Expression In Colonic Mucosa Research Articles

Prokineticin-2 Is Highly Expressed in Colonic Mucosa of Early Parkinson's Disease Patients.

Elevated levels of prokineticin-2 (PK2), regarded as a protein involved in modulating immune/inflammatory responses, have been detected in the substantia nigra, serum, and olfactory neurons of Parkinson's disease (PD) patients. Of note, emerging evidence suggests that gut alterations, including dysbiosis and enteric inflammation, play a role in PD via the gut-brain axis. Our goal was to investigate the expression of PK2 in colonic biopsies of PD patients. Mucosal biopsies from the descending colon were obtained in 11 PD patients and five asymptomatic subjects. Biopsy samples were processed for PK2 immunofluorescence and western blot. We revealed an increased PK2 expression in colonic mucosa from PD patients in the early stages compared to controls. In addition, we found that PK2 was expressed by activated enteric glial cells and macrophages. PK2 is highly expressed within neurogenic/inflammatory cells of colonic mucosa from early PD patients, suggesting a potential role of PK2 in gut inflammation, especially in the early stages of PD. © 2024 International Parkinson and Movement Disorder Society.

BTB and CNC homology 1 deficiency disrupts intestinal IgA secretion through regulation of polymeric immunoglobulin receptor expression.

Immunoglobulin A (IgA)-mediated mucosal immunity is important for the host because it contributes to reducing infection risk and to establishing host-microbe symbiosis. BTB and CNC homology 1 (Bach1) is a transcriptional repressor with physiological and pathophysiological functions that are of particular interest for their relation to gastrointestinal diseases. However, Bach1 effects on IgA-mediated mucosal immunity remain unknown. For this study using Bach1-deficient (Bach1-/-) mice, we investigated the function of Bach1 in IgA-mediated mucosal immunity. Intestinal mucosa, feces, and plasma IgA were examined using immunosorbent assay. After cell suspensions were prepared from Peyer's patches and colonic lamina propria, they were examined using flow cytometry. The expression level of polymeric immunoglobulin receptor (pIgR), which plays an important role in the transepithelial transport of IgA, was evaluated using Western blotting, quantitative real-time PCR, and immunohistochemistry. Although no changes in the proportions of IgA-producing cells were observed, the amounts of IgA in the intestinal mucosa were increased in Bach1-/- mice. Furthermore, plasma IgA was increased in Bach1-/- mice, but fecal IgA was decreased, indicating that Bach1-/- mice have abnormal secretion of IgA into the intestinal lumen. In fact, Bach1 deficiency reduced pIgR expression in colonic mucosa at both the protein and mRNA levels. In the human intestinal epithelial cell line LS174T, suppression of Bach1 reduced pIgR mRNA stability. In contrast, overexpression of Bach1 increased pIgR mRNA stability. These results demonstrate that Bach1 deficiency causes abnormal secretion of IgA into the intestinal lumen via suppression of pIgR expression.

Effects of Massa Medicata Fermentata on the intestinal pathogenic flagella bacteria and visceral hypersensitivity in rats with irritable bowel syndrome.

Objective: To investigate the effect of Massa Medicata Fermentata (MMF) on the changes of pathogenic flagellar bacteria and visceral hypersensitivity in rats with diarrhea irritable bowel syndrome (IBS-D). Methods: Thirty adult SD rats were randomly divided into normal control group (n = 10), model control group (n = 10), and MMF group (n = 10). Acetic acid enema combined with restraint stress was used to build the IBS-D visceral hypersensitivity model; Abdominal withdrawal reflex (AWR) test was used to assess the visceral sensitivity of rats; 16SrRNA sequencing was used to analyze the changes of intestinal bacteria in each group, and the content of pathogenic flagellated bacteria were quantitatively counted; The content of flagellin in colonic mucosa was detected by ELISA; TLR5 protein in colonic mucosa of rats was detected by Western Blot. Results: After IBS-D modeling, the visceral sensitivity of rats was significantly higher in the model control group than that in the normal control group (p = 0.0061), while it was significantly decreased in MMF group compared with the model control group (p = 0.0217), but without significant difference compared with the normal control group (p = 0.6851). The number of fecal Bifidobacterium and Lactobacillus in the model group were significantly decreased compared with the normal control group (p < 0.0001); While they were significantly increased in the MMF group compared with the model control group and normal control group (p = 0.009; p < 0.0001). The amount of fecal pathogenic flagellated bacteria in the model group was significantly increased compared with the normal control group (p = 0.001); However it was significantly reduced in MMF group compared with the model group (p = 0.026), which has no statistically difference with the normal control group (p = 0.6486). The content of flagellin in colonic mucosa was significantly increased in the model group when compared with the normal control group (p < 0.0001), and it was decreased in MMF group compared with the normal control group (p < 0.0001), but there was no statistical difference with the normal control group (p = 0.6545). The expression level of TLR5 protein in colonic mucosa of rat was significantly increased in model control group compared with the normal control group (p = 0.0034), However, it was significantly decreased in MMF group compared with normal control group (p = 0.0019), but it was no statistical difference with the normal control group (p = 0.7519). Conclusion: MMF can reduce visceral hypersensitivity by decreasing the content of pathogenic flagellated bacteria and their flagellin and inhibiting its specific receptor TLR5 protein expression in colonic mucosa in IBS-D rats.

