Entomopathogenic Nematode Species Research Articles

Effect of temperature and soil moisture on the infectivity of four species of entomopathogenic nematodes (Steinernema and Heterorhabditis spp.) to fall armyworm, Spodoptera frugiperda (Smith)

Spodoptera frugiperda (JE Smith) is one of the most important lepidopterous pests of maize throughout the word. The implementation of management strategies for this are need of the hour. In this case the use of Entomopathogenic nematodes (EPNs) is feasible because third-instar larvae feed in the leaf whorls of maize, and sixth instar larvae pupate in the soil; these two environments are congenial for the EPNs. But temperature and soil moisture play major roles in EPNs infectivity. Therefore, in the current study, we examined temperature and soil moisture effect on the infectivity of four indigenous EPN species from India, Heterorhabditis indica NBAIIH23, H. bacteriophora NBAIRH75, Steinernema carpocapsae NBAIRS59, and S. abbasi NBAIISa01 against larvae and pupae of S. frugiperda. Present study results showed that both temperature and soil moisture affected the infectivity of H. indica, S. carpocapsae, H. bacteriophora, and S. abbasi. As the exposure time increased, all these four nematodes infectivity to larvae was increased. Six days after inoculation, H. indica caused significantly higher larval mortality (96 %) at 25 °C and 100 % mortality at 28 °C. Whereas, S. carpocapsae caused 100 % mortality at 28 °C, and 76 % mortality at 25 °C. At 32 °C, H. indica and S. carpocapsae caused 90 % and 92 % larval mortality, respectively. As the temperature decreased to 20 °C, the infectivity of both the nematodes decreased. However, H. bacteriophora and S. abbasi caused 68 % and 50 % mortality in larvae at 20 °C, respectively. Compared to other nematodes, H. indica significantly caused higher mortality in pupae at 13 % soil moisture at 28 °C. We conclude that, Heterorhabditis indica and S. carpocapsae can be utilized against S. frugiperda larvae at (25–32 °C), and pupae at (28 °C). These nematodes can also be used against pupae of S. frugiperda at 9–13 % soil moisture content. We also suggest that these EPNs species can be incorporated in the Integrated Pest Management (IPM) for S. frugiperda.

Damage to the host cadaver, simulating the effects of scavenging, differentially affects fitness of entomopathogenic nematode species

Insect cadavers infected by entomopathogenic nematodes (EPN) are defended against scavengers by chemical and other means. Despite these defences, the cadaver may be bitten before being rejected. In this study, we investigated the effect of damage to the cadaver cuticle on the fitness of nematodes (Heterorhabditis downesi or Steinernema feltiae) developing inside. We first quantified the severity of scavenger damage to EPN-infected Galleria mellonella Linnaeus cadavers in the field, and separately, with crickets (Gryllus bimaculatus De Geer) in the laboratory. In field and laboratory, EPN-infected cadavers suffered less damage than freeze-killed controls, and damage consisted mainly of small lesions to the cuticle. In further experiments, scavenging damage was simulated shortly after death of infected cadavers by piercing the cuticle 0, 1, 3 or 5 times and incubating in moist (100% relative humidity (RH)) or dry (60-70% RH) conditions. The greater the level of damage, the greater the loss of moisture from the cadaver (estimated by weight loss), and this was exacerbated in dry conditions. The number of Infective Juveniles (IJs) emerging from H. downesi-infected cadavers was significantly reduced by damage, especially in dry conditions. In addition, emerging IJs were progressively smaller with increasing damage. For this species, number of IJs was negatively correlated with moisture loss, indicated that the reduction in fitness was mediated by desiccation. For S. feltiae, damage impacted IJ number to a lesser extent and size was not affected. The reduction in numbers was not explained by moisture loss, indicating that for S. feltiae, some factor other than desiccation (perhaps competition with opportunistic microbes) impacts the nematodes when the cuticle is damaged. The greater vulnerability of H. downesi than S. feltiae to scavenger damage to the host cadaver may be due to its longer developmental time in the host resulting in longer exposure to damaging conditions. In conclusion, damage simulating biting by scavengers impacts the fitness of EPN, with the effect depending on nematode species, environmental conditions and the extent of damage. These findings have implications for the success of field application of EPN in infected cadavers.

