21185 Background: NQO1 is a two-electron reductase, which metabolizes a variety of xenobiotics. This FAD-binding protein forms homodimers and reduces quinones to hydroquinones. This protein's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in this gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Genetic polymorphism of NQO1 is a C to T point mutation at base pair 609 of exon 6, which codes for a proline to serine substitution in NQO1 protein. This mutation results in a loss of NQO1 activity. Previously it was reported that wild-type NQO1 increased lung adenocarcinoma risk among male smokers in Taiwan. The association of the P187S polymorphism with breast cancer found in study of two independent populations (one from Tyrol, Austria, and the other from Prague, Czech Republic) (Menzel et al., 2004). Methods: The purpose of this study was to determine whether polymorphism in the NQO1 gene may influence breast cancer risk in Siberian population. The prevalent case-control design was used. The cases were 203 patients with breast cancer. Controls consisted of 182 noncancer outpatients. Genotyping for detecting of NQO1 gene polymorphism was performed using PCR amplification with the primer set of 5'- ACGCTAGCTCTGAACTGATTCTCT -3' and 5'- TTTTCTCCTCATCCTGTACCTCT –3’. The amplified PCR products were digested with HinfI and analyzed using electrophoresis on a 2.5% agarose gel. Results: Compared to subjects having C alleles (genotype CC), odds ratio (chi2=0.04, p=0.84309) were 1.116 (0.376–3.311) for subjects having genotype TT. Conclusions: These results suggest that polymorphic variation P187S of the NQO1 gene has no influence on breast cancer risk in Siberian women. No significant financial relationships to disclose.