Urinary chemerin as a potential biomarker for inflammatory bowel disease.

Systemic levels of the adipokine chemerin are elevated in different inflammatory conditions such as inflammatory bowel disease (IBD). In IBD, chemerin protein expression in colon mucosa is induced and serum chemerin levels are increased. Aim of this study was to identify chemerin protein in human feces and/or urine and to evaluate a possible association with IBD activity. Feces and urine of 40 patients with IBD and the respective sera of 34 patients were collected. Chemerin levels were analyzed by immunoblot in feces and urine samples. In addition, enzyme-linked immunosorbent assay (ELISA) was used to measure chemerin in all urine, feces and serum samples of the patients and in urine of 17 healthy controls. Chemerin was not detectable in 80% of the human feces samples by ELISA. Chemerin in human urine was detected by immunoblot and ELISA. Compared to serum levels, urinary concentration was about 6,000-fold lower. Urinary chemerin did not differ between patients with ulcerative colitis (n = 15) and Crohn's disease (n = 25). Urinary chemerin was not related to its serum levels, did not correlate with serum C-reactive protein level and negatively correlated with serum creatinine. Of note, urinary chemerin of patients with a fecal calprotectin > 500 μg/g was significantly higher compared to patients with lower calprotectin levels and compared to healthy controls. Serum creatinine did not differ between the patient groups. Urinary chemerin might present a novel non-invasive biomarker for monitoring IBD severity and clinical course.

Possible role of nuclear factor erythroid 2–related factor 2 in the progression of human colon precancerous lesions

BackgroundIncreased levels of oxidative stress/cell inflammation contribute to colorectal cancer (CRC) onset. Nuclear factor-erythroid 2-related factor 2 (Nrf2) and its controlled growth factor erv1-like (Gfer) gene regulate redox‐sensitive and anti-inflammatory mechanisms, respectively, which can contribute to promoting cancer development. AimWe evaluated Nrf2 and Gfer RNA expression and Nrf2 protein expression in colon mucosa in order to establish their possible involvement in the early stage of CRC. MethodsForty subjects were enrolled after a histological evaluation of their colon biopsies. They included 20 subjects with a sporadic colorectal adenoma (SpCA group) and 20 without precancerous lesions (controls). Biopsy samples were processed for gene expression analysis and protein expression, using Real-time PCR and immunofluorescence confocal microscopy, respectively. ResultsNrf2 and Gfer mRNA expression were significantly reduced (p=0.007 and p<0.003, respectively) in SpCA tissues compared to normal mucosa from controls. Furthermore, immunofluorescence analysis confirmed a relevant reduction of Nrf2 in SpCA tissue compared to normal tissue from controls. ConclusionsOur data confirm the hypothesis that Nrf2 and Gfer expression may be involved in the initial hits contributing to the multistep process of colon carcinogenesis. Further larger studies are needed to confirm if Nrf2 and Gfer are potential risk/prognostic factors for cancer development.

Role of microRNAs in the Pathophysiology of Ulcerative Colitis

Ulcerative colitis (UC) is an intractable disorder characterized by a chronic inflammation of the colon. Studies have identified UC as a multifactorial disorder affected by both genetic and environmental factors; however, the precise mechanism remains unclear. Recent advances in the field of microRNA (miRNA) research have identified an association between this small non-coding RNA in the pathophysiology of UC and altered miRNA expression profiles in patients with UC. Nevertheless, the roles of individual miRNAs are uncertain due to heterogeneity in both research samples and clinical backgrounds. In this review, we focus on miRNA expression in colonic mucosa where inflammation occurs in UC and discuss the potential roles of individual miRNAs in disease development, outlining the pathophysiology of UC.

