Euglenoid Algae Research Articles

New records of euglenoid algae from Surma river in Bangladesh

Eight species of Euglenophyceae from Surmariverin Bangladesh are reported in this paper. The species are: Euglena hyaline Klebs, E. robertilamii Lefèvre , Phacus gigas Da Cunha, P. pseudoplatalea Pochm., P. triqueter (Ehr.) Duj.var. oblonga Shi, Trachelomonas scabra Playf. var. labiata (Teiling) H.-P., Trachelomonas spiculifera Palmer, and T.umbili copora Conradare. After a careful review on the list of euglenoid algae of Bangladesh, all these eight species are found to be new addition, and hitherto described here for the first time in Bangladesh. Bangladesh J. Plant Taxon. 30(1): 107-110, 2023 (June)

Microspheres in the Silurian of the Altai Mountains: Morphology, Chemical Composition, Biomineralization, and Genesis

The study of Silurian sediments in the central part of the Altai Mountains (Gorny Altai) by limestone dissolution has revealed two groups of spherical objects; large microspheres 90–120 µm and small nanofossils (nanospheres) 5–18 µm in diameter. Their double-layered walls are composed of standard-sized siderite microcrystals replaced by goethite. The Altai microspheres have a low Ca content (<0.5 wt %) so cannot be interpreted as calcispheres. The Altai Silurian microspheres and nanofossils (nanospheres) are tentatively attributed to biomineralized remains of loricae (shell-like envelopes) of various euglenoid alga generations.

Euglenoids in Haqlan Springs and Euphrates River at Hadithah City, Western Iraq

The present study aimed to investigate the species of euglenoid algae in the Euphrates river and Haqlan valley springs at Al-Anbar province, Western Iraq. Samples were collected in October 2019 from two sites in the study area. Some environmental parameters measured were water temperature, pH, electrical conductivity, salinity, sulphate, total hardness, total alkalinity, nitrate and phosphate. Fifty-four species of the euglenoids belonging to six genera were encountered, one belonged to Monomorphina, two belonged to Colacium, 19 to Euglena, 10 to Trachelomonas, seven to Lepocinclis and 15 to Phacus. Thirteen species were new records in Iraq. Ten species were recorded in two sites. Most of the euglenoids found in this study occurred in Haqlan springs and were represented by 40 species in comparison to 24 species in the Euphrates river.

Bioindication of the Influence of Oil Production on Sphagnum Bogs in the Khanty-Mansiysk Autonomous Okrug–Yugra, Russia

Algal diversity in the bogs of the Ershov oil field of the Khanty-Mansiysk Autonomous Okrug–Yugra (KMAO-Yugra) with the gradient of oil pollution between 255 and 16,893 mg kg−1 has been studied with the help of bioindication methods and ecological mapping. Altogether 91 species, varieties, and forms of algae and cyanobacteria from seven divisions have been revealed for the first time from seven studied sites on the bogs. Charophyta algae prevail followed by diatoms, cyanobacteria, and euglenoids. The species richness and abundance of algae were maximal at the control site, with charophytic algae prevailing. The species richness of diatoms decreased in the contaminated area, but cyanobacteria were tolerated in a pH which varied between 4.0 and 5.4. Euglenoid algae survived under the influence of oil and organic pollution. Bioindication revealed a salinity influence in the oil-contaminated sites. A comparative floristic analysis shows a similarity in communities at sites surrounding the contaminated area, the ecosystems of which have a long-term rehabilitation period. The percent of unique species was maximal in the control site. Bioindication results were implemented for the first time in assessing the oil-polluted bogs and can be recommended as a method to obtain scientific results visualization for decision-makers and for future pollution monitoring.

