Ephedra Plants Research Articles

Ephedra alenda from the Algerian Sahara: Ethnobotanical Investigation, Evaluation of Total Polyphenols, Antioxidant Potential and Antibacterial Properties

Background: This study is part of the contribution to the development of the medicinal plant Ephedra alata from the region of Bechar, Algeria. This work aimed to measure yields, total phenols, total flavonoids, antioxidant capacity and antibacterial evaluation. Methods: In this laboratory investigation during March 2023 to December 2023, the samples were macerated; total phenolic and flavonoids contents were analyzed using a colorimetric method, while antioxidant capacity was assessed through DPPH. The antibacterial essay was carried out by the disc diffusion method on a solid medium using Muller Hinton. Result: Phytochemical screening confirms the presence of alkaloids, flavonoids, free quinones, reducing sugars, saponins, sterols, tannins and terpenes. Methanol extract represents the highest yield (4.41%), followed by butanol extract (3.3%), ethyl acetate extract (1.25%) and dichloromethane extract (0.69%). The dosage carried out revealed the content of plyphenols and flavonoids in the methanol extract was (175.73±0.25 μg EAG/mg DE) and (35.2±0.17 μg QE/mg DE), respectively. The evaluation of the antioxidant effect of the crude extracts by free radical scavenging DPPH gave the IC50 values of the extracts methanol, butanol, ethyl acetate and dichloromethane (0.170, 0.244, 0.324 and 2.23 mg/mL), respectively. The investigation into antibacterial activity revealed that the methanol extract significantly inhibited all tested bacteria, while the dichloromethane extract showed the lowest inhibition of Escherichia coli.

Effect of Hydralcoholic Extract of Dafneh on Expressin Level of MAPK8 and PTK2 Genes and Cell Viability of Ovarian Cancercell Lines (A2870S)

Introduction: Ovarian cancer, as an aggressive epithelial tumor, remains one of the leading causes of cancer-related mortality in women. Regarding to the side effects of chemical drugs, medicinal plants, according to their unique properties such as cheapness, naturalness and availability, and without any significant side effects, medicinal plants have recently been considered in the prevention of diseases. In this laboratory research, the cytotoxic effect of hydroalkolic extract of Daphne mucronata Royle on cell viability of A2780 cancer cell and the expression of MAPK8 and PTK2 genes in the cells treated with the Ephedra plant extract during three-time interval 24,48 and 72 hours after treatment were investigated. Methods: The inhibitory effect of hydroalcholic extact of D. mucronato on targeted cells was done using MTTassay then, expression level of MAPK8 and PTK2 genes in cells treated with plant extract were investigated using qRT-PCR method. Data analyses were done using GraphPad prism software. Results: Regarding to the results of cell viability, IC50 rate for 24, 48 and 72h after treatment were determined as 105.40, 85.98 and 81.38µg/mL, respectively. Expression analysis of tested genes showed that hydroalcoholic plant extract of D. mucronato had not significant effect on expression of targeted genes (Pvalue≤0.05) so that there was no significant difference on their expression level compared to the control. Conclusion: According to the results, it can be concluded that D. mucronato extract had a significant inhibitory effect on treated A2870s cancer cells, but it was not able to change the expression level of genes involved in anticancer activities and its molecular pathways. The use of bio-markers and other gene pathways is suggested for additional studies.

Taxonomic Revision of Genus Ephedra Tourn. ex L. in Egypt with Intra-Gender Diversity in Morphometric Traits and Fatty Acid Composition.