Main active components of Jiawei Gegen Qinlian decoction protects against ulcerative colitis under different dietary environments in a gut microbiota-dependent manner

As an effective drug against acute enteritis diarrhea, Gegen Qinlian decoction (GQD) has a history of 2000 years. However, the potential molecular mechanism through which GQD could protect intestinal barrier from ulcerative colitis (UC) still remains undefined. As an important part of the homeostasis of the colon, gut microbiota is closely related to the dynamic evolution of the surrounding environment and the adjustment of dietary structure. At present, the effectiveness and mechanism of Jiawei Gegen Qinlian decoction against UC in different dietary environments are not clear. Here, the main active components of Jiawei Gegen Qinlian Decoction (PBM), were selected to construct a reasonable and effective compound scheme. We adopted "5% dextran sulfate sodium (DSS)" and "high temperature and humidity + high sugar and high fat + alcohol + 5%DSS" to induce UC rat models in general environment and UC rat models in Lingnan area, respectively. Then, we examined the therapeutic effects of PBM (89.96 mg/kg and 179.92 mg/kg) on two kinds of UC rats. The role of gut microbiota in the anti-UC effect of PBM was identified by intestinal flora consumption and fecal microbiota transplantation (FMT) experiments. Subsequently, we monitored the alterations of gut microbiota and fecal metabolism in the rat colon by 16Sr DNA technique and targeted metabonomics, respectively. The colon inflammation of the PBM-treated and the FMT-treated rats both showed significant relief, as evidenced by a reduction in body weight loss, bloody stool, diarrhea, disease activity index (DAI) score, shortening of colon length as well as decreased colon histology damage. Interestingly enough, the depletion of intestinal flora took away the protective effect of PBM, confirming the importance of intestinal flora in the anti-UC effect of PBM. Then our findings suggested that PBM could not only regulate the gut microbiota by increasing Akkermansia and Romboutsia but also decrease Escherichia-Shigella. More importantly, PBM could increase the production of propionate and total short-chain fatty acids (SCFAs) in colitis rats, regulate medium and long chain fatty acids (M-LCFAs), maintain bile acids (BAs) homeostasis, and regulate amino acids (AAs) metabolism. The transformation of intestinal environment might be related to the upregulation of anti-inflammation, anti-oxidation and tight junction protein expression in colonic mucosa. In summary, PBM showed potential for anti-UC activity through gut microbiota dependence and was expected to be a complementary and alternative medicine herb therapy.

Serotonin Pathway of Tryptophan Metabolism in Small Intestinal Bacterial Overgrowth-A Pilot Study with Patients Diagnosed with Lactulose Hydrogen Breath Test and Treated with Rifaximin.

Small intestinal bacterial overgrowth (SIBO) is a condition associated with diverse clinical conditions and there is no gold standard in its diagnosis and treatment. Tryptophan (Trp) metabolism may be involved in etiology of gastrointestinal diseases and is regulated by intestinal microbiota. In our study we investigated aspects of the serotonin (5-HT) pathway of Trp metabolism in three groups of individuals based on the hydrogen concentration in the lactulose hydrogen breath test (LHBT): controls (<20 ppm) and SIBO patients (≥20 ppm), with diarrhea (SIBO-D) or constipation (SIBO-C). The SIBO-D patients showed an increased serum concentration of 5-HT and small intestinal mucosa mRNA expression of tryptophan hydroxylase 1 (TPH-1), a rate-limiting enzyme in 5-HT biosynthesis. Urinary 5-hydroxyindoleacetic acid (5-HIAA), the main metabolite of 5-HT, was higher in both group of SIBO patients than controls. A positive correlation between 5-HIAA and LHBT was observed. A two-week treatment with rifaximin decreased hydrogen in LHBT and 5-HIAA concentration in SIBO patients. In conclusion, the serotonin pathway of Trp metabolism may play a role in the pathogenesis of hydrogen-positive SIBO and it may influence the diversification of SIBO into variants with diarrhea or constipation. As urinary 5-HIAA concentration correlates with LHBT, TPH-1 expression in colonic mucosa and TH-5 in serum of SIBO patients, it can be considered as a non-invasive marker of this condition.

