Eosin Methylene Blue Agar Research Articles

Molecular detection of extended-spectrum β-lactamase-producing Escherichia coli from bat caves on Lombok Island.

The discovery of antibiotic-resistant Enterobacteriaceae bacteria in wild animals is an indication of their potential for wildlife as a reservoir. Bats are natural reservoir hosts and a source of infection for several microorganisms and have the potential to become vectors for the spread of zoonotic diseases. A study was conducted based on these characteristics to identify and detect the blaTEM gene in Eschericia coli isolated from bat excrements in Tanjung Ringgit Cave, East Lombok. Bat fecal samples were firstly inoculated onto eosin methylene blue agar media. Recovered bacterial isolates were further characterized using standard microbiological techniques. Antimicrobial susceptibility testing was done using the Kirby-Bauer disc diffusion method. blaTEM gene detection was carried out using polymerase chain reaction (PCR). Out of the 150 bat fecal samples obtained from Tanjung Ringgit cave, Lombok Island, Indonesia, 56 (37%) were positive for E. coli. Eight (8) out of the 56 E. coli isolates that underwent antimicrobial susceptibility testing using the disc diffusion method were confirmed to be multidrug-resistant as they exhibited resistance to at least three different classes of antibiotics. Out of the eight (8) multidrug resistance E. coli isolates recovered from fecal samples of bats, 2 (two) harbored the blaTEM gene. The discovery of the blaTEM gene in bat fecal samples indicates the potential for wild animals, especially bats, to spread ESBL resistance genes to the environment and to humans.

MICROBIOLOGICAL QUALITY AND SAFETY ASSESSMENT OF FRESHLY PREPARED FRUIT JUICES SOLD IN DIFFERENT AREAS OF LAHORE, PAKISTAN

Fruit juices are among the best food products with respect to the nutritional and medicinal applications. However, disaster can come along the way, as bacteria can cause spoiling of fruit juices through contaminated raw materials, extraction equipment and malpractice of handlers and results into the deleterious health effects. Numerous bacterial species including Streptococcus spp., Escherichia coli, Candida albicans, Staphylococcus aureus, Vibrio cholera, etc can be present in high concentrations in fruit juices. In the present study, a total of 164 bacterial strains were isolated from nine samples of fresh fruit juices (Carrot, Orange and sugarcane) from different areas in Lahore. Three media i.e., Nutrient agar, MacConkey agar and Eosin Methylene Blue agar (EMB) were used for enumeration and isolation of various bacterial genera. Among the total 164 isolated bacterial strains, 37 were recovered from sugarcane juice samples, 91 from carrot juice samples and 36 from orange juice samples. The most frequent strains were E. coli and Enterobaacter spp. which were most likely due to the contamination from water. A panel of 10 antibiotics including Erythromycin, Ceftizoxime, Ciprofloxacin, Tobramycin, Vancomycin, Ampicillin, Streptomycin, Polymyxin B, Levofloxacin, and Cephalexin was used to determine the antibiotics sensitivity (AST) status of the isolated strains. It was observed that Levofloxacin showed highest zones of inhibition against all the tested strains and overall, strains didn’t have significant resistance against the tested antibiotics. The practice of proper hand and fruit washing can minimize the potential threat of bacterial contamination in food products.

KELIMPAHAN DAN KARAKTERISTIK BAKTERI DALAM BAKASANG BIA GARU (Tridacna gigas L) [Abundance and Characteristics of Bacteria in Bakasang Bia Garu (Tridacna gigas)

Bakasang bia garu is a clam-based fermented product processed by the people of the Babar Islands, Maluku. Uncontrolled processing allows the presence of unwanted bacteria in these local food products. Preservatives added in the processing of bakasang bia garu are very diverse. This study aims to isolate and characterize lactic acid, halotolerant, and coliform bacteria from bakasang bia garu which are processed using different preservatives. Lactic acid bacteria were isolated using de Man Rogosa and Sharpe Agar (MRSA) media while halotolerant and coliform bacteria used Mannitol Salt Agar (MSA) and Eosin Methylene Blue Agar (EMBA) media, respectively. Characterization was carried out macroscopically and microscopically. The results showed that lactic acid bacteria were only found in bakasang with synthetic salt and vinegar preservatives of 3.5x103 CFU/g which was dominated by Pediococcus pentosaceous. Halotolerant and coliform bacteria have diverse characteristics that belong to the genera Staphylococcus, Escherichia, and Enterobacter. Bakasang bia garu needs to optimize its controlled processing to improve the quality of this local food product in the future

Hatching Failure and Success of Hawksbill Sea Turtles (Eretmochelys imbricata) in Semi-Natural Nests Karimunjawa.

