN1A-related signaling pathways was performed using MetScape and g:Profiler. Results showed that the knockdown of circRNA_CDKN1A enhanced the proliferation, migration, and invasion of GBC cells and inhibited apoptosis. In addition, knocking out circRNA_CDKN1A promoted GBC cell proliferation and enhanced the dry indices of the OCT4 protein and CD34 expression levels. The knockdown of circRNA_CDKN1A activated the epithelial-mesenchymal transition pathway. Bioinformatics analysis revealed that the biological role of circRNA_CDKN1A in GBC cells involved the NF-κB pathway. LY2409881, which is an NF-κB inhibitor, reversed the effects induced by the knockdown of circRNA_CDKN1A in GBC-SD cells. In summary, the knockdown of circRNA_CDKN1A promoted the progression of GBC by activating the NF-κB signaling pathway. For the first time, this study revealed the mechanism of circRNA_CDKN1A-mediated regulatory action in GBC and identified the newly discovered circRNA_CDKN1A-NF-κB signaling axis as a potentially important candidate for clinical therapy and prognostic diagnosis of GBC.

Stimulating effect of nanocurcumin and crocin on proliferation and pluripotency of bone marrow-derived mesenchymal stem cells.

Enhancement of proliferation, pluripotency, and self-renewal capacity as the unique features of MSCs can improve their therapeutic potential to regenerate tissues. In this context, crocin and curcumin, carotenoid compounds with outstanding medicinal properties, could be promising for cell protection and growth. This study aimed to evaluate the impact of nanocurcumin and crocin on BM-MSCs proliferation and pluripotency in vitro. BM-MSC were isolated from the iliac crest of SCI patients who were candidates for stem cell therapy. The effect of crocin and nanocurcumin on MSC proliferation was evaluated using MTT and PDT assay. The percentage of apoptotic MSCs was measured by flow cytometry. Furthermore, mRNA and protein expression of OCT4 and SOX2 as the proliferation and self-renewal related genes were quantified by real-time PCR and western blotting, respectively. Our findings demonstrated that only low concentrations of nanocurcumin (0.3 and 0.7 µM) and crocin (2.5 5 µM) significantly affected MSCs proliferation and protected them from apoptosis. Also, crocin and nanocurcumin at low doses caused an elevation in the mRNA and protein expression levels of OCT4 and SOX2 genes. In contrast, high concentrations decreased the survival of MSCs and led to increased apoptosis compared with the untreated group. Our results suggest that using nanocurcumin and crocin separately in culturing MSCs can be considered proliferative agents to prepare the more advantageous tool for cell therapies. However, more in vitro and preclinical research is needed in this area.

Effects of Topoisomerase II alpha Inhibition on Oral Cancer Cell Metabolism and Cancer Stem Cell Function.

Topoisomerase IIα (TOP2A), is an enzyme involved in DNA replication, transcription, recombination, and chromatin remodeling and is found in a variety of cancers. However, the role of TOP2A regulation in oral cancer progression is not fully explained. We investigated the effect of TOP2A inhibition on cell survival, metabolism, and cancer stem cell self-renewal function in oral cancer cells. Oral carcinoma cell line SCC25 was cultured in complete DMEM/F12 media and treated with 5μM of Etoposide (Topoisomerase II inhibitor) for 48h. The critical parameters of cellular metabolism, including extracellular acidification rate (ECAR) and mitochondrial oxidative phosphorylation based on the oxygen consumption rate of cancer cells were assessed using Seahorse assay. Western blotting was performed to assess the proteins that are associated with proliferation (Survivin, IL-6) and cancer stem cell function (Oct4, Sox2) in cell lysates prepared from control and etoposide treated groups. Statistical analysis was performed using One-way ANOVA with Dunnett's multiple comparisons test. The protein expression of TOP2A was significantly (P<0.05) inhibited by etoposide. Additionally, TOP2A inhibition decreased the mitochondrial respiratory parameters including basal respiration, maximal respiration and ATP production. However, TOP2A inhibition has no impact on glycolytic function. Moreover, the proliferative marker survivin and IL-6 showed a significant (P<0.05) decrease after TOP2A inhibition. Conversely, the protein expression of cancer stem cell markers Oct-4 and Sox 2 were not altered. These results indicate that inhibition of TOP2A is more efficacious by decreasing the mitochondrial metabolic reprogramming and thereby downregulating the key anti-apoptotic and pro-survival mediators. Thus, TOP2A represents an ideal therapeutic target and offers a potential treatment strategy for OSCC.