Complex changes of circadian proteins expression in inflammatory bowel disease.

Recently, a possible role of circadian system in the pathogenesis of various gastrointestinal disorders gained an attention. The association of circadian system with immune system activity and reciprocal connection with intestinal microbiota indicate possible links with inflammatory bowel diseases (IBD). The retrospective study provided a semiquantitative immunohistochemical analysis of the expression of 8 core circadian proteins (BMAL1, BMAL2, PER1, PER2, PER3, CLOCK, NPAS2 and TIMELESS) in the epithelial cells of intestinal mucosa in 24 patients with Crohn's disease (CD) and 26 patients with ulcerative colitis (UC). Samples from patients without history of IBD served as the control. The BMAL1 protein expression in intramucosal inflammatory cells was explored as well. The expression of 5 core circadian proteins (BMAL1, PER1, PER3, TIMELESS and NAPS2) was decreased in mucosal epithelium of patients with IBD in comparison with the control samples, whereas the expression of BMAL1 and PER1 was more noticeably decreased in UC patients and PER3, TIMELESS and NPAS2 in CD patients. There was a decreased BMAL1 expression in intramucosal inflammatory cells of IBD patients. Decreased core circadian proteins expression in colonic mucosa and in intramucosal inflammatory cells of IBD patients indicated a circadian rhythm deregulation as contributing factor in the development of IBD. To our knowledge, this is so far the most extensive immunohistochemical analysis performed on the samples of IBD patients evaluating the changes in circadian protein expression in the intestinal mucosa (Tab. 1, Fig. 2, Ref. 31).

Cilostazol protects against acetic acid-induced colitis in rats: Possible role for cAMP/SIRT1 pathway

The phosphodiesterase-3 inhibitor, cilostazol has been recently shown to protect against chemically induced colitis in animal models. However, whether cyclic adenosine monophosphate (cAMP) contributes to the anti-inflammatory activity of cilostazol in colitis is still unknown. In the current study, we investigated the role of cAMP/silent information regulator-1 (SIRT-1) pathway in the protective effect of cilostazol using rat model of acetic acid-induced colitis. Upregulation of SIRT1 activity and expression has been recently shown to protect against chemically induced colitis. Our results demonstrated that cilostazol alleviated the histopathological changes associated with acetic acid-induced colitis. Interestingly, pre-administration of cilostazol increased cAMP concentration and SIRT1 expression in colonic mucosa to levels similar to that observed in control animals without induction of colitis. In addition, cilostazol inhibited the SIRT1 targets; NF-κB, Akt and MAPK inflammatory pathways as demonstrated by suppression of acetic acid-induced upregulation of NF-κB activity, p-AKT levels and the expression of p38 MAPK. NF-κB activity and the levels of p-AKT, tumor necrosis factor α (TNF-α), interleukin-1β (IL-1β) were similar in rats pretreated with cilostazol prior to induction of colitis and the control rats without colitis. Furthermore, cilostazol reduced acetic acid-induced oxidative stress and apoptosis. In conclusion, the protective effect of cilostazol against acetic acid-induced colitis may be attributed to activation of SIRT1 expression by cAMP. SIRT1 is suggested to contribute to cilostazol-induced suppression of NF-κB, Akt and MAPK inflammatory pathways, oxidative stress and apoptosis.

Tumor response to irinotecan is associated with CYP3A5 expression in colorectal cancer.

Recently, a tumor-autonomous cytochrome P450 (CYP)-3A5-mediated resistance to cancer therapy has been demonstrated in pancreatic ductal adenocarcinoma. Expression of CYP3A5, which is involved in the degradation of irinotecan, has also been reported in colorectal cancer (CRC). The aim of the present study was to analyze CYP3A5 expression in the normal colon, colon adenoma, CRC and normal tissues, as well as to examine whether CYP3A5 expression in CRC has an impact on tumor response to irinotecan treatment. Immunohistochemistry was used to assess 85 tissue samples from 65 patients with CRC, along with 15 samples of normal colon and 45 samples of colon adenoma (including tubular, tubulovillous, and sessile serrated adenomas), and a tissue microarray (TMA) comprised of 26 different normal tissue types. Expression of CYP3A5 was evaluated with a semi-quantitative score. Tumor response to irinotecan therapy was assessed according to the Response Evaluation Criteria in Solid Tumors (RECIST) 1.1 guidelines. In normal tissues, CYP3A5 was expressed in epithelial cells of the colon, gallbladder, kidney, liver, small intestine, stomach, thyroid gland and tonsil, as well as in nerves. Expression in colon mucosa was heterogeneous, with only weak staining in the minority of specimens. CYP3A5 exhibited markedly higher expression in adenomas compared with normal colon tissues. A statistically significant inverse correlation was identified between CYP3A5 expression in CRC tissues and tumor response to irinotecan therapy. Irinotecan treatment itself did not alter CYP3A5 expression in CRC tissues. As CYP3A5 is involved in the degradation of irinotecan, the significantly higher intratumoral expression of CYP3A5 in patients with CRC who do not respond to irinotecan-based chemotherapy may indicate a causal role of CYP3A5 in tumor resistance.