Hatching success and failure is influences by the interaction between biotic and abiotic factors during the incubation period. Non optimal nest is susceptible to bacterial contaminated eggs during incubation period and hatchling morphology. The purpose of the study is to understand the relationship between environmental conditions of semi natural nest with bacteria contaminant, hatchlings allometry and abnormality. The method used was quantitative descriptive which are nest temperature and humidity measurement, hatchlings allometry measurement, bacteria observation of gram negative with EMB (Eosin Methylene Blue) agar, TPC (Total Plate Count), bacteria characteristic morphology and hatchlings abnormality observation. The result showed that semi natural nest have high temperature (30˚C) and high humidity (70%) caused smaller hatchlings and negative allometry growth, hatchlings abnormality and bacterial contaminant. TPC showed that the number of bacteria unhatched eggs (1,42 x ) more than hatched eggs (1,03 x ). The bacteria colonies were suspected to be from Enterobacteriaceae family according to microscopic and macroscopic morphological characteristic. Macroscopically, the bacteria morphology is dominated by a round shape, concentric surface, flat edges, flat elevation and pink color, meanwhile microscopic form is bacilli. There is significant correlation between environmental conditions of semi natural nest with hatchlings growth, hatchlings abnormality and eggshells bacteria

Phenotypic and genotypic characterization of multidrug resistant and extended-spectrum β-lactamase-producing Enterobacterales isolated from clinical samples in the western region in Cameroon

BackgroundThe 2017 World Health Organization (WHO) report has listed extended-spectrum β-lactamase-producing Enterobacterales (ESBL-E) as critical pathogens for public health and requiring urgently new antibiotics. The aim of this study was to characterize phenotypically and genotypically ESBL-E isolated among clinical samples in Dschang, Cameroon.MethodsA cross-sectional study was conducted during a four-month periods from February to May 2022 in the two biggest hospitals of Dschang. Clinical samples were collected and cultured on Eosin Methylene Blue agar. Suspected growing colonies were biochemically identified using the Enterosystem Kit 18R. Antimicrobial susceptibility testing (AST) was done using the Kirby Bauer disc diffusion method and interpretated according to the CA-SFM recommendations. ESBL phenotypes were double screened using CHROMagar™ ESBL and double disk synergy test (DDST). The detection of resistance genes was performed using conventional and multiplex PCR methods. Results were analyzed with SPSS (version 21) and a p-value < 0.05 was considered statistically significant.ResultsA total of 152 Enterobacterales were isolated among 597 clinical samples including urine, blood, cervico-vaginal, urethral swabs and wound samples. The overall prevalence of ESBL-Enterobacterales was 29.61% (45/152). The most represented ESBL species were Escherichia coli (n = 23; 51.11%), Klebsiella pneumoniae (n = 8; 17.78%) and Citrobacter freundii (n = 6; 13.33%).ConclusionThis study reveals the high burden of ESBL-E among clinical samples in the regional hospital in Dschang with the most common species being E. coli and K. pneumoniae. It confirmed the high occurrence of blaCTX−M and blaTEM among ESBL-E. The study suggests that implementing antimicrobial stewardship program and real-time surveillance of antimicrobial resistance are needed in the Western region of Cameroon. Moreover, the implementation of infection prevention and control measures (IPC) is essential to curb the dissemination of these bacteria from community to hospital settings. Implementation of national action plan to fight against antimicrobial resistance at the local levels is urgently needed.

Generation Time of Escherichia Coli Bacteria Based On Variaton In Eosin Methylene Blue Agar Media PH

Bacteria require optimum environmental conditions to support cell growth and reproduction. States that are less than optimal cause bacteria to adapt and can infect humans for invasion of other organs. The speed of bacteria to infect is influenced by the rate and time of generation of bacteria in multiplying cells. This study aims to determine the effect of variations in pH (4,8; 5,8; 6,8; 7,8; and 8,8) in Eosin Methylene Blue Agar (EMBA) media on the generation time of Escherichia coli bacteria. Researchers used the True Experiment Post Only Control Design and One Way ANOVA test. The results showed that at a variation of pH 4,8 there was no growth; pH 5,8 with a generation time of 1,5-24,9; pH 6,8 with a generation time of 1,5-21,7 minutes; pH 7,8 with a generation time of 1,6-22,3 minutes; and pH 8,8 with a generation time of 1,6-22,8 minutes. The study concludes is that there is a significant effect of the variation in pH of the EMBA media on the generation time of Escherichia coli bacteria with a p-value of 0,000 &lt; α 0,05, with the fastest generation time at pH 6,8.