The genus Ephedra Tourn. ex L. (Ephedraceae) still exhibits taxonomic complexity that has not yet been resolved. This study aimed to determine the taxonomic identity of the Ephedra species in Egypt and identify the fatty acid profile and its diversity at the gender level as a taxonomic tool for specimens lacking reproductive cones. The current study provides a pioneering approach that distinguishes Ephedra species at the gender level. A total of 120 fresh individuals were collected from 20 locations representing different habitats where Ephedra plants grow in Egypt. In addition, herbarium specimens were deposited in Egyptian herbaria. The studied morphological traits included 30 vegetative characteristics and 72 traits of the reproductive organs of both genders. The fatty acid content was measured using gas-mass chromatography (GC-Mass). The taxonomic revision revealed that the Genus Ephedra was represented in the Egyptian flora by five species, Ephedra alata in section Alatae and E. aphylla, E. ciliata, E. foemina, and E. pachyclada in section Ephedra. South Sinai hosts these five species and represents the center of diversity for this genus in Egypt. The vegetative characteristics were subjected to principal component analysis (PCA), which revealed a distinct separation of the five studied species. Similarly, the cone traits treated by hierarchical clustering revealed intra-gender variations. The taxonomic key was developed based on the morphological traits to distinguish the studied species at the gender level. In total, 51 fatty acids were identified from the studied species and grouped as 18 saturated, 16 monounsaturated, and 17 polyunsaturated fatty acids. In the absence of reproductive cones, the lipid content and fatty acid composition of the vegetative parts displayed significant interspecific and intra-gender variations. Therefore, fatty acids can be used to efficiently identify the studied species when they lack reproductive cones. This study proved the efficacy of a multidisciplinary approach to identify Ephedra species at the gender level and recommends this trend for future studies of this genus.

Ephedra: An anti-asthamatic medicinal plant

ailments such as cold, cough, asthma, fever and flu. It is distributed in many regions such as Asia, Europe, North Africa, Western North America and South America. It has more than 100 active compounds with effects. It contains flavonoids, alkanes, tannins, sugars and organic phenolic acids. It is used in the treatment of asthma, liver disease, skin disease and other diseases, the most important among the effectiveness of the treatment of the disease is COVID-19. It is considered an ancient group and is appreciated for its abundant fossil record. Ephedra, known as "Ephedra" in China, is a gymnosperm plant. It is a dry straw stalk associated with the lung and bladder meridians. Ephedra is one of the largest genera of the Ephedra family and is found in arid and semi-arid regions of the world. In traditional medicine in many countries, some of these species are frequently used to treat asthma, colds, flu, colds, fever, headaches, nasal congestion and cough. The chemical composition of the ephedra plant has been a focus of interest for decades due to its content of ephedrine alkaloids and its medicinal properties. Other chemical compounds such as phenolics and amino acid derivatives are also of interest and provide evidence-based support for the ethnomedical use of Ephedra. Medicinal plants contain many phytochemical compounds related to various treatments (Naiá et al., 2005; Ghoíbani, 2005). Therefore, this medicinal herb is used in various ephedrine formulations and has many adverse effects on diseases such as liver diseases, angle-closure glaucoma, kidney stones, neurodegenerative diseases and heart toxicity. Indian Ayurveda is a traditional herbal medicine with a long history and strong foundations. Medicinal plants play an important role in the prevention and treatment of human diseases. This plant usually grows on dry rocks and soil because it needs high, dry mountain forests to grow. Many parts of plants such as branches and roots are used in various applications for medicinal purposes. For example, the dry part of the plant is used in vartonic medicine systems such as Ayurveda, Siddha and traditional Chinese medicine to treat many diseases such as asthma, hay fever, pain or inflammation, lung disease, heart disease. Aches, coughs, and colds are considered flu-like symptoms.

Comparison of Non-ephedrine Constituents from Ephedra Plants Cultivated in Japan.

Ephedra plants, the main components of which are ephedrine alkaloids, are used as traditional medicines in Eastern Asian countries. In this study, we isolated non-ephedrine constituents from various Ephedra plant species cultivated in Japan. HPLC analysis suggested that kynurenic acid and its derivatives accumulated in a wide range of Ephedra plant species. Furthermore, a large amount of (2R,3S)-O-benzoyl isocitrate has been isolated from E. intermedia. This study suggests that Ephedra plants have diverse non-ephedrine constituents.