Modified apple polysaccharide influences MUC-1 expression to prevent ICR mice from colitis-associated carcinogenesis

The present study tried to assess the effects of modified apple polysaccharide (MAP) on colitis associated carcinogenesis and the expression of Mucin 1(MUC1). One hundred and twenty 5-week-old male ICR mice were used. The control mice were just administrated with saline, and the rest mice were injected intraperitoneally with 1, 2-dimethyl-hydrazine (DMH) and dextran sodium sulfate (DSS). In the 7th week, the mice in MAP-treated groups were bred with the basal diets mixed with different doses of MAP (w/w: 1.25%, 2.5% and 5%) for 13 weeks. The pathological findings demonstrated that: in the 20th week, adenocarcinoma and/or adenoma occurred in the colons of all the mice in model group. MAP treatment decreased the incidence of colorectal cancer significantly. In the early phase of inflammation, MUC1 expression in colonic mucosa had no significant changes. However, when the inflammation developed and tumor formed, MUC1 expression increased remarkably (P < 0.01). And the MAP treatment (especially at the dose of 5%) reduced MUC1 expression significantly. These data suggested that MAP could prevent against colitis associated colorectal cancer in ICR mice effectively, and MUC1 may be a potential therapeutic target in colorectal cancer prevention and treatment.

MicroRNA-transcription factor interactions and their combined effect on target gene expression in colon cancer cases.

Transcription factors (TFs) and microRNAs (miRNAs) regulate gene expression: TFs by influencing messenger RNA (mRNA) transcription and miRNAs by influencing mRNA translation and transcript degradation. Additionally, miRNAs and TFs alter each other's expression, making it difficult to ascertain the effect either one has on target gene (TG) expression. In this investigation, we use a two‐way interaction model with the TF and miRNA as independent variables to investigate whether miRNAs and TFs work together to influence TG expression levels in colon cancer subjects. We used known TF binding sites and validated miRNA targets to determine potential miRNA‐TF‐TG interactions, restricting interactions to those with a TF previously associated with altered risk of colorectal cancer death. We analyzed interactions using normal colonic mucosa expression as well as differential expression, which is measured as colonic carcinoma expression minus normal colonic mucosa expression. We analyzed 3518 miRNA‐TF‐TG triplets using normal mucosa expression and 617 triplets using differential expression. Normal colonic RNA‐Seq data were available for 168 individuals; of these, 159 also had carcinoma RNA‐Seq data. Thirteen unique miRNA‐TF‐TG interactions, comprising six miRNAs, four TFs, and 11 TGs, were statistically significant after adjustment for multiple comparisons in normal colonic mucosa, and 14 unique miRNA‐TF‐TG interactions, comprising two miRNAs, two TFs, and 13 TGs, were found for carcinoma‐normal differential expression. Our results show that TG expression is influenced by both miRNAs as well as TFs, and the influence of one regulator impacts the effect of the other on the shared TG expression.