Hand hygiene status and its associated factors among housemaids working in communal living residences in Jimma city, southwest Ethiopia

ObjectiveHand hygiene is a milestone, cost-effective, and convenient strategy to prevent the transfer of pathogenic micro-organisms. However, housemaids operating inside a kitchen can be the source of infection. In addition, hand hygiene among housemaids working in dwellings was underexplored. This study aimed to assess the hand hygiene status and associated factors among housemaids working in communal living residences in Jimma City, Southwest Ethiopia. MethodsA total of 230 housemaids were included in this cross-sectional study. Total samples were proportionally allocated for each residence and a simple random sampling technique was applied to select the study participants. Hand hygiene status and relevant characteristics were collected through face-to-face interviews and observations. Hand swab samples were collected and tested for bacterial contaminants. Then, it was inoculated aseptically using streak-plating methods on mannitol salt agar (MSA), MacConkey agar (MCA), salmonella-shigella agar (SSA), and eosin methylene blue (EMB) agar and then incubated at 37 °C for 24 h. Data was edited, cleaned, and double-entered into Epidata version 3.1 and then exported to the statistical package for social science statistics version 26 for further analysis. Binary logistic regression was used to identify associated factors. Statistically significant was declared at P value < 0.05. ResultsTwo hundred twenty-five housemaids were interviewed with a response rate of 97.8 %. The results showed that the proportion of good hand hygiene status among the housemaids was only 28.0 %. Although the majority of participants reported washing their hands frequently, the prevalence of bacterial contaminants on their hands was high at 72 %. The study identified several factors associated with hand hygiene status, including the occupational status of heads of households (AOR = 0.030, 95 % CI: 0.003, 0.348; P = 0.0050), the effectiveness of the heads of household (AOR = 13.955, 95 % CI: 1.442, 13.500; P = 0.0230), and the removal of accessories during handwashing (AOR = 20.844, 95 % CI: 2.190, 9.842; P = 0.0080). ConclusionOverall, the hand hygiene status of housemaids was found to be poor and influenced by demographics and other relevant characteristics. The study emphasizes the need for a multimodal strategy involving household heads, local and national authorities, and other stakeholders to raise awareness and advocate for hand hygiene to prevent communicable diseases in the wider community, particularly in the study area.

Prevalence of multidrug resistance and extended-spectrum beta-lactamase-producing Klebsiella pneumoniae from dairy cattle farm wastewater in East Java Province, Indonesia

Background and Aim: Antibiotic resistance in Klebsiella pneumoniae, especially extended-spectrum beta-lactamase (ESBL) producers, has become a global public health problem. This study aimed to estimate the prevalence of multidrug resistance (MDR) and ESBL-producing K. pneumoniae in wastewater from dairy farms. Materials and Methods: This study was conducted on dairy farms in East Java Province from June to October 2022. In total, 342 dairy farm wastewater samples were isolated on buffered peptone water media from six cities/regencies with the highest dairy cattle population in East Java. Samples were identified using MacConkey agar media, Gram-staining,eosin-methylene blue agar, and biochemical tests. In total, 14.32% (49/342) samples contained K. pneumoniae. Positive isolates were tested for antibiotic sensitivity. Klebsiella pneumoniae resistant to beta-lactam was confirmed using the double-disk synergy test to confirm the presence of ESBL-producing bacteria. Results: The percentage of antibiotic resistance in K. pneumoniae was 98% resistance to ampicillin, 67.3% to cefotaxime, 46.9% to tetracycline, 49% to ciprofloxacin, 98% to streptomycin, 14.3% to sulfamethoxazole–trimethoprim, and 83.7% to chloramphenicol. The prevalence of MDR in K. pneumoniae was 12.57% (43/342), with the highest prevalence in the five classes of antibiotics at 41.86% (18/43), and the prevalence of ESBL-producing K. pneumoniae was 5.55% (19/342), with the highest prevalence in the districts of Blitar and Pasuruan at 26.31% (5/19). Conclusion: Although the prevalence of ESBL-producing K. pneumoniae in wastewater samples from dairy farms was low, caution is recommended because they can be a reservoir for ESBL. Keywords: animal health, dairy cattle, extended-spectrum beta-lactamase, human health, Klebsiella pneumoniae, wastewater.