Modelling the amount of inputs needed for methamphetamine manufacture in Afghanistan.

The use and manufacture of methamphetamine has increased in Afghanistan in recent years. Recent research and reports have pointed to the ephedra plant, which grows wildly, as a key source of ephedrine used in the manufacture of methamphetamine. This paper aimed to estimate the relative efficiencies and scale of inputs required to manufacture methamphetamine in Afghanistan. Monte Carlo simulations model of the amount of ephedra or cold medications needed to render a pure kilogram of methamphetamine in Afghanistan, accounting for uncertainty in ranges of key parameters informed from the literature and elsewhere. Final estimates were extrapolated to recent seizure totals. For dried ephedra, the median estimate is 196.8kg (25th-75th percentiles 119.3-346.6kg) needed to produce 1kg of methamphetamine compared with 27.9kg (25th-75th percentiles 21.9-36.8kg) for cold medications. Nearly 2.7t of methamphetamine were seized in Afghanistan in 2021. Assuming a purity range of 50%-90%, some 266-478 t of dried ephedra or 38-68 t of cold medication would need to have been processed. Simulated estimates show that considerable amounts of either ephedra or cold medication are needed to produce 1kg of methamphetamine in Afghanistan. This raises questions about the plausibility of ephedra as the dominant source of Afghanistan's methamphetamine.

New data on the scale insect pests of Ephedra foeminea in Greece

Summary The dioecious gymnosperm self-sown ornamental plant Ephedra foeminea Forssk (Ephedraceae: Gnetales) has a special interest due to its nutraceutical and pharmaceutical properties. The present study contributes with data about the phenology of the plant in Attica, Greece, and the complex of its scale insect pests (Hemiptera: Coccomorpha), Stotzia ephedrae (Newstead) (Coccidae) (morphology, phenology, biology, natural enemies), Dynaspidiotus ephedrarum (Lindinger) (morphology, natural enemies) and Leucaspis riccae Targioni Tozzetti (Diaspididae) (natural enemies), based on observations made from April 2021 to June 2023. Stotzia ephedrae which was the scale species found in higher numbers on E. foeminea is a univoltine, oviparous and biparental species recorded as settled 1st instar nymph on the shoots of E. foeminea from May to January. The fecundity of the scale fluctuated between 370 and 598 eggs per female. The results on the phenology of S. ephedrae contribute to the knowledge of the critical period for the pest control, i.e. from May to January during which the scale remains in the sensitive first instar. In addition, the records of parasitoids and predators in the colonies of the scale insects infesting E. foeminea provide information on the available natural enemies for potential use in biological control schemes of these pests.

A Modified 1H-NMR Quantification Method of Ephedrine Alkaloids in Ephedrae Herba Samples.

A previous 1H-NMR method allowed the quantification of ephedrine alkaloids; however, there were some disadvantages. The cyclized derivatives resulted from the impurities of diethyl ether were identified and benzene was selected as the better extraction solvent. The locations of ephedrine alkaloids were confirmed with 2D NMR. Therefore, a specific 1H-NMR method has been modified for the quantification of ephedrine alkaloids. Accordingly, twenty Ephedrae Herba samples could be classified into three classes: (I) E. sinica-like species; (II) E. intermedia-like species; (III) others (lower alkaloid contents). The results indicated that ephedrine and pseudoephedrine are the major alkaloids in Ephedra plants, but the concentrations vary greatly determined by the plant species and the collection locations.

Ephedrae Herba: A Review of Its Phytochemistry, Pharmacology, Clinical Application, and Alkaloid Toxicity.

Ephedrae Herba (Ephedra), known as "MaHuang" in China, is the dried straw stem that is associated with the lung and urinary bladder meridians. At present, more than 60 species of Ephedra plants have been identified, which contain more than 100 compounds, including alkaloids, flavonoids, tannins, sugars, and organic phenolic acids. This herb has long been used to treat asthma, liver disease, skin disease, and other diseases, and has shown unique efficacy in the treatment of COVID-19 infection. Because alkaloids are the main components causing toxicity, the safety of Ephedra must be considered. However, the nonalkaloid components of Ephedra can be effectively used to replace ephedrine extracts to treat some diseases, and reasonable use can ensure the safety of Ephedra. We reviewed the phytochemistry, pharmacology, clinical application, and alkaloid toxicity of Ephedra, and describe prospects for its future development to facilitate the development of Ephedra.