Expression of microRNA-155 in inflammatory bowel disease and its clinical significance

Objective: To explore the expression of microRNA-155 in colonic mucosa and peripheral blood in patients with inflammatory bowel disease(IBD), and to examine the clinical value and significance of microRNA-155 in the diagnosis of IBD. Methods: Quatitative reverse-transcription PCR was performed to detect the expression of microRNA-155 in 20 patients with Crohn disease(CD), 21 patients with ulcerative colitis (UC), 18 patients with IBD type unclassified(IBDU), 25 healthy people(control group), 12 patients with infection colitis and 19 patients with ischemia colitis.Receiver operating characteristic (ROC) curve was performed to analyze the clincal value of microRNA-155 in diagnosis of IBD. Results: The expression of microRNA-155 in colonic mucosa in CD, UC and IBDU group was significantly higher than that in control group(P<0.05). MicroRNA-155 expression was also significantly higher in UC group in comparison to CD group (35.4±3.0 vs 18.6±5.9, P<0.01), IBDU group in comparison to CD group (23.0±3.7 vs 18.6±5.9, P<0.05) and UC group in comparison to IBDU group (35.4±3.0 vs 23.0±3.7, P<0.01). The plasma level of microRNA-155 in UC group (55.6±2.5) and IBDU group (48.1±6.2) was significantly higher than that in control group(P<0.05), while no significant difference in CD group was observed when compared with control group(P>0.05). ROC curve shows an AUC of 0.83 and 95%CI of 0.679-0.986 of microRNA-155 expression in colonic mucosa.The sensitivity and specificity of microRNA-155 expression in colonic mucosa in diagnosis of IBD was 68.4% and 78.6%, respectively. Conclusions: MicroRNA-155 showed high expression in colonic mucosa and peripheral blood in patients with IBD.MicroRNA-155 shows promise as a biomarker in diagnosis of IBD.Furthermore, the aberrant expression indicates that microRNA-155 may be involved in pathogenesis and progression of IBD.

Transcription factor-microRNA associations and their impact on colorectal cancer survival.

MicroRNAs (miRNAs) and Transcription Factors (TFs) both influence messenger RNA (mRNA) expression, disrupting biological pathways involved in carcinogenesis and prognosis. As many miRNAs target multiple mRNAs, thus influencing a multitude of biological pathways, deciphering which miRNAs are important for cancer development and survival is difficult. In this study, we (i) determine associations between TF and survival (N = 168 colon cancer cases); (ii) identify miRNAs associated with TFs related to survival; and (iii) determine if factors derived from TF‐specific miRNA principal component analysis (PCA) influence survival. Cox Proportional hazard models were run for each PCA factor to determine Hazard Ratios (HR) and 95% Confidence Intervals (CI) adjusting for age, center, and AJCC stage. Thirty TFs improved survival when differential expression increased; 27 of these were associated significantly with normal colonic mucosa expression of 65 unique miRNAs when an FDR q‐value of <0.05 was applied. Five factors, comprising 21 miRNAs, altered survival in rectal cancer subjects; four of these five factors improved survival and one factor reduced survival. One factor comprising four miRNAs reduced survival in colon cancer subjects. In summary, our data suggest that expression of TFs and their related miRNAs influence survival after diagnosis with colorectal cancer.

P164 FOX04 gene expression in colonic mucosa is a potential marker associated with histological remission in patients with ulcerative colitis

Background: Ulcerative colitis (UC) is a chronic and inflammatory disease that affects the colon of unknown etiology. The genetics factors play an important role in the pathogenesis of UC. FOX04 is a transcription factor that regulates the immune response by inhibition of nuclear factor kappa B (NF-kB). The NF-kB regulates the expression of pro-inflammatory cytokines and proteins from tight junctions such as occludins. The aim of this study was to measure the gene expression of FOX04 in patients with UC and normal controls as well as to determine their association with clinical outcomes. Methods: We included a total of 37 patients with confirmed diagnosis of UC and 20 controls without endoscopic evidence of any type of colitis or neoplasia. All colonic biopsies were taken by colonoscopy. The histological remission was defined according Riley and Geboes index. The relative quantification of the gene expression was performed by real time PCR for FOX04: forward: cgagggactggacttcaact; reverse: ggctcaagggtaaagagtagatatga and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH): reverse 3'-agccacatcgctcagacac and forward 5'-gcccaatacgaccaaatcc, as housekeeping gene was analyzed for normalization. Statistical analysis was performed using the program SPSS Ver. 17.Statistical significance was considered when P value was <0.05. Results: Of the 37 patients with UC (17 male and 20 female) with a mean age at diagnosis of 42 years and 20 normal control individuals with a mean age of 44 years. Regarding to the UC group, 22 had histological activity and the remaining 15 UC patients were on histological remission. The extent of UC was pancolitis (74%), distal colitis (23%) and left side colitis (3%) and clinical course was distributed as follows: 37% were initially active and then inactive; 30% had intermittent activity and 33% had continuous activity. The gene expression of FOX04 was increased in patients with remission UC compared to active UC patients (p<0.002) and normal control group (p<0.001). No significant differences were found between patients with active UC and normal controls. The overexpression of FOX04 gene was associated significantly with histological remission (p<0.05, OR=8.5, 95% CI: 0.83–87.8). Conclusions: The gene expression of FOX04 in colonic mucosa was increased in patients with remission UC. FOX04 could be a potential marker of histological remission and its over-expression in remission UC might suggest an anti-inflammatory mechanism as inhibitor of the production of NF kappa B.