Phytoplankton Prey Selection by Hypophthalmichthys molitrix Val. (Silver Carp) in a Lower Mississippi River Backwater Lake

Hypophthalmichthys molitrix (Silver Carp) are invasive and abundant in the Mississippi River system, where they consume phytoplankton. There is concern that Silver Carp may influence phytoplankton community structure with cascading effects on other trophic levels. Information is needed regarding Silver Carp phytoplankton-consumption rates and prey selection to assess their potential impact on the food-web in the river. We investigated Silver Carp diets in a backwater lake of the Lower Mississippi River in order to quantify phytoplankton prey selectivity. We made measurements on 4 dates over a 2-y period, which spanned a range of hydrologic connectivity between the lake and the river and a variety of fish sizes. We quantified selection by comparing phytoplankton community composition in the lake to prey in foreguts of captured Silver Carp using Vanderploeg and Scavia's (1979) relativized selection index. With a possible exception of diatoms on 1 date, there was no relationship of sample date or fish size on prey selection. However, there was a consistent pattern in prey selection: euglenoid algae were positively selected, selection of colonial algae and diatoms was variable, and flagellates and filamentous cyanobacteria were negatively selected. Results are discussed in the context of a conceptual model for Silver Carp phytoplanktivory that incorporates the roles of habitat selection, prey availability, prey capture and processing, and digestive physiology.

Euglenophycin is produced in at least six species of euglenoid algae and six of seven strains of Euglena sanguinea

Euglena sanguinea is known to produce the alkaloid toxin euglenophycin and is known to cause fish kills and inhibit mammalian tissue and microalgal culture growth. An analysis of over 30 species of euglenoids for accumulation of euglenophycin identified six additional species producing the toxin; and six of the seven E. sanguinea strains produced the toxin. A phylogenetic assessment of these species confirmed most taxa were in the Euglenaceae, whereas synthesis capability apparently has been lost in the Phacus, Eutreptiella, and Discoplastis branches.

Quantitative Mass Spectrometric Analysis and Post-Extraction Stability Assessment of the Euglenoid Toxin Euglenophycin

Euglenophycin is a recently discovered toxin produced by at least one species of euglenoid algae. The toxin has been responsible for several fish mortality events. To facilitate the identification and monitoring of euglenophycin in freshwater ponds, we have developed a specific mass spectrometric method for the identification and quantitation of euglenophycin. The post-extraction stability of the toxin was assessed under various conditions. Euglenophycin was most stable at room temperature. At 8 °C there was a small, but statistically significant, loss in toxin after one day. These methods and knowledge of the toxin’s stability will facilitate identification of the toxin as a causative agent in fish kills and determination of the toxin’s distribution in the organs of exposed fish.

Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

Polysaccharide nanofiber made from euglenoid alga

We have fabricated a polysaccharide nanofiber made from paramylon (β-1,3-glucan), a storage polysaccharide stored as a micrometer-sized particle in the cell of euglenoid alga. Preparation of this nanofiber primarily hinges on the bottom-up approach. First, paramylon, which is originally present in the form of a bundle of nanofibers in a particle, was fibrillated to a randomly coiled polymer by dissolving the particle in a 1.0-mol/L NaOH aqueous solution. Second, the randomly coiled polymer was allowed to self-assemble into a triplex as the NaOH concentration was reduced to 0.25–0.20mol/L. Third, a 20-nm-width nanofiber made from the triplex emerged in the solution when the NaOH concentration was reduced to approximately 0.20mol/L.

Ectobiotic and Endobiotic Bacteria Associated with Eutreptiella sp. Isolated from Long Island Sound

Diversity and functional association of bacteria with Eutreptiella sp. was investigated. 16S rDNA analysis of ectobiotic bacteria revealed various lineages of Alphaproteobacteria and abundant Gammaproteobacteria, specifically Marinobacter. Antibiotic treatment yielded axenic cultures, and experiments based on them indicated that ectobiotic bacteria likely provide vitamin B(12) and other growth-enhancing factors for the alga. Further, DAPI staining and transmission electron microscopy revealed endobiotic bacteria in the cytoplasm of algal cells. 16S rDNA analysis showed that the bacteria belonged to one species that was most closely related to Rickettsiales endosymbionts of other organisms and phylogenetically affiliated with a new group of aquatic Rickettsiales. Observations from a diel experiment indicated that the endobiotic bacteria reproduced asynchronously with Eutreptiella sp. and had no adverse effects on lipid production (bioenergetics) or growth of the host alga. Our study reveals a diverse microbiome associated with this euglenoid alga, offering a system for studying the roles of algae-bacteria associations.