Biochemical characteristics and mineral elements of some Ephedra plant species

This study aimed to determine and compare some biochemical characteristics and mineral elements in rare medicinal plants Ephedra equisetina Bunge. and E. przewalskii Stapf. in Mongolia. In 2017, we identified several biochemical characteristics in aerial parts of E. equisetina and E. przewalskii, such as moisture, total ash, protein, lipid, and total carbohydrate, as well as 17 elements. Proteins were determined by the Kjeldahl method, lipid was determined by the Soxhlet method, moisture and total ash were determined by weighing essay, and mineral elements were dissolved in concentrated acids using an inductively coupled plasma optical emission spectrophotometer (ICP-OES). The study’s findings, in particular the moisture content (4.7%), total ash content (13.1%), protein content (7.1%), lipid content (0.83%), total carbohydrate content (20.1%), and elemental content Ca-59.05 mg/g, K-93.7 mg/g, Mg[1]11.3 mg/g, P-13.7 mg/g, and Na-2.24 mg/g are all contained in E. equisetina. E. przewalskii contains the following percentages of moisture: 5.21%, total ash: 11.9%, protein: 7.11%, lipid: 1.2%, total carbohydrate: 15.5%, and element content, particularly Ca: 57.3 mg/g, 24.2 mg/g, Mg: 4.4 mg/g, P: 2.28 mg/g, and Na: 1.69 mg/g. As a result, E. equisetina contained the highest concentrations of ashes and total carbohydrates, whereas E. przewalskii had the highest concentrations of moisture, proteins, and lipids. There was also a significant difference in biochemical characteristics between the two species (p<0.002). The highest other elements in the two species of Ephedra were elements with the highest concentrations of Ca, K, Mg, P, and Na. Elements contents had a high difference between species variances (p><0.079) and significance of statistics. Our results showed that E. equisetina and E. przewalskii have similar habitat and soil types. However, there is some difference in biochemical characteristics and mineral element contents. E. equisetina was found to have a higher content of 13 elements, ash, and carbohydrate than E. przewalskii. In the future, there is an opportunity to conduct a detailed study of two species of plants, to study the vast heritage of traditional Mongolian medicinal plants, to provide explanations from the point of view of modern science, and to introduce them into modern medicine. Зарим зүйл зээргэний биохимийн үзүүлэлт болон эрдэс элементүүд Энэхүү судалгаа нь Монгол оронд ургадаг Шивлээхэй зээргэнэ, Хонин зээргэнэ зэрэг ховор эмийн ургамлын зарим биохимийн шинж чанар, эрдэс элементүүдийн агууламжийг харьцуулан тодорхойлох зорилготой юм. Баянхонгор аймгийн нутаг дэвсгэрт орших Залаа уул, Цагаан богд уулнаас судалгааны 2 зүйл зээргэний газрын дээд хэсгийг 2017 оны 6-р сарын сүүл үед цуглуулан чийг, үнс, уураг, липид, нийт нүүрс ус, мөн 17 элементийг тодорхойлсон. Ингэхдээ уургийн агууламжийг Кьелдалийн аргаар буюу шатаах, нэрэх, титрлэх гэсэн 3 үндсэн зарчмаар тодорхойлсон. Тослогийн агууламжийг эфирт уусгаж, тосыг эфирээр дэвтээж, халааж, эфирийн буцалгах температур 50℃ орчимд эфир ууршиж, давтан ууршуулах зарчмаар жингийн аргаар чийг болон үнслэгийн агууламжийг мөн хатаах, шатаах зарчмаар жингийн зөрүүгээр тооцсон, мөн эрдэс элементийн агууламжийг индукци холбоост плазмын оптик шингээлтийн спектрофотометрийн багажаар (ICP-OES) даралтад богино долгионы дээж задлагч ашиглан концентрацитай хүчлүүдээр уусган тодорхойлолтыг явуулсан. Судалгааны үр дүнд: Шивлээхэй зээргэний чийглэг 4.7 %, үнс 13.1 %, уураг 7.11 %, өөх тос 0.83 %, нийт нүүрс ус 20.1 %, элементүүд ялангуяа Са 59.05 мг/г, К 93.7 мг/г, Мg 11.3 мг/ , P 13.7 мг/г, Na 2.24 мг/г агууламжтай, Хонин зээргэний чийг 5.21 %, үнс 11.9 %, уураг 7.11 %, өөх тос 1.2 %, нийт нүүрс ус 15.5 %, Са 57.3 мг/г, 24.2 мг/г, Мg 4.4 мг/г, P 2.28 мг/г, Na 1.69 мг/г агууламжтай байв. Иймд судалгааны үр дүнгээс үнслэг болон нийт нүүрс усны агууламж Шивлээхэй зээргэнэд хамгийн их, харин чийг, уураг, тослогийн агууламж Хонин зээргэнэд хамгийн их байсан ба биохимийн үзүүлэлт зүйл хооронд ялгаатай (P < 0.002) байв. Судалгаанд авсан 2 зүйл зээргэнэд Ca, K, Mg, P, болон Na зэрэг макроэлементүүдийн агууламж нь бусад микроэлементүүдээс өндөр байсан ба элементүүдийн агууламж зүйл хооронд ялгаа (P < 0.079) бага боловч макроэлементийн агууламж зүйл хооронд ялгаатай (P < 0.05), микроэлементүүд хооронд статистикийн ялгаа ажиглагдсангүй. Энэхүү судалгааны үр дүнд амьдрах орчин, хөрсний төрөл ижил боловч биохими, эрдэс элементийн агууламжаараа ялгаатай болохыг бид илрүүлсэн. Шивлээхэй зээргэнийг Хонин зээргэнэтэй харьцуулахад 13 элемент, үнслэг, нүүрс усны агууламж өндөртэй болохыг тогтоосон. Цаашид хоёр төрлийн ургамлын нарийвчилсан судалгаа хийж, Монголын уламжлалт эмийн ургамлын асар их өвийг судлах, орчин үеийн шинжлэх ухааны үүднээс тайлбар өгөх, орчин үеийн анагаах ухаанд нэвтрүүлэх боломжийг судлах шаардлагатай байна. Түлхүүр үгс: Зээргэнэ, нийт үнслэг, нийт нүүрс ус, чийг, уураг, тослог элементүүд