Myeloperoxidase expression in human colonic mucosa is related to systemic oxidative balance in healthy subjects

ABSTRACTObjectives: To improve understanding of the preclinical stage of colonic inflammation by exploring the existence of a link between early inflammatory changes in the colonic mucosa and the systemic redox balance.Methods: Clinical characteristics, a fasting blood draw, and mucosal biopsies from the right, left, and sigmoid-rectum colonic tracts collected from 28 healthy individuals (14/14 males/females) who underwent colonoscopy. Myeloperoxidase (MPO) positive cells infiltrating colonic mucosa specimens were assessed by immunohistochemistry, and patients divided into high or low MPO expressing cells/optical field groups (MPOhigh or MPOlow, respectively).The systemic oxidative balance has been studied through derived-Reactive Oxygen Metabolites (d-ROMs), Biological Antioxidant Potential (BAP), and Lipoperoxide-cholesterol Oxidizing (LP-CHOLOX) tests on serum.Results: MPOhigh patients demonstrated an increased systemic oxidative stress compared to MPOlow individuals (P = 0.035), especially when MPO is referred to the left-sided colonic mucosa (P = 0.007). MPOlow subjects in the sigmoid-rectum showed a significant higher antioxidant capacity in the serum (P < 0.02). Sex-specific differences in MPO expression (male and female: 4.6 ± 3.2 and 2.6 ± 1.5 MPO-positive cells/optical field, respectively, P = 0.044), and a decreasing gradient in MPO expression moving from the cecum to the rectum (ascendant, descendant, and sigmoid-rectum: 3.7 ± 2.8, 3.1 ± 1.7, and 1.4 ± 0.5, respectively, P = 0.012) were also found and discussed.Discussion: The study is the first demonstrating a connection between systemic redox balance and MPO expression in the colonic mucosa, according to the colonic tract and patient gender. Further research evaluating the MPO expression in the human colon and its relationship with pathological conditions could benefit from these results.

All-Trans Retinoic Acid Modulates TLR4/NF-κB Signaling Pathway Targeting TNF-α and Nitric Oxide Synthase 2 Expression in Colonic Mucosa during Ulcerative Colitis and Colitis Associated Cancer.

Colitis associated cancer (CAC) is the colorectal cancer (CRC) subtype that is associated with bowel disease such as ulcerative colitis (UC). The data on role of NF-κB signaling in development and progression of CAC were derived from preclinical studies, whereas data from human are rare. The aim of this work was to study the contribution of NF-κB pathway during UC and CAC, as well as the immunomodulatory effect of all-trans retinoic acid (AtRA). We analyzed the expression of NOS2, TNF-α, TLR4, and NF-κB, in colonic mucosa. We also studied NO/TNF-α modulation by LPS in colonic mucosa pretreated with AtRA. A marked increase in TLR4, NF-κB, TNF-α, and NOS2 expression was reported in colonic mucosa. The relationship between LPS/TLR4 and TNF-α/NO production, as well as the role of NF-κB signaling, was confirmed by ex vivo experiments and the role of LPS/TLR4 in NOS2/TNF-α induction through NF-κB pathway was suggested. AtRA downregulates NOS2 and TNF-α expression. Collectively, our study indicates that AtRA modulates in situ LPS/TLR4/NF-κB signaling pathway targeting NOS2 and TNF-α expression. Therefore, we suggest that AtRA has a potential value in new strategies to improve the current therapy, as well as in the clinical prevention of CAC development and progression.