Bacteriological assessment of fruit pulp sold in supermarkets in São Raimundo das Mangabeiras, Maranhão State, Brazil

Natural fruit pulp is highly appreciated because it retains the flavor and nutrients of the fresh fruit. However, fruit pulp is susceptible to contamination by pathogenic bacteria, mainly because of improper handling and storage. Therefore, this study evaluated and quantified the presence of pathogenic bacteria in fruit pulp sold in São Raimundo das Mangabeiras, Maranhão, Brazil. Two fruit pulp samples each of açaí (A and B), acerola (C and D), cajá (E and F), cashew (G and H), and passion fruit (I and J) were obtained from supermarkets and subjected to the following microbiological analyses: enumeration of mesophilic bacteria using plate count agar; quantification of total (TC) and thermotolerant (TTC) coliforms using the multiple tube technique; qualitative detection of Escherichia coli on eosin methylene blue agar and that of Salmonella on xylose lysine base agar and enteric agar. Mesophilic bacteria were found to grow in all the samples, with the highest value obtained for the acerola pulp (sample D; average: 1.08 x 105 colony-forming units g-1). However, all samples were in accordance with the Brazilian legislation for this parameter. The most probable number of colonies (MPN g-1) of TC and TTC were ≥1,100 in açaí (sample A), cajá (sample E), and cashew (sample G) pulps, which is in disagreement with the maximum value allowed. E. coli and Salmonella were not found to grow in the samples evaluated in this study. Collectively, the data indicate inadequate handling and storage in the production chain of fruit pulp sold in the municipality of São Raimundo das Mangabeiras, suggesting that the population in the region is exposed to a probable risk of food contamination.

Isolation and Identification of Possible Pathogenic Bacteria on Carrots Sold at Community Market, Ahmadu Bello University, Zaria

Carrots (Daucus carota) are root vegetables that can be purple, red, yellow or white colour based on their pigmentation and variety. Due to the awareness of its high nutritional content such as vitamins, minerals and carotene, they are mainly consumed raw, possibly exposing one to the risk of being infected. Studies on the pathogenic Bacteria associated with fresh carrots sold in the community market at Ahmadu Bello University, main campus Samaru Zaria, were carried out using cultural techniques. Salmonella Shigella agar, MacConkey agar and Eosin methylene blue agar were the growth media for the isolation of the pathogenic Bacteria. Twelve fresh carrots were randomly bought from different food vendors in the community market, and then 10g of the outer layer (epidermal) scrapings were collected from each sample and homogenized in 90 ml of buffered peptone water. It was then serially diluted and 0.1ml of each 104 and 105 dilutions were plated on EMB, SSA, and MacConkey agar. Isolates were identified by gram staining and biochemical tests. The bacteria were identified to be Proteus species, Citrobacter species, Klebsiella species, and Salmonella species. Proteus spp was predominantly isolated among the bacterial isolates (41%) followed by Citrobacter spp (25%), Klebsiella spp (17%) and Salmonella spp (17%). These organisms may have been introduced to the carrots during growth, harvesting, handling, storage and distribution. The presence of the organisms is a public health risk because of the diseases known to be caused by them. It is therefore imperative that adequate hygienic practices be put in place during the cultivating and handling of carrots. A high level of susceptibility was observed in Ciprofloxacin at (100%) and Augmentin at (50%), while the high level of resistance was observed to be high in Gentamicin at (100%).

Correlation between Escherichia coli resistant gene isolated from stool samples of children under five years and that from consumed water