New evidence for Holocene vegetation variations and their drivers in an East Asian sandy land: A perspective from aeolian sand-paleosol deposits

Past vegetation responses to climate change in semi-arid and arid regions are not yet well understood, especially in northeastern China. This study provides new evidence for long-term vegetation changes and their possible driving forces in northeastern China's Songnen sandy lands by employing a multiproxy approach applied to well-dated aeolian sand-paleosol sediments. Pollen analyses and data on total organic carbon (TOC) are used to reconstruct paleovegetation dynamics whereas grain size data are used for interpreting independent paleoclimate changes. Results show that Chenopodiaceae and Ephedra plants dominated in a brief early period that was followed by an abrupt transition to Artemisia and Asteraceae plants with the encroachment of dry steppes between 9000 and 7000 cal yr BP. From 7000 to 3200 cal yr BP, Chenopodiaceae plant dominated the region. During the 3200 to 400 cal yr BP interval Ulmus, Salix, and Tribulus abundance increased while Chenopodiaceae abundance decreased. After 400 cal yr BP, Poaceae plants generally expanded and the regional landscape alternated between dry steppe and steppe. In addition, changes in the regional vegetation exhibit 1000 yr periodic oscillations especially during 9000 to 4500 cal yr BP. By comparing these features with regional climate change, we suggest that regional paleovegetation dynamics were linked to East Asia Summer Monsson (EASM) circulation. These findings reveal a pronounced long-term relationship between vegetation and climate change in semi-arid regions worldwide.