Expression of inflammatory cytokines and its correlation with peptide YY and claudin-1 in patients with irritable bowel syndrome

Objective To explore the pathogenesis of irritable bowel syndrome (IBS) by detecting serum levels and the colonic mucosa expression of inflammatory cytokines, peptide YY (PYY), and claudin-1, and to analyze their correlation. Methods From April 2013 to April 2015, 50 outpatients with IBS and 20 healthy controls were selected. Serum levels of PYY, interleukin (IL)-10, tumor necrosis factor (TNF)-α and claudin-1 were detected by enzyme-linked immunosorbent assay (ELISA). The expression of IL-10, TNF-α, PYY and claudin-1 in colonic mucosa was determined by immunohistochemistry. Single factor analysis of variance, least significant difference (LSD) method, chi-square test, and Pearson correlation analysis were performed for statistical analysis. Results Among the 50 patients with IBS, 27 cases were diarrhea-type irritable bowel syndrome (D-IBS), and 23 cases were constipated-type irritable bowel syndrome (C-IBS). The serum level and the positive expression rate of PYY in colonic mucosa of D-IBS group were significantly higher than those of healthy control group ((16.28±2.75) ng/L vs (10.12±1.55) ng/L; 66.7%(18/27) vs 30.0%(6/20)), and the differences were statistically significant (LSD-t=10.19, χ2=6.182, both P 0.05). The serum level of claudin-1 and its positive expression rate of PYY, IL-10, TNF-α in colonic mucosa in D-IBS group were both lower than those of healthy control group ((94.44±6.61) ng/L vs (103.64±5.47) ng/L; 11.1%(3/27) vs 40.0%(8/20)), and the differences were statistically significant (LSD-t=5.76, χ2=5.349; both P<0.05). However, the serum level of claudin-1 and its positive expression rate in colonic mucosa in C-IBS group were both higher than those of healthy control group ((115.54±3.42) ng/L vs (103.64±5.47) ng/L; 73.9%(17/23) vs 40.0%(8/20)), and the differences were statistically significant (LSD-t=5.56, χ2=5.055; both P<0.05). The serum levels of IL-10 and PYY, TNF-α and claudin-1 were negatively correlated in the D-IBS group (r=-0.874 and -0.863, both P<0.05). While the serum levels of TNF-α and PYY, IL-10 and claudin-1 were positively correlated (r=0.865 and 0.876, both P<0.05). Conclusions There may be the imbalance of proinflammatory factors and anti-inflammatory factors in IBS patients. PYY may decrease the expression of claudin-1 by promoting IL-10 and inhibiting TNF-α, and thus ameliorate the inflammation reaction of IBS patients. Key words: Irritable bowel syndrome; Tumor necrosis factor-alpha; Interleukin-10; Peptide YY; Claudin-1

Expression of CD68 and Fas Ligand in Colon Mucosa of Patients with Inflammatory Bowel Disease as Prognostic Markers of Cancerogenesis

As it is known, colon carcinogenesis is associated with the inflammatory bowel disease (IBD). Colorectal cancer (CRC) being observed in 5.5-13.5 % of patients with ulcerative colitis (UC) and in 0.4-0.8 % of patients with Crohn disease (CD). The gut mucosa of patients with CD, but not with UC, as well as the stroma of CRC have elevated numbers of CD68(+) macrophages. It is known also that the expression of Fas Ligand (FasL), representing another branch of immunoreactivity, in the lesions of CRC and UC but not of CD is upregulated. The fact that enterocyte apoptosis is increased in lesions of CD and lymphocytes in UC are resistant to Fas-mediated apoptosis can be the keypoint for understanding the hypothesis [17], suggesting that cells express FasL and are able to kill Fas-expressing activated lymphocytes and escape rejection by the immune system, which can be the basis for differences in association of UC and CD with CRC. The aim of this study was to evaluate the number of CD68(+) macrophages and to analyze FasL expression in colon mucosa of patients with UC, CD and CRC in order to assess its value for prognosis of CRC. Expression of CD68 and FasL was analyzed immunohistochemically in the samples of colon mucosa taken from the affected areas of 4 patients with UC, 6 patients with CD and 10 patients with CRC. In addition in 7 CRC patients the samples taken from unaffected areas were analyzed. We find average expression of FasL in both unaffected and affected areas of CRC patients was higher than in CD patients (p = 0.04, p = 0.00). Average expression of FasL in affected areas of CRC patients was higher (p = 0.02) than in UC patients and the same (p = 0.23) as in unaffected areas of CRC patients. The revealed associations support the possibility to use expression of CD68 and FasL as prognostic markers for transformation of IBD to CRC.