Mesenchymal Stem Cell-Derived Extracellular Vesicles Increase Human MCF7 Breast Cancer Cell Proliferation associated with OCT4 Expression and ALDH Activity.

The aim of this study was to investigate the effect of mesenchymal stem cells-derived extracellular vesicles (MSC-EVs) on the human MCF7 breast cancer cell proliferation that have been considered to contain limited CSC population and its association with the expression of OCT4 and ALDH1 stemness markers. EVs were successfully isolated from the conditioned medium of umbilical cord MSCs using size exclusion chromatography. The isolated EV fraction was verified under a transmission electron microscope (TEM). Five and ten percent (v/v) concentration of MSC-EVs were then co-cultured with MCF7 cells. To investigate MSC-EV uptake by MCF7 cells, we performed confocal microscopy analysis. Subsequently, the proliferation of co-cultured MCF7 cells was determined using trypan blue exclusion assay, while their mRNA and protein expression of OCT4 as well as ALDH activity as the marker of stemness properties were analyzed using quantitative reverse transcription polymerase chain reaction, Western Blot, and Aldefluor™ assays, respectively. MSC-EVs were detected as round-shaped, ~100 nm sized particles under TEM. We also demonstrate that MSC-EVs can be internalized by MCF7 cells. Notably, MSC-EVs of 5% concentration increased OCT4 mRNA expression and ALDH1 activity in MCF7 cells. At 10% concentration, MSC-EVs reduced the OCT4 expression and ALDH1 activity. MSC-derived EVs modulate the stemness of MCF7 cells, either OCT4 expression or ALDH1 activity, in a concentration dependent manner along with the increase of cell proliferation.

High OCT4 Expression Might Be Associated with an Aggressive Phenotype in Rectal Cancer.

Rectal cancer (RC) is one of the most common malignant neoplasms, and cancer stem cells (CSCs) of the intestinal tract have been implicated in its origin. The oncofetal protein OCT4 has been linked to neoplastic processes, but its role and clinical significance in RC are unknown. This study investigates the expression of the stem cell marker OCT4 related to clinical-pathological characteristics and its clinical significance in RC patients. The expression level of stem cell marker OCT4 was analyzed in 22 primary rectal tumors by western blot. The association between OCT4 protein expression and the clinical-pathological features of tumors was evaluated by χ2 test and Fisher's exact test. We demonstrated that the expression of the stem cell marker OCT4 was observed in tumor tissue but not adjacent non-tumor tissue. High expression of the stem cell marker OCT4 was significantly associated with histological differentiation grade (p = 0.039), tumor invasion level (p = 0.004), lymph node involvement (p = 0.044), tumor-node-metastasis (TNM) stage (p = 0.002), and clinical stage (p = 0.021). These findings suggest that high OCT4 expression is associated with a more aggressive RC phenotype, with a greater likelihood of progression and metastasis. These results shed light on the importance of targeting this CSC marker to attenuate RC progression.

P-540 Improper placentation due to skewed Oct4-Cdx2 expression may be a leading factor in idiopathic recurrent pregnancy loss (RPL) cases from Assam, India.