Diarrheagenic Escherichia coli (DEC) causes enteric infections and diarrhea, especially in young children. Kenya reports around 2.6 million cases and 7,000 deaths annually due to diarrhea. Antibiotic-resistant DEC strains are a significant public health concern, complicating treatment. The objective of this research was to correlate children's water consumption and antimicrobial-resistant DEC development. The study sampled 1124 children under five with diarrhea in Nakuru, Kenya, using a case-control design. Among 384 eligible children, 192 cases showed Amoxicillin-resistant DEC. Water samples from households were collected and analyzed for DEC presence. The samples were filtered, plated onto MacConkey agar, and subcultured onto Eosin Methylene Blue agar for further analysis. The DEC pathotypes were identified based on morphological and biochemical characteristics, and antibiotic resistance was assessed using the Kirby-Bauer disk diffusion method. The study revealed a strong correlation of 11.613 (95 % Confidence Interval [CI]: 6.495–20.765, p-value: 0.000) between microbial burden in vended water (water sold by vendors) used by different households consumption and antimicrobial resistance in DEC. Water sources showed a high prevalence of DEC, primarily Enteroaggregative, enteropathogenic, enterotoxigenic, and enteroinvasive E. coli. DEC isolates also exhibited varying antibiotic resistance, and genes like blaCTX-M, blaTEM, and blaSHV were identified using PCR. The Spearman correlation coefficient was one, showing that resistance genes in water and stool were perfectly correlated. The study emphasizes the significance of improving water quality, hygiene, and antibiotic-resistant bacteria control to prevent and manage DEC and infectious diseases in Kenya. To combat outbreaks, effective surveillance and rapid reaction procedures are essential. The findings help to shape public health policies and initiatives.

Carbapenem-resistant Escherichia coli in Black-headed gulls, the Danube, and human clinical samples: A One Health comparison of contemporary isolates

Our aim was to characterize and compare contemporary carbapenem-resistant Enterobacterales (CRE) isolates from gulls, the River Danube, and humans in Hungary, Budapest. Multiresistant Enterobacterales were sought for in 227 gull faecal and 24 Danube water samples from 2019 to 2020. Eosin-methylene blue agar containing 2 mg/L cefotaxime and Colilert-test containing 10 mg/L cefotaxime were used for gull and water samples, respectively. Isolates were characterized by polymerase chain reactions (PCRs); acquired carbapenemase producers were further analysed by whole-genome sequencing, together with 21 Hungarian human CR Escherichia coli (CREc) isolates. Gull and water samples exhibited a CRE prevalence of 7.4% (9/122) and 6.7% (7/105), none and 5/12 water samples yielded CRE from 2019 and 2020, respectively; CRE were found only in samples taken downstream of Budapest. The dominant species was Escherichia coli and the most prevalent carbapenemase was blaNDM-1. High-risk CREc clones were found both in gulls (ST224, ST372, ST744) and the Danube (ST10, ST354, ST410); the closest associations were between ST410 from humans and the Danube, among ST1437 among gulls, and between ST1437 in gulls and the Danube (46, 0, and 22-24 allelic distances, respectively). Direct links between human and gull isolates were not demonstrated. The study demonstrates potential epidemiological links among humans, a river crossing a city, and urbanised birds, suggesting a local transmission network. Water bodies receiving influent wastewater, together with animals using such habitats, may serve as a local reservoir system for CRE, highlighting the importance of One Health in CRE transmission, even in a country with a low CRE prevalence in humans.

Antibiocompetent and bacteriocidal relevance of ascorbic acid on coliforms isolated from feces of apparently healthy students in Rivers Nigeria

In recent times, Ascobic acid has been discovered to posses antibiocidal potential against various bacterial strains that has been resistant which is in sharp contrast as it was previously regarded as potential antioxidant especially as it is thought to reduce oxygen radicals both in vivo and in vitro biochemical processes. This study investigates the anti-biocompetent and bacteriocidal relevance of ascorbic acid on Staphylococcus aureus, Escherichia coli, and Proteus mirabilis recovered from the apparently healthy student feces at Madonna University. Standard microbiological methods were applied for the isolation of fecal coliforms using sterile blood agar, mannitol salt agar and eosin methylene blue (EMB) agar plates. The agar diffusion disc technique was used to determine an ascorbic acid fortified antimicrobial susceptibility testing of test bacteria at various concentrations varying from 0.167g/ml to 1.0g/ml, while their mean values were compared using one-way analysis of variance. The results revealed that Proteus mirabilis were resistant to the various ascorbic acid concentrations, whereas S. aureus and E. coli were susceptible to various ascorbic acid concentrations. An ascorbic acid content (g/ml) changes/shift (at p &lt; 0.05) the zones of inhibition (mm) of the isolates (E. coli and S. aureus) Such observed antibacterial potential suggests that ascorbic acid may be applied in the treatment of enteric or coliforms infections associated with E. coli and Staphylococcus aureus.