Phytochemical Profile, Antioxidant and Antibacterial Activities of Ephedra alata Extract against Pathogenic Bacteria

Plants have been a source of important chemical compounds that can be used for treatment of different disease. Natural products in plants also are a source of active compounds and can be considered an alternative to synthetic molecules with high antioxidant potential. Objective of this study was to determine the antioxidant and antibacterial potential of Ephedra alata extract. Methods: Phytochemical values namely, total phenolic, DPPH radical scavenging effect were studied by established methods. Antimicrobial properties of Ephedra alata was tested using cup-plate diffusion method and disc diffusion.
 Results showed numerous secondary metabolic products including in plant Ephedra alata extract such as Flavonoids, Saponins, Tannins were detected. And other metabolic products such as Steroids and Cardinolids are absent. The yield for the aqueous extract was 9.89%. However, the polyphenols extract content was equal to 0.004243 (mg GAE/ml extract. Effectiveness of antioxidant plant using DPPH free root was estimated at IC50= 0.901 mg/ml for aqueous extract. In antibacterial screening, the extract showed antibacterial power with zone of inhibitions compared to positive controls Penicillin against multi-resistant germs such as: Pseudomonase aeruginosa and Serratia fonticola responsible of many infectious. Growth inhibition varies with bacterial species and concentration of Ephedra alta extract.

Ephedra mediated green synthesis of gold nanoparticles (AuNPs) and evaluation of its antioxidant, antipyretic, anti-asthmatic, and antimicrobial properties

The eco-friendly green bio-synthesis of Ephedra-AuNPs was constructed from Ephedra plant extract. The synthesis process was optimized using different volumes of Ephedra-extract, 10-3M (HAuCl4·3H2O) solution, reaction temperature, time, and pH of the solution. Where, 4 mL of Ephedra-extract, 6 mL of 10-3M (HAuCl4·3H2O) solution at 25 °C for 3 h at a pH of 4 are showed the optimum reaction parameters respectively. The characterization of AuNPs was verified by UV–vis. spectrophotometer, FTIR, microscopic techniques (TEM, HRTEM), Zeta potential, and X-ray techniques (XRD, EDX, XPS). The nanoparticles are extremely important materials in emerging the future sustainable technologies for the living beings. The AuNPs were employed in biological assays where ABTS assay used to investigate the antioxidant activity. The in-vivo study of AuNPs was executed to study the anti-pyretic and anti-asthma activities of Ephedra-AuNPs. Ephedra-AuNPs of 1.3 nm to 15.6 nm size were achieved which have as importance as proficient to bind with the biological systems. The Ephedra-AuNPs prepared exploiting Ephedra-extract which is considered to be influential anti-asthma agent and antipyretic agent reduced the fever by 83.3 % at 32μg/g/day. Further the Ephedra-AuNPs used to scrutinize the anti-bacterial activities for Staphylococcus aureus, Listeria moncytogenes, Bacillus subtilis, Escherichia coli, Pseudomonas aeruginosa, and Salmonella typhimurium, and anti-fungal activities on Candida albicans, Aspergillus nigra and Aspergillus flavus. The synthesized Ephedra-AuNPs exhibited great potential activities comparable to the standard drugs in case of Staphylococcus aureus, Escherichia coli, Candida albicans with the zone of inhibition of 25 ± 0.5 nm, 26 ± 0.6 nm and 24 ± 0.7 nm respectively. It is believed that the synthesized Ephedra-AuNPs to be a hopeful option intended for diverse biological applications.

Seasonal variation of alkaloids and polyphenol in Ephedra sinica cultivated in Japan and controlling factors.