Abstract Study question Does the differential expression of key embryonic stem cell (ESC) markers due to upstream signaling cascade(s) deregulation influence RPL pathogenesis in the studied population? Summary answer Imbalanced Oct4-Cdx2 expression linked differential ESCs polarization due to β-catenin signaling deregulation during the peri-implantation period impacts RPL pathogenesis in the studied population. What is known already RPL affects approximately 2-5% of women globally and around 7% Indian women in reproductive age group; with 50% of case etiology being unclear. Proper placentation is indispensable for establishment, continuation, and success of a pregnancy; and it depends largely on a healthy balance between apoptosis and stem cell differentiation that aids proper trophoblast invasion. These differentiation events are tightly controlled by the interplay of oxygen tension, hormones, growth factors, other signaling molecules and most importantly by transcription factors including those deciding the stem cell lineage like Oct4, NANOG, and Cdx2, wherein, β-catenin is known to enhance Oct-4 activity in ESCs. Study design, size, duration The sample size was predicted using Raosoft software utilizing the prevalence rate of RPL. Overall 87 women with 2 or more pregnancy losses before completion of 20 weeks of gestation were enrolled as RPL cases with informed consent, whereas, for the control group, 107 women volunteers undergoing medical termination of pregnancy (MTP) were enrolled as gestation-week-matched comparative study group for experimental data analysis. Participants/materials, setting, methods Products of conception (POC) was collected from the MTP and RPL cases. POCs were collected in 2vials for every subject: (i) 4% buffered formalin for fixation and preparation of microscopic slides for immunofluorescence (IF) based protein expression of Oct4 and Cdx2; (ii) RNA later solution for site specific transcriptional analysis of Oct4, NANOG, Cdx2, and β-catenin utilizing Realtime PCR. The difference in expression was analyzed using SPSS statistical software. Main results and the role of chance IF based site specific protein expression data confirmed higher expression of OCT4 in RPL cases compared to MTP controls, whereas CDX2 expression was found to be low in RPL compared to MTP subjects. The Realtime PCR amplification of cDNA using β-actin as internal normalization control for Oct4 (25.76 ± 10.17 folds) and NANOG (18.32 ± 6.67folds) showed increased expression whereas the Cdx2 expression was downregulated (0.487 ± 0.186 folds) in RPL cases compared to MTP controls, indicating a shift towards pluripotency which is a non-favorable environment for the ongoing pregnancy since cell polarization for initiation of differentiation to different cell lineages is required at that time of gestation. The cdx2 and oct4 expression correlated inversely and significantly {Pearson’s correlation= −0.838, p = 0.009; Spearman’s rho= −0.786; p = 0.016}. The realtime PCR amplification of β-catenin, the key molecule involved in direct enhancing of Oct4 expression during gestation was found to be increased in RPL cases compared to MTP controls. Statistically, the β-catenin-Oct4 expression correlated positively significantly. Limitations, reasons for caution Being a patient based study, the present study is limited to being an associative study only; and therefore secondary validation of the data for causal association using cell lines or suitable model system futuristically may add valuable scientific inputs and aid clinical intervention modalities for controlling RPL. Wider implications of the findings As the majority of RPL pathogenesis etiology is undefined limiting the possibilities of clinical interventions therefore we presume the present data can layout possible therapeutic interventions by regulating key regulators influencing skewed ESC profile aiding proper placentation leading to successful pregnancy in a subpopulation of cases with RPL history. Trial registration number Not applicable

OCT4 protein and gene expression analysis in the differentiation of spermatogonia stem cells into neurons by immunohistochemistry, immunocytochemistry, and bioinformatics analysis.