PREVALENCE OF TETRACYCLINE RESISTANCE GENES IN ESCHERICHIA COLI ISOLATED FROM FOOD SAMPLES IN AND AROUND MICHAEL AND CECILIA IBRU UNIVERSITY, NIGERIA

Background: Genes that confer resistance to tetracycline, a common antibiotic used in both human and veterinary medicine, are among the antibiotic resistance genes of most concern. Tetracycline treatment, a crucial weapon in the fight against bacterial infections, can become ineffective because of this resistance. Aim: Determination of the prevalence of tetracycline resistance genes within Escherichia coli strains found in food samples obtained from local food vendors in and around Michael and Cecilia Ibru University, Agbarha-Otor. Methods: Food samples were obtained from 6 out of 10 selected food vendors in and around MCIU campus. A total sample size of 100 respondents were administered questionnaires. Out of a total food sample size of 28, about 25grams of food samples were homogenized with 225 ml of buffered peptone water (BPW) in an electric blender (Vitamix 5200 model). Eosin Methylene Blue (EMB) agar was subsequently used as the culture media. About 0.5 ml aliquots of the inoculum were taken to extract DNA by the modified Boiling Lysis Method. Polymerase Chain Reaction (PCR) was performed using a thermocycler for the detection of tetA gene in E. coli isolates using specific primers (tetA-F CGCCTTTCCTTTGGGTTCTCTATATC; tetA-R CAGCCCACCGAGCAC AGG; Size=182 base pairs). Thereafter, gel electrophoresis was done at 200 volts for 15 minutes and studied under UV light Gel Documentation System (Cleaver Scientific, UK). Statistical analysis was conducted using Chi-square tests to identify significant differences (p&lt;0.05) in resistance patterns among the food categories. Results: Tetracycline resistant gene (tetA) was investigated among 18 of 28 cultured samples which had E. coli growth indicating 64% prevalence. Electrophoresis results indicated the presence of tetA gene in 11 out of the 18 E. coli positive samples as the prevalence of tetA gene was 61%. Lane 2, 4, 5, 6, 7, and 10 showed bands at 182 bp confirming the isolate contained tetA gene. Lane 5 showed additional bands at 780 bp which indicated possible superficial polymorphism of the tetA gene in isolates. The presence of bands at 182 bp confirmed the presence of the gene, and the presence of additional bands at 780 bp in Lane 5 suggested potential genetic variation in the tetA gene. Conclusion: The study contributes to a broader understanding of antibiotic resistance patterns, gene prevalence, and genetic variations in bacterial isolates, with particular reference to E. coli. It underscores the need for continued surveillance and research into antimicrobial resistance, particularly in environments where E. coli contamination is of concern, such as food vendor settings. Peer Review History: Received: 20 June 2023; Revised: 14 July; Accepted: 27 August, Available online: 15 September 2023 Academic Editor: Dr. A.A. Mgbahurike, University of Port Harcourt, Nigeria, amaka_mgbahurike@yahoo.com Received file: Reviewer's Comments: Average Peer review marks at initial stage: 6.0/10 Average Peer review marks at publication stage: 7.0/10 Reviewers: Prof. Hassan A.H. Al-Shamahy, Sana'a University, Yemen, shmahe@yemen.net.ye Dr. Bilge Ahsen KARA, Ankara Gazi Mustafa Kemal Hospital, Turkey, ahsndkyc@gmail.com

Detection of extended-spectrum β-lactamase-producing Escherichia coli genes isolated from cat rectal swabs at Surabaya Veterinary Hospital, Indonesia.

Escherichia coli causes a bacterial illness that frequently affects cats. Diseases caused by E. coli are treated using antibiotics. Because of their proximity to humans, cats possess an extremely high risk of contracting antibiotic resistance genes when their owners touch cat feces containing E. coli that harbor resistance genes. This study was conducted to identify multidrug-resistant E. coli and extended-spectrum β-lactamase (ESBL)-producing genes from cat rectal swabs collected at Surabaya City Veterinary Hospital to determine antibiotic sensitivity. Samples of cat rectal swabs were cultured in Brilliant Green Bile Lactose Broth medium and then streaked on eosin methylene blue agar medium for bacterial isolation, whereas Gram-staining and IMViC tests were conducted to confirm the identification results. The Kirby-Bauer diffusion test was used to determine antibiotic sensitivity, and the double-disk synergy test was used to determine ESBL-producing bacteria. Molecular detection of the genes TEM and CTX-M was performed using a polymerase chain reaction. Based on morphological culture, Gram-staining, and biochemical testing, the results of sample inspection showed that of the 100 cat rectal swab samples isolated, 71 (71%) were positive for E. coli. Furthermore, 23 E. coli isolates (32.39%) demonstrated the highest resistance to ampicillin. Four isolates were confirmed to be multidurg-resistant and ESBL-producing strains. Molecular examination revealed that three E. coli isolates harbored TEM and CTX-M. In conclusion, pet owners must be educated on the use of antibiotics to improve their knowledge about the risks of antibiotic resistance.