Direct effects of Xenorhabdus spp. cell-free supernatant on Meloidogyne incognita in tomato plants and its impact on entomopathogenic nematodes

Entomopathogenic Xenorhabdus spp. bacteria, symbiont of the nematode Steinernema spp., shows potential for mitigating agricultural pests and diseases through bioactive compound production. The plant-parasitic nematode (PPN) Meloidogyne incognita affects the yield and quality of numerous crops, causing significant economic losses. We speculate that Cell-Free Supernatants (CFS) from Xenorhabdus spp. could reduce the impact of the root-knot nematode (RKN) M. incognita without negatively affecting entomopathogenic nematodes (EPNs), which are considered beneficial organisms. This study explored the activity of seven CFS against M. incognita (two populations, AL05 and Chipiona) and their possible effects on EPNs. The in vitro impact of CFS at 10 %, 40 %, and 90 % concentrations on nematode motility at four and 24 h were tested on the PPN M. incognita and two EPNs, S. feltiae and H. bacteriophora. Additionally, EPN viability and virulence were evaluated at two and five days. On the other hand, tomato plant-mesocosm experiments examined the activity of four CFS on M. incognita reproductive capacity and EPN virulence. In vitro exposure of M. incognita to 90 % concentration of CFS resulted in reductions of activity over 60 % after four hours of expossure in four out of seven CFS. In the in vitro evaluation of two species of EPNs, none of the CFS affected the activity across any tested doses after four hours of exposure nor after 24 h. Plant-mesocosm experiments showed that CFS application significantly reduced RKN galls, egg masses, and galling index. However, the virulence of both EPN species decreased 15 days after application, with a significant impact on S. feltiae. Overall, these findings suggest that CFS could be used as a bio-tool against M. incognita in tomato crops, mitigating its impact on plant growth. However, this study also highlights the necessity of investigating the effects of CFS on non-target organisms.

Exploring the effects of entomopathogenic nematode symbiotic bacteria and their cell free filtrates on the tomato leafminer Tuta absoluta and its predator Nesidiocoris tenuis

The use of biocontrol agents, such as predators and entomopathogenic nematodes, is a promising approach for the effective control of the tomato leafminer Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidaean), an oligophagous insect feeding mainly on Solanaceae species and a major pest of field- and greenhouse-grown tomatoes globally. In this context, the effects of two entomopathogenic nematode species Steinernema carpocapsae (Weiser) (Rhabditida: Steinernematidae) and Heterorhabditis bacteriophora (Poinar) (Rhabditida: Heterorhabditidae), as well as their respective bacterial symbionts, Xenorhabdus nematophila and Photorhabdus luminescens (Enterobacterales: Morganelaceae), which were applied as bacterial cell suspensions and as crude cell-free liquid filtrates on T. absoluta larvae, were investigated. The results showed that of all treatments, the nematodes S. carpocapsae and H. bacteriophora were the most effective, causing up to 98 % mortality of T. absoluta larvae. Regarding bacteria and their filtrates, the bacterium X. nematophila was the most effective (69 % mortality in young larvae), while P. luminescens and both bacterial filtrates showed similar potency (ca. 48–55 % mortality in young larvae). To achieve a holistic approach of controlling this important pest, the impact of these factors on the beneficial predator Nesidiocoris tenuis (Reuter) (Hemiptera: Miridae) was also studied. The results demonstrated that although nematodes and especially S. carpocapsae, caused significant mortality on N. tenuis (87 %), the bacterial cell suspensions of X. nematophila and P. luminescens and crude cell-free liquid filtrates had minimum impact on this beneficial predator (∼11–30 % mortality).