Spermatogonia Stem Cells (SSCs) are potential candidates for reprogramming and regeneration. Recent studies have revealed that differentiated cells can be reverted to pluripotent by overexpressing a set of pluripotent transcription factors. OCT4 (encoded by pou5f1), a POU transcription factor family member, is essential to the potential that controls pluripotency, and it is widely expressed in pluripotent stem cells, although it decreased or suppressed after differentiation. In this investigated research, we examined the OCT4 expression during the differentiation of SSCs into neurons (involving four stages in the following order: SSCs in vivo and in-vitro, embryonic Stem Cell-like (ES-like), Embryonic Bodies (EBs), and finally Neurons) by Immunocytochemistry (ICC), Immunohistochemistry (IMH), and Fluidigm Real-Time polymerase chain reaction. In addition, we use some databases like STRING to predict protein-protein interaction and enrichment analysis. We evaluated the expression of OCT4 in this process, and we observed that it is expressed in SSCs, ES-like, and EBs during the differentiation of spermatogonia stem cells into adult neurons. We show that by adding RA to EBs, the expression of OCT4 is reduced and is not expressed in the neuron cells. We observed that the expression of OCT4 is linked and interacts with the differentiation of spermatogonia stem cells into neuron cells, and it has been shown to be biologically functional, like stem cell maintenance and somatic cell reprogramming. Our findings can help us better understand the process of differentiation of spermatogonia stem cells into neurons, and it can be effective in finding new and more efficient treatments for neurogenesis and repair of neurons. We examined the OCT4 expression during the differentiation of SSCs into neurons (involving four stages in the following order: SSCs in vivo and in-vitro, embryonic Stem Cell-like (ES-like), Embryonic Bodies (EBs), and finally Neurons) by Immunocytochemistry (ICC), Immunohistochemistry (IMH), and Fluidigm Real-Time polymerase chain reaction. In addition, we use some databases like STRING to predict protein-protein interaction and enrichment analysis. We evaluated the expression of OCT4 in this process, and we observed that it is expressed in SSCs, ES-like, and EBs during the differentiation of spermatogonia stem cells into adult neurons. We show that by adding RA to EBs, the expression of OCT4 is reduced and is not expressed in the neuron cells. We observed that the expression of OCT4 is linked and interacts with the differentiation of spermatogonia stem cells into neuron cells, and it has been shown to be biologically functional, like stem cell maintenance and somatic cell reprogramming.

Generation and characterization of induced pluripotent stem cell lines from two patients with recessive dystrophic epidermolysis Bullosa

Recessive Dystrophic Epidermolysis Bullosa (RDEB) is a rare and severe genetic disease responsible for blistering of the skin and mucosa caused by a wide variety of mutations in COL7A1 encoding type VII collagen. We have generated Induced Pluripotent Stem Cells (iPSCs) from two RDEB patients’ fibroblasts harboring homozygous recurrent mutations in COL7A1. Their pluripotent state was confirmed by gene and protein expression of stem cell markers OCT4, SOX2, TRA1/60 and SSEA4. Embryoid body formation followed by immunostaining and TaqMan scorecard analysis confirmed the capacity of RDEB iPSCs to differentiate into cell types from the three germ layers in vitro.

Maslinic Acid Supplementation during the In Vitro Culture Period Ameliorates Early Embryonic Development of Porcine Embryos by Regulating Oxidative Stress

As a pentacyclic triterpene, MA exhibits effective free radical scavenging capabilities. The purpose of this study was to explore the effects of MA on porcine early-stage embryonic development, oxidation resistance and mitochondrial function. Our results showed that 1 μM was the optimal concentration of MA, which resulted in dramatically increased blastocyst formation rates and improvement of blastocyst quality of in vitro-derived embryos from parthenogenetic activation (PA) and somatic cell nuclear transfer (SCNT). Further analysis indicated that MA supplementation not only significantly decreased the abundance of intracellular reactive oxygen species (ROS) and dramatically increased the abundance of intracellular reductive glutathione (GSH) in porcine early-stage embryos, but also clearly attenuated mitochondrial dysfunction and inhibited apoptosis. Moreover, Western blotting showed that MA supplementation upregulated OCT4 (p < 0.01), SOD1 (p < 0.0001) and CAT (p < 0.05) protein expression in porcine early-stage embryos. Collectively, our data reveal that MA supplementation exerts helpful effects on porcine early embryo development competence via regulation of oxidative stress (OS) and amelioration of mitochondrial function and that MA may be useful for increasing the in vitro production (IVP) efficiency of porcine early-stage embryos.