Antibiotics and Antifungal Resistance Patterns of Microbial Isolates from Dish Washing Sponges in the University of Port-Harcourt, Nigeria

This study examined the presence or contamination of bacteria in dishwashing sponges as well as the impact of various disinfectants on sponges. The total number of pathogenic organisms present in 120 sponges was determined using the nutritional agar (NA), MacConkey agar (MAC), Mannitol-Salt agar (MSA), Eosin-Methylene Blue agar (EMB), and Salmonella-Shigella agar (SSA) techniques. The efficacy of various disinfectants was evaluated using bleach, sanitizer, liquid soap, and boiled water for 30 minutes, while the remaining one served as a control sample. The result showed that household sponges had the lowest bacteria load across the five media with a mean bacteria count of 6.98 log CFU/g, followed by restaurant sponges with a mean count of 7.31 log CFU/g, and the highest bacteria load of 7.43 log CFU/g was obtained from hostel sponges. E. coli (40%), Klebsiella sp. (20%), Shigella sp. (15%), Staphylococcus sp. (20%), and Salmonella sp. (5) were the bacteria isolated and identified, whereas Aspergillus niger (65.6%) Penicillium oxalicum (9.4%), and Candida albicans (25%) were the fungi responsible for the contamination. Tarivid 25%, Reflacine 50%, Ciproflox 0%, Augmentin 50%, Gentamycin 0%, Streptomycin 0%, Ceporex 50%, Nalidixic acid 75%, Septrin 25%, and Amplicin 75% are the antibiotic resistant strains that have been identified. Griseofluvin eliminates both fungi at all concentrations that have been tested. Dishwashing sponges can be extremely contaminated, especially those used in the hostels on the University of Port Harcourt's Abuja campus. However, by applying basic and routine disinfection processes, the microbial contamination can be greatly reduced.

Bacterial Assessment of Retailed Smoked Edible Frog (&lt;i&gt;Hoplobatrachus occipitalis&lt;/i&gt;)

This research work evaluated the bacteriological safety of smoked edible frog (Hoplobatrachus occipitalis) retailed in three selected markets in Ota metropolis, Ogun State, Nigeria. Three different markets namely Iju-Ota, Sango and Ijoko markets were visited and smoked edible frogs were procured. The study was conducted to determine if there is any potential risk of foodborne infection from consuming these smoked edible frogs by the populace. Microbiological analyses were carried out using nutrient Agar, mannitol salt agar, mac conkey agar, Salmonella shigella agar and eosin methylene blue agar (EMBA) and conventional methods were used to identify the bacteria isolated. The results revealed that samples from Sango market had the highest heterotrophic bacterial counts and ranged from 2.57 x 107 cfu/g to 3.47 x 107 cfu/g among the three markets. Total coliform counts ranged from 1.23 x 105 cfu/g to 2.04 x 105 cfu/g, total enterobacteriaceae counts ranged from 8.91 x 102 cfu/g to 1.29 x 103 cfu/g, total staphylococcal counts ranged from 1.82 x 105 cfu/g to 2.63 x 105 cfu/g and that of Salmonella shigella counts ranged from 8.71 x 102 cfu/g to 1.15 x 103 cfu/g. The bacterial isolates in this study belong to six genera. Presence of these bacterial isolates is highly suggestive that these products were prepared and sold under condition that would permit the survival and multiplication of various microorganisms. Proper processing and cooking of the smoked edible frog meat will get rid of these pathogens, thereby preventing foodborne infections.

Microorganism Test on Biscuits Combined With Red Algae Extract (Eucheuma denticulatum) and Tempeh (Glycine max).