Observations of Silver Carp (Hypophthalmichthys molitrix) Planktivory in a Floodplain Lake of the Lower Mississippi River Basin

ABSTRACT The invasive silver carp (Hypophthalmichthys molitrix) has become pervasive in much of the Mississippi River, its tributaries, and in connected lakes and wetlands. As an increasingly abundant planktivore, it competes directly for food with native fishes. Its greatest impact may be in connected backwater lakes and wetlands, which due to their high primary production serve as critical sites for feeding and growth of many fishes. To assess the impact that silver carp may have on one such system, we examined the composition of plankton samples and of alimentary tract (gut) contents of collected from an oxbow lake in Mississippi, Forest Home Chute. Through an occasional connection to the Mississippi River, Forest Home Chute was invaded by silver in winter 2005, after which the river and lake became disconnected for about two years. In the water-column, the most common types of phytoplankton were euglenoid algae, cyanobacteria, and diatoms. The vast majority of zooplankton was rotifers with densities sometimes exceeding 7,000 organisms per liter. Very high concentrations of phytoplankton in the gut, relative to in the water-column, indicate substantial consumption of phytoplankton production. In October 2006, euglenoid phytoplankters were a much greater, and cyanobacteria a much lesser, proportion of prey in the fish gut compared to their proportions in the water-column. In December, however, there was no evidence of selective consumption by the silver carp population. Some of the phytoplankters observed in the lowest portion of the gut, including pinnate diatoms and euglenoid algae, were motile, indicating they had survived transit through the 5 to 7-m long gut tract. There was no evidence of rotifer survival of gut passage. By its high consumption of plankton, possible selective planktivory, and differential digestion of consumed phytoplankton and zooplankton, the silver may be altering the food web structure of these important connected lakes.

ALGAL TRANSGENICS IN THE GENOMIC ERA1

The last few years have witnessed significant advances in the field of algal genomics. Complete genome sequences from the red alga Cyanidioschyzon merolae and the diatom Thalassiosira pseudonana have been published, the genomes for two more algae (Chlamydomonas reinhardtii and Ostreococcus tauri) are nearing completion, and several others are in progress or at the planning stage. In addition, large‐scale cDNA sequencing projects are being carried out for numerous algal species. This wealth of genome data is serving as a powerful catalyst for the development and application of recombinant techniques for these species. The data provide a rich resource of DNA elements such as promoters that can be used for transgene expression as well as an inventory of genes that are possible targets for genetic engineering programs aimed at manipulating algal metabolism. It is not surprising therefore that significant progress in the genetic engineering of eukaryotic algae is being made. Nuclear transformation of various microalgal species is now routine, and progress is being made on the transformation of macroalgae. Chloroplast transformation has been achieved for green, red, and euglenoid algae, and further success in organelle transformation is likely as the number of sequenced plastid, mitochondrial, and nucleomorph genomes continues to grow. Importantly, the commercial application of algal transgenics is beginning to be realized, and algal biotechnology companies are being established. Recent work has shown that recombinant proteins of therapeutic value can be produced in microalgal species, and it is now realistic to envisage the genetic engineering of commercially important species to improve production of valuable algal products. In this article we review the recent progress in algal transgenics and consider possible future developments now that phycology has entered the genomic era.

Analyses of physico-chemical characteristics and phytoplankton communities of Lake Nasser during the last two decades

Lake Nasser is one of the largest man-made lakes in the world. The creation of Lake Nasser, due to the impoundment of the River Nile in Southern Egypt, was accompanied by alterations in the environmental conditions that consequently affect the biota. Such alterations lead to corresponding changes in the diversity, abundance and distribution of the phytoplankton community. Therefore, the phytoplankton populations were followed and investigated in Lake Nasser. The phytoplankton community structure revealed a floristical diversity and is composed of various planktonic algal taxa appertaining to the divisions: Chlorophyta, Bacillariophyta (diatoms), Cyanophyta (cyanobacteria), Dinophyta (Dinoflagellates) and Euglenophyta. Chlorophyta contribute more taxa to the phytoplankton than any other groups. However, diatoms and cyanobacteria are numerically the main components and alternate in dominance of the community. Dinoflagellates persist as frequent forms and the euglenoid algae are very scarcely represented. Remarkable spatial (horizontal and vertical) as well as temporal (seasonal) variations are recorded in the distribution of phytoplankton. Pronounced variations in the vertical distribution of the phytoplankton standing crop appear during the periods of thermal stratification (late spring, summer and early autumn). However, diatoms and cyanobacteria remain the most influential groups also in the vertical distribution of the phytoplankton. Water blooms are occasionally observed in limited areas of the southern region of Lake Nasser mainly due to the florishment of the cyanobacterium Microcystis aeruginosa.