We investigated the seasonal variation of alkaloids (ephedrine and pseudoephedrine), total polyphenol, and sugar contents in Ephedra sinica cultivated in Japan and elucidated the controlling factors for the variation. In 2018, alkaloids and polyphenol contents increased dramatically from May to July, decreased to their lowest in October, and slightly increased again in November. The reduction of alkaloids and polyphenol contents in the autumn may be affected by precipitation in summer. In 2020, alkaloids and polyphenol contents started to decrease in late July when rainfall was abundant from July to August. In contrast, sucrose and starch contents continued to increase until September and remained high until October. Vascular bundles and fiber developed, and herbal stem weight increased from August to October. Alkaloids and total polyphenol contents tended to increase in November. At the same time, starch and sucrose contents decreased dramatically, whereas glucose and fructose contents increased. Sugar content decreased from October and was lowest in November. The seasonal variation of alkaloids and total polyphenol contents exhibited a contrasting tendency to the seasonal variation of sugar content and tissue development. The seasonal variation of alkaloids and total polyphenol contents was caused by the seasonal variation of sugar content and tissue development. In addition, it is suggested that anatomy may be used for alkaloids content estimation in Ephedra plants.

Rapid Screening of Proanthocyanidins from the Roots of Ephedra sinica Stapf and its Preventative Effects on Dextran-Sulfate-Sodium-Induced Ulcerative Colitis.

Proanthocyanidins (PACs) have been proven to exert antioxidant and anti-inflammatory effects. In this study, ultra-performance liquid chromatography (UPLC) coupled with linear ion trap-Orbitrap (LTQ-Orbitrap) high-resolution mass spectrometry was first employed to systematically screen PACs from the roots of Ephedra sinica Stapf, and its ethyl acetate extract (ERE) was found to contain PAC monomers and A-type dimeric proanthocyanidins, which were tentatively identified through characteristic fragmentation patterns. In vitro, the antioxidant activity of ERE was tested through 2,2-diphenyl-1-picrylhydrazyl (DPPH) and 2, 2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) assays. In addition, ERE could inhibit the production of nitric oxide (NO) in lipopolysaccharide (LPS)-induced RAW 264.7 cells. In vivo, the preventative effects on dextran-sulfate-sodium-induced ulcerative colitis in mice was investigated. Mice were administered with ERE for 21 days, and during the last 7 days of the treatment period dextran sulfate sodium (DSS) was used to induce experimental colitis. The results showed that ERE treatment alleviated DSS-induced colitis, which was characterized by decreases in disease activity index (DAI) scores, spleen index and colon levels of TNF-α and IL-6, mitigation in pathological damage and oxidative stress and increases in colon length and IL-10 levels. In conclusion, supplementation of PACs derived from ERE may offer a new strategy for the treatment of ulcerative colitis. Moreover, our research will greatly facilitate better utilization of Ephedra plants.

Antimicrobial, antioxidant and anticancer activity of Ephedra alata growing in East of Libya1

Introduction: The plant Ephedra alata belongs to the Ephederiaceae family. These plants distributed in North Africa, Palestine, Libya, Egypt, Saudi Arabia, and Iraq. Ephedra alata has been commonly used in folk medicine in Libya and most of the Arabian countries for treatment of asthma, hay fever, and the common cold. Aim: This study aimed to investigate the phyto-constituents and to assess its anti-microbial, antioxidant activities, in addition, to study its cytotoxic effect. Methods: The aerial part dried of the plant was subjected to a phytochemical screening and investigated for their antimicrobial activity, antioxidant effect, and cytotoxic effects. Results: The phytochemical investigation of the methanolic extracts of Ephedra alata revealed the presence of alkaloids, carbohydrates, flavonoides, steroids, tannins, and phenolic compounds. The results of anti-microbial activity revealed that; there was a significant antibacterial activity against representatives of Gram positive (Staphylococcus aureus, Bacillus subtilis) and Gram-negative (Escherichia coli, Pseudomonas aeruginosa), while there was no antifungal effect against Aspergillusflavus and Candida albicans. In terms of antioxidant activity, the methanolic extract of Ephedra alata showed a significant scavenging effect on the DPPH radical, compared to gallic acid. The results showed an honest correlation between antioxidant activity and flavonoid content. The plant extract displayed a significant cytotoxic effect on MCF7with IC50 and IC90 comparing with doxorubicin as a positive control. Conclusion: The results indicated that the extract of Ephedra alata had significant antioxidant, and cytotoxic effects in addition to their antimicrobial activity