Laboratory Evaluation of the Combine Usage Possibilities of Entomopathogenic Nematodes with Insecticides against Mediterranean Corn Borer Sesamia nonagrioides (Lefebvre)

The Mediterranean Corn Borer (MCB), Sesamia nonagrioides, poses a significant threat to maize crops, necessitating effective pest management strategies. This study investigates the compatibility of two entomopathogenic nematode (EPN) isolates, Steinernema feltiae KV6 and Heterorhabditis bacteriophora EO7, with four registered insecticides for MCB control: deltamethrin, flubendiamide, spinetoram, and betacyfluthrin. The impact of these insecticides on EPN mortality, infectivity, and reproduction was assessed. Results indicate that deltamethrin exhibits the lowest toxicity to EPNs, with mortality rates of 1.3% for S. feltiae and 0.63% for H. bacteriophora at field dose (FD) after 24 h and 4.63% and 1.96%, respectively, after 48 h. In contrast, betacyfluthrin showed higher toxicity, with mortality rates of 38.04% and 14.17% for S. feltiae at 2FD and FD after 48 h. The infectivity assays demonstrated that deltamethrin-treated EPNs caused up to 100% mortality in MCB larvae, while the reproduction capacity varied significantly between the EPN species and insecticides. H. bacteriophora exhibited higher progeny production, especially in the presence of deltamethrin (87,900 IJs/larva). The findings suggest that integrating EPNs with selective insecticides like deltamethrin can enhance pest control efficacy and support sustainable agricultural practices. This study provides valuable insights for developing integrated pest management (IPM) strategies aimed at mitigating MCB infestations in maize while minimizing environmental impacts.

Efficacy of native entomopathogenic nematodes against different white grubs in sweetpotato field in China

White grubs (Holotrichia parallela, Anomala corpulenta and Holotrichia oblita) are the main underground pests of sweetpotato in North China. The virulence of 26 entomopathogenic nematode (EPN) isolates belonging to 10 species against H. parallela, A. corpulenta and H. oblita was evaluated in the laboratory. Isolates showing greater efficacy were further tested at different concentrations, and their virulence against different developmental stages of different white grub species was also examined. Greenhouse and field experiments were conducted to identify the most effective and adaptable nematode isolates. The mortality of the white grubs was significantly affected by nematode isolates and concentrations. The tested Heterorhabditis beicherriana NCWZ1, H. bacteriophora HQ4 and H. beicherriana LJ24 caused more than 70% mortality of the insect larvae at an application rate of 60 infective juveniles (IJs)/cm2 in the laboratory. In general, the susceptibility of the first and second instar of the white grubs was overall higher than that of the third instar according to the bioassay. Holotrichia oblita were less susceptible to most of the EPNs than H. parallela and A. corpulenta. There were significant differences in susceptibility to the nematodes among the early stage and the late stage of the first instar larvae of H. oblita. The tested EPN species showed promising control efficacy in field experiments. Heterorhabditis beicherriana NCWZ1 provide the highest efficacy at an application rate of 2 × 109 IJs/ha in the second and third field experiments. Our findings indicate that native EPN have good potential for use in the integrated management of white grubs in China.

The sky is not the limit: Successful foliar application of Steinernema spp. entomopathogenic nematodes to control Lepidopteran caterpillars