Plant-like traits associated with metabolism of Trypanosoma parasites.

Trypanosomatid parasites cause serious diseases among humans, livestock, and plants. They belong to the order of the Kinetoplastida and form, together with the Euglenida, the phylum Euglenozoa. Euglenoid algae possess plastids capable of photosynthesis, but plastids are unknown in trypanosomatids. Here we present molecular evidence that trypanosomatids possessed a plastid at some point in their evolutionary history. Extant trypanosomatid parasites, such as Trypanosoma and Leishmania, contain several "plant-like" genes encoding homologs of proteins found in either chloroplasts or the cytosol of plants and algae. The data suggest that kinetoplastids and euglenoids acquired plastids by endosymbiosis before their divergence and that the former lineage subsequently lost the organelle but retained numerous genes. Several of the proteins encoded by these genes are now, in the parasites, found inside highly specialized peroxisomes, called glycosomes, absent from all other eukaryotes, including euglenoids.

Virus-like particles in both nucleus and cytoplasm of Euglena viridis (Euglenophyceae)

Ultrastructural examination of a green euglenoid alga, Euglena viridis, from an urban ditch in Korea revealed virus-like particles within both the cytoplasm and nucleus. The particles are 340-380 nm in diameter and hexagonal with two electron-dense layers near the protein capsule and electron-opaque material in the center. Structural modifications of cell organelles and probable lysis of host cells suggest that virus-like particles may play a role for natural control of green euglenoid blooms in the fresh waters. This is the first report on the presence of virus-like particles in the class Euglenophyceae, a well-known group of algal blooming.

SEASONAL AND SPATIAL VARIATION IN EPIPELIC DIATOM ASSEMBLAGES IN THE SEVERN ESTUARY

The species composition of epipelic algal assemblages on intertidal mudflats was investigated at three sites in the Severn estuary, England, between March 1990 and February 1991. Diatoms were the dominant algal group, comprising greater than 95% of living cells in 100 out of 106 lens tissue samples. Euglenoid algae were abundant at one site during the summer months. Although over 60 diatom taxa were identified, only 15–20 species occurred regularly, with 12 species being dominant in the samples. Upper and middle shore diatom assemblages were dominated by Navicula pargemina during the spring and autumn, and by Nitzschia epithemioides during the early summer months. High relative abundances of Rhaphoneis minutissima were recorded at lower shore stations throughout the year and on upper and middle shores during the winter months. These lower shore assemblages contained high proportions of epipsammic species (Coscinodiscus sp., Cymatosira belgica). Principal component scores (obtained from assemblage composit...

X-ray and dissolution studies of paramylon storage granules fromEuglena

Paramylon is the β-1,3 glucan storage carbohydrate in the euglenoid algae. Mature paramylon granules are highly crystalline, fibrillar, and have a complex substructure. X-ray diffraction was used to demonstrate that mature paramylon granules are much more crystalline than immature granules. Freeze-etch electron microscopy showed that in mature granules, the microfibrils are organized in highly ordered arrays while the microfibrils of immature granules are less organized. The data suggest that the high crystallinity of paramylon is due to higher-order aggregates of microfibrils and the interaction of water with the microfibrils. The dissolution of paramylon was recorded by darkfield videomicroscopy. In a 0.5 N NaOH solution, paramylon dissociates in a regular manner into its constituent 4 nm microfibrils, and the central region of the granule is the last remaining refractile area during the dissolution process.