MiR 378a/FSCN1 regulatory axis inhibits tumor stemness and increases the cytotoxicity of chemotherapeutic drugs in colorectal cancer cells

Purpose: To evaluate the effect of miR-378a/FSCN1 axis on tumor stemness and aerobic glycolysis in colorectal cancer cells (CRC).&#x0D; Methods: Abnormal expressions of miR-378a and FSCN1 in CRC tissues were analyzed through TCGA database. Cell viability and apoptosis were determined using 3-(4,5)-dimethylthiahiazo (-z-y1)-3,5-di- phenytetrazoliumromide (MTT) assay and flow cytometry, respectively, while expression of miR-378a was evaluated by quantitative real-time polymerase chain reaction (qRT-PCR). Furthermore, Western blotting assay was used to assess protein expressions. The miR-378a target was evaluated using ENCORI and confirmed by luciferase assay. Aerobic glycolysis was evaluated by determining glucose uptake, lactate production and lactate dehydrogenase (LDH) activity.&#x0D; Results: Downregulation of miR-378a and upregulation of FSCN1 were observed in both CRC tissues and cell lines (p &lt; 0.05). Overexpression of miR-378a and repression of FSCN1 reduced cell viability and tumor sphere formation, and induced cell apoptosis. Protein expression of SOX2, KLF4, Bmi1 and Oct-4 were downregulated by either the overexpression of miR-378a or repression of FSCN1 (p &lt; 0.01). Glucose uptake, lactate production and LDH activity were inhibited by either overexpression of miR-378a or repression of FSCN1, while cytotoxicity of Dox and 5-Fu was increased by upregulation of miR-378a or downregulation of FSCN1 (p &lt; 0.05). The predictive results of ENCORI demonstrated that FSCN1 was the direct target of miR-378a, and this was confirmed by luciferase assay results (p &lt; 0.005). All the effects of miR-378a in CRC were reversed by overexpression of FSCN1 (p &lt; 0.05).&#x0D; Conclusion: This study has shown that miR-378a suppresses tumor stemness and increases the cytotoxicity of chemotherapeutic drugs by directly targeting FSCN1, resulting in the prevention of CRC tumorigenesis. Thus, these findings suggest a new approach to the chemotherapeutic management of CRC.

The Role of Box A of HMGB1 in Enhancing Stem Cell Properties of Human Mesenchymal Cells: A Novel Approach for the Pursuit of Anti-aging Therapy.

Box A is a highly conserved DNA-binding domain of high-mobility group box 1 (HMGB1) and has been shown to reverse senescence and aging features in many cell models. We investigated whether the activation of box A can influence stem cell properties. Human dermal papilla (DP) cells and primary human white pre-adipocytes (HWPc) were employed as mesenchymal cell models. Box A-overexpressing plasmids were used to induce cellular box A expression. mRNA and protein levels of stemness markers POU class 5 homeobox 1 pseudogene 5 (OCT4, HGNC: 9221), Nanog homeobox (NANOG, HGNC: 20857), and SRY-box transcription factor 2 (SOX2, HGNC:11195) in DP cells and HWPc were measured by real-time polymerase chain reaction and immunofluorescence analysis, respectively. Transfection efficiency of box A-overexpressing plasmid was 80% and 50% in DP cells and HWPc, respectively. The proliferative rate of both cell types significantly increased 72 h after transfection. Levels of OCT4, NANOG and SOX2 mRNA and protein expression were significantly increased in box A-transfected DP cells and HWPc compared to empty plasmid-transfected cells. Immunofluorescence analysis confirmed the induction of OCT4, NANOG and SOX2 protein expression in response to box A in DP cells and HWPc. OCT4 and SOX2 were expressed in both the nuclear and cytoplasmic compartments, while NANOG was intensely located in the nucleus of box A-transfected cells. Our findings suggest that box A may potentially enhance stemness, which may have significant benefits in improving stem cell function due to aging processes and disease. This research may have implications for regenerative medicine applications.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

Circ_0001535 Facilitates Tumor Malignant Progression by miR-485-5p/LASP1 Axis in Colorectal Cancer