&lt;b&gt;Background and Objective:&lt;/b&gt; Biscuits are snacks that are widely circulated in the market but do not meet Indonesian National standards so they are harmful to consumer health. This study aims to determine the total plate count (TPC) value of bacteria and mold/yeast and determine the presence or absence of bacterial contamination of &lt;i&gt;Staphylococcus aureus &lt;/i&gt;and &lt;i&gt;Escherichia coli&lt;/i&gt; in biscuit products. &lt;b&gt;Materials and Methods:&lt;/b&gt; This study is descriptive in nature using three different sample types. Total plate count (TPC) value testing was carried out using the pour plate method. Meanwhile, to determine the presence or absence of &lt;i&gt;Staphylococcus aureus&lt;/i&gt; bacteria using MSA (mannitol salt agar) media with the spread plate technique. The &lt;i&gt;Escherichia coli&lt;/i&gt; test uses EMBA (eosin methylene blue agar) media with a streak plate technique. &lt;b&gt;Results:&lt;/b&gt; Three samples of biscuit formula obtained ALT of bacteria in sample A) 2.2×10&lt;sup&gt;7&lt;/sup&gt; colonies/g, sample B) 1.9×10&lt;sup&gt;7&lt;/sup&gt; colonies/g and sample C) 4.1×10&lt;sup&gt;7&lt;/sup&gt; colonies/g. Mold/khamir obtained in sample A) 7.7×10&lt;sup&gt;5&lt;/sup&gt; colonies/g, sample B) 5.1×10&lt;sup&gt;6&lt;/sup&gt; colonies/g and sample C) 1.1×10&lt;sup&gt;6&lt;/sup&gt; colonies/g. In the &lt;i&gt;Staphylococcus aureus&lt;/i&gt; bacteria test, the results were not overgrown with &lt;i&gt;Staphylococcus aureus&lt;/i&gt; bacteria and in the &lt;i&gt;Escherichia coli&lt;/i&gt; bacteria test, the results were easily purplish red in color. &lt;b&gt;Conclusion:&lt;/b&gt; It can be concluded that only formula C samples meet the requirements of the SNI quality standards. In the pathogenic microbial test, there was no growth of &lt;i&gt;Staphylococcus aureus&lt;/i&gt; and &lt;i&gt;Escherichia coli&lt;/i&gt; microbes in the three biscuit formula samples.

BACTERIOLOGICAL EVALUATION OF KWATA ABATTOIR WASTE WATER AWKA, NIGERIA

Abattoir wastes can have a detrimental effect on the environment, public health, animal health, and economy of a country if they are not effectively managed and controlled. The bacteriological evaluation of waste water from Kwata abattoir was carried out to determine the bacterial load present and if the waste water generated is suitable for direct discharge into the environment. A total of two samples were aseptically collected, in which the physicochemical analysis of the waste water showed objectionable color and odor, pH of 7.3 and 6.5, and temperature of 30.2°C and 25.3°C for samples A and B, respectively, of which the pH and temperature were within acceptable limits by WHO. The membrane filter method was used to determine the total coliform and thermotolerant coliform counts present per 100 mL of the samples using MacConkey agar and Eosin Methylene Blue Agar, respectively. The total viable count was obtained for both samples: 5.1×105 CFU/mL for sample A and 1.4×106 CFU/mL for sample B. Phenotypic and biochemical tests were carried out for four isolates, which include Escherichia coli, Salmonella spp., Bacillus spp., and Bacillus cereus. Thus, it can be concluded from the above study that untreated abattoir waste water contains a high level of pollutants, which supports the growth of the microbial population, as evidenced in the microbial study. Therefore, waste water has to be treated before discharge into the environment to protect public health and promote the safety of the environment.

Activity of Crystal Violet and Albert Stains against Escherichia coli

BACKGROUND: Escherichia coli (E. coli) developed resistance to multiple antibiotics, making them difficult to treat with standard therapies. Hence, using alternative strategies such as dyes to treat E. coli is urgent. MATERIALS AND METHODS: E. coli was isolated from the urinary tract by culturing urine specimens in three media (blood agar, MacConkey agar, and eosin methylene blue agar). The well diffusion method was used to evaluate the activity of crystal violet (CV) and Albert stains as well as disc diffusion method after overnight incubation for antibiotic sensitivity test of gentamicin and ciprofloxacin as control agents; the diameter of the inhibited growth is measured in millimeter. All the statistical analysis was done using SPSS 26 software. RESULTS: Out of the 20 participants in the study, 70% were women, while 30% were males. Both CV and gentamicin revealed 90% activity against isolates, while Albert stain reagents 1 and 2 showed 65% and 55% activity against isolated E. coli, respectively. Ciprofloxacin was sensitive in 65% of isolates. The mean of CV 19 ± 7.5 mm was more active than gentamicin 15.56 ± 6.72 mm significantly (P = 0.04). No significant differences in activity of both ciprofloxacin and CV was detected (P = 0.64). CONCLUSIONS: Both CV and Albert stains have antibacterial activity against E. coli that may be developed in clinical use.