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

The inhibitory Effect of different Ephedra plant extracts on the Aspergillus flavus growth and Aflatoxin B1 gene Expression

The inhibitory Effect of different Ephedra plant extracts on the Aspergillus flavus growth and Aflatoxin B1 gene Expression

Isolation and Characterization of Fungal Endophytes Isolated from Medicinal Plant Ephedra pachyclada as Plant Growth-Promoting.

Endophytic fungi are widely present in internal plant tissues and provide different benefits to their host. Medicinal plants have unexplored diversity of functional fungal association; therefore, this study aimed to isolate endophytic fungi associated with leaves of medicinal plants Ephedra pachyclada and evaluate their plant growth-promoting properties. Fifteen isolated fungal endophytes belonging to Ascomycota, with three different genera, Penicillium, Alternaria, and Aspergillus, were obtained from healthy leaves of E. pachyclada. These fungal endophytes have varied antimicrobial activity against human pathogenic microbes and produce ammonia and indole acetic acid (IAA), in addition to their enzymatic activity. The results showed that Penicillium commune EP-5 had a maximum IAA productivity of 192.1 ± 4.04 µg mL−1 in the presence of 5 µg mL−1 tryptophan. The fungal isolates of Penicillium crustosum EP-2, Penicillium chrysogenum EP-3, and Aspergillus flavus EP-14 exhibited variable efficiency for solubilizing phosphate salts. Five representative fungal endophytes of Penicillium crustosum EP-2, Penicillium commune EP-5, Penicillium caseifulvum EP-11, Alternaria tenuissima EP-13, and Aspergillus flavus EP-14 and their consortium were selected and applied as bioinoculant to maize plants. The results showed that Penicillium commune EP-5 increased root lengths from 15.8 ± 0.8 to 22.1 ± 0.6. Moreover, the vegetative growth features of inoculated maize plants improved more than the uninoculated ones.

Case studies on illegal production of ephedrine/pseudoephedrine within Fujian China

Ephedrine/pseudoephedrine (EPH) is the most common precursor for the manufacture of methamphetamine and is controlled within China via criminal law and government regulations. Therefore, it is of great significance to systematically study the cases of illicit production of EPH in order to aid timely investigation into the production of precursor drugs. According to the literature, there are no comprehensive case studies on the illicit production of EPH. To address this, 50 cases involving the illicit production of EPH from Fujian Province in China were comprehensively explored and the quantitative data of the 762 collected samples were directly compared. In terms of the timeframe these cases occurred in, the results show that the number of such cases in Fujian Province increased significantly from 2012 to 2013 (10 cases -15 cases), but the number of cases decreased rapidly in 2016 (4 cases). Across the region of interest, the illegal production of EPH was mainly observed in Longyan, accounting for 32 cases (64.0 % of the total cases). Forty-two cases (84.0 % of the total cases) were located in remote mountains, abandoned pig farms, chicken farms and factories. In terms of the synthetic methodology used, initially (up until 2013) only the extraction of EPH from the ephedra plant and from commercially available tablets was observed. The manufacture of EPH via a direct chemical synthesis was only observed in this region after 2013 at which point a significant drop in the extraction methodologies was identified. The quality of the samples and the appearance of semi-finished products was shown to vary significantly across the cases with sample color ranging from light yellow, brown, tan for both seized solids and liquids. This data set gives some insights into the local issues specifically around EPH production in Chinese provinces and goes some way to help inform policing strategies.