Increasing evidence revealed that circular RNAs (circRNAs) are involved in colorectal cancer progression. However, the potential function of circ_0001535 in colorectal cancer remains unclear. To investigate the mechanism of circ_0001535 by silencing circ_0001535 in colorectal cancer cells and nude mice. A cell study. Expressions of circ_0001535, LIM and SH3 protein 1 (LASP1) mRNA, and miR-485-5p were detected by real-time quantitative polymerase chain reaction (RT-qPCR). Western blot analyses of LASP1, PCNA, cleaved caspase 3, snail 1, and OCT4 protein expression were performed. CCK-8, EdU, flow cytometry, transwell assays, and sphere formation were conducted to evaluate colorectal cancer cell proliferation, apoptosis, invasion, and stemness. Luciferase reporter assays, RNA pull-down, and RIP validated binding. A nude mice xenograft model was constructed. Circ_0001535 was significantly upregulated in colorectal tissues and cells. Circ_0001535 knockdown suppressed the malignant behavior of colorectal cells such as proliferation, invasion, stemness, and tumor growth in vivo. This knockdown also induced apoptosis by sponging miR-485-5p and upregulating LASP1 expression. Circ_0001535 promotes colorectal cancer cell development by absorbing miR-485-5p and upregulating LASP1.

Tuning pro-survival effects of human induced pluripotent stem cell-derived exosomes using elastin-like polypeptides

Exosome-based regenerative therapies are potentially easier to manufacture and safer to apply compared to cell-based therapies. However, many questions remain about how to bio-manufacture reproducible and potent exosomes using animal-free reagents. Here we evaluate the hypothesis that designer biomaterial substrates can be used to alter the potency of exosomes secreted by human induced pluripotent stem cells (iPSCs). Two animal-free designer matrices were fabricated based on recombinant elastin-like polypeptides (ELPs): one including a cell-adhesive RGD ligand and a second with a non-adhesive RDG peptide. While iPSCs cultured on these two substrates and Matrigel-coated controls had similar levels of proliferation, the RDG-ELP substrate significantly increased protein expression of stemness markers OCT4 and SOX2 and suppressed spontaneous differentiation compared to those on RGD-ELP. The pro-survival potency of iPSC-derived exosomes was evaluated using three distinct stress tests: serum starvation in murine fibroblasts, hypoxia in human endothelial cells, and hyperosmolarity in canine kidney cells. In all three cases, exosomes produced by iPSCs grown on RDG-ELP substrates had similar pro-survival effects to those produced using iPSCs grown on Matrigel, while use of RGD-ELP substrates led to significantly reduced exosome potency. These data demonstrate that recombinant substrates can be designed for the robust bio-manufacturing of iPSC-derived, pro-survival exosomes.

Effects of EGF and melatonin on gene expression of cumulus cells and further in vitro embryo development in bovines.

Despite previous research demonstrating the benefits of including growth factors and antioxidants to maturation medium to support embryo production, to date the effect of epidermal growth factor (EGF) and melatonin (Mel) on oocyte competency has not been studied. This study supplemented in vitro maturation (IVM) medium with EGF (10 ng/ml) and Mel (50 ng/ml) alone, or in combination, and evaluated cumulus cell (CC) gene expression and the development and quality of parthenogenetic blastocysts. No differences in CC gene expression levels indicative of developmental potential were found among the treatment groups. Antioxidant gene CuZnSOD was significantly (P < 0.05) decreased in CCs from the Mel group. Moreover, blastocyst rates on day 7 were significantly increased in EGF or Mel (P < 0.05), but not EGF+Mel. Significant decrease (P < 0.05) in GPX1, CuZnSOD, SLC2A1 and HSPA1A (P = 0.07) mRNA levels was observed in blastocysts from the Mel group. OCT4 gene expression was significantly increased (P < 0.05) in EGF+Mel and confirmed using immunofluorescence. Our results indicate that, despite the lack of changes of competence-related genes in CCs, IVM medium supplemented with Mel improved the culture environment sufficiently, resulting in improved blastocysts. Moreover, EGF and Mel combined during maturation increased OCT4 gene and protein expression in blastocysts, indicating its potential for stem cells.