THE INTRAMEMBRANOUS PARTICLE PROFILE OF THE PARAMYLON MEMBRANE DURING PARAMYLON SYNTHESIS IN EUGLENA (EUGLENOPHYCEAE)1

ABSTRACTParamylon is the β‐1, 3‐glucan storage product in euglenoid algae. It is a fibrous crystal that occurs as membrane‐bound granules in the cytosol. The role of the surrounding membrane in paramylon synthesis was investigated by the use of freeze‐etch electron microscopy. When Euglena gracilis Klebs strain Z (Pringsheim) cells were frozen in supercooled liquid nitrogen, the fracture plane primarily was throuh the paramylon membrane. A large intramembranous particle (IMP, mean diam range 5.6‐6.5 nm) and a small IMP (mean diam range 9.6‐10.3 nm) were predominant in both PF (protoplasmic fracture) and EF (exoplasmic fracture) faces of the paramylon membrane. During paramylon synthesis induction, the ratio of small to large IMPs increased in both fracture faces. The IMP density decreased in both fracture faces concomitant to paramylon synthesis increase. These changes in IMP profile and density suggest that the paramylon membrane is involved in the synthesis of paramylon.

Metabolism of mutagenic polycyclic aromatic hydrocarbons by photosynthetic algal species

Polycyclic aromatic hydrocarbons (PAH) known to produce carcinogenic and mutagenic effects have been shown to contaminate waters, sediments and soils. While it is accepted that metabolites of these compounds are responsible for most of their biological effects in mammals, their metabolism, and to a large extent their bioactivity, in aquatic plants have not been explored. Cultures of photosynthetic algal species were assayed for their ability to metabolize benzo[ a]pyrene (BaP), a carcinogenic PAH under conditions which either permitted (white light) or disallowed (gold light) photooxidation of the compound. Growth of Selenastrum capricornutum, a fresh-water green alga, was completely inhibited when incubated in white light with 160 μg BaP/1 medium. By contrast concentration at the upper limit of BaP solubility in aqueous medium had not effect on algal growth when gold light was used. BaP quinones and phenol derivatives were found to inhibit growth of Selenastrum under white light incubation. BaP phototoxicity and metabolism were observed to be species-specific. All 3 tested species of the order Chlorococcales were growth-inhibited by BaP in white light whereas neither the green alga Chlamydomonas reinhardtii nor a blue-green, a yellow-green or an euglenoid alga responded in this fashion. Assays of radiolabeled BaP metabolism in Selenastrum showed that the majority of radioactivity associated with BaP was found in media as opposed to algal cell pellets, that the extent of metabolism was BaP concentration dependent, and that the proportion of various metabolites detected was a function of the light source. After gold light incubation, BaP diols predominated while after white light treatment at equal BaP concentrations, the 3,6-quinone was found in the highest concentration. Extracted material from algal cell pellets and from media was tested for mutagenicity in a forward mutation suspension assay in Salmonella typhimurium using resistance to 8-azaguanine for selection. Direct-acting mutagens were detected in extracted media from incubation of Selenastrum with 400 μg BaP/1 for 1 day in gold light. Extracts of media from algae incubated in gold light from 1 to 4 days with 1200 μg BaP/1 were found to have direct-acting mutagens as well as those requiring further metabolism.

Spontaneous “Depolyploidization” of Cells in Amoeba Clones with Increased Nuclear DNA Content

Summary The ultrastructure and taxonomic position of the colourless flagellate Apusomonas proboscidea Alexeieff , a member of coprophilic and freshwater faunas, has been studied for the first time. The following features have been revealed as a result of examination of ultra-thin sections. Nearly all the body of the flagellate is covered by a thick five-layered membrane. An exception is the ventral groove lined with a unit membrane. In the groove there are two flagella, the anterior and the posterior, both of whiplash type. Their kinetosomes are located in the distal part of the proboscis. Three bands of microtubules, emerging from the basal apparatus of the flagella, pass inside the proximal part of the proboscis. One of them looks like a multilayered structure. There is an electron-dense rodlike body at the base of the proboscis. The only dictyosome of the Golgi apparatus lies close to it. The mitochondria contain tubular cristae. The nucleus belongs to the vesicular type, with a well pronounced nucleolus. The cytoplasm is clearly differentiated into endoplasm and a denser ectoplasm. Ingestion of food (bacteria) occurs in the rear part of the ventral groove (the ventral pouch). The unique pattern of the cell structure of A. proboscidea does not allow to include it into any of the known groups of flagellates. According to some features, this species is compared with euglenoid algae, the bicosoecids, and with some other flagellates of unclear taxonomic position.