Entomopathogenic nematodes (EPNs) are ubiquitous soil-thriving organisms that use chemical cues to seek and infect soil-dwelling arthropods, yielding various levels of biological control. Going beyond soil application, scientists and practitioners started exploring the option of applying EPNs onto the foliage of crops in attempts to manage leaf-dwelling insect pests as well. Despite some success, particularly with protective formulations, it remains uncertain whether EPNs could indeed survive the phyllospheric environment, and successfully control foliar insect pests. In this context, we tested the potential of commercially produced Steinernema feltiae and S. carpocapsae, two of the most commonly used EPNs in the field of biological control, in controlling Lepidopteran foliar pests of economic importance, i.e. Tuta absoluta and Spodoptera spp. caterpillars as models. We first tested the survival and efficacy of both EPN species against the Lepidopteran caterpillars when applied onto tomato, sweet pepper and lettuce leaves, under controlled conditions and in commercial greenhouse conditions, respectively. Subsequently, we explored the behavioural responses of the EPNs to environmental cues typically encountered in the phyllosphere, and analysed plant volatile organic compounds (VOCs). Our results show that both S. feltiae and S. carpocapsae successfully survived and infected the foliar caterpillars, reaching similar level of control to a standard chemical pesticide in commercial practices. Remarkably, both EPN species survived and remained effective up to four days in the phyllosphere, and needed only a few hours to successfully penetrate the caterpillars. Interestingly, S. feltiae was attracted to VOCs from tomato plants, and tended to prefer those from caterpillar-induced plants, suggesting that the nematodes may actively forage toward its host, although it has never been exposed to leaf-borne volatiles during its evolution. The present study shows the high potential of steinernematids in managing major foliar pests in greenhouses and in becoming a key player in foliar biological control. In particular, the discovery that EPNs use foliar VOCs to locate caterpillar hosts opens up new opportunities in terms of application techniques and affordable effective doses.

Volatile organic compounds released from entomopathogenic nematode-infected insect cadavers for the biocontrol of Meloidogyne incognita.

Root-knot nematodes (RKNs), Meloidogyne spp., are one of the most destructive polyphagous plant-parasitic nematodes. They pose a serious threat to global food security and are difficult to control. Entomopathogenic nematodes (EPNs) show promise in controlling RKNs. However, it remains unclear whether the volatile organic compounds (VOCs) emitted from EPN-infected cadavers can control RKNs. We investigated the fumigation activity of VOCs released from cadavers infected by five different species of EPNs on RKNs in Petri dishes, and found that VOCs released from Steinernema feltiae (SN strain) and S. carpocapsae (All strain) infected cadavers had a significant lethal effect on second-stage juveniles (J2s) of Meloidogyne incognita. The VOCs released from the cadavers infected with S. feltiae were analyzed using SPME-GC/MS. Dimethyl disulfide (DMDS), tetradecane, pentadecane, and butylated hydroxytoluene (BHT), were selected for a validation experiment with pure compounds. The DMDS compound had significant nematicidal activity and repelled J2s. DMDS also inhibited egg hatching and the invasion of tomato roots by J2s. In a pot experiment, the addition of S. feltiae-infected cadavers and cadavers wrapped with a 400-mesh nylon net also significantly reduced the population of RKNs in tomato roots after 7 days. The number of root knots and eggs was reduced by 58% and 74.34%, respectively, compared to the control. These results suggested that the VOCs emitted by the EPN-infected cadavers affected various developmental stages of M. incognita and thus have the potential to be used in controlling RKNs through multiple methods. © 2024 Society of Chemical Industry.

Photorhabdus africana sp. nov. isolated from Heterorhabditis entomopathogenic nematodes

One Gram-negative, rod-shaped bacterial strain, isolated from an undescribed Heterorhabditis entomopathogenic nematode species was characterized to determine its taxonomic position. The 16S rRNA gene sequences indicate that it belongs to the class Gammaproteobacteria, to the family Morganellaceae, to the genus Photorhabdus, and likely represents a novel bacterial species. This strain, designated here as CRI-LCT, was therefore molecularly, biochemically, and morphologically characterized to describe the novel bacterial species. Phylogenetic reconstructions using 16S rRNA gene sequences show that CRI-LCT is closely related to P. laumondii subsp. laumondii TT01T and to P. laumondii subsp. clarkei BOJ-47T. The 16rRNA gene sequences between CRI-LCT and P. laumondii subsp. laumondii TT01T are 99.1% identical, and between CRI-LCT and P. laumondii subsp. clarkei BOJ-47T are 99.2% identical. Phylogenetic reconstructions using whole genome sequences show that CRI-LCT is closely related to P. laumondii subsp. laumondii TT01T and to P. laumondii subsp. clarkei BOJ-47T. Moreover, digital DNA-DNA hybridization (dDDH) values between CRI-LCT and its two relative species P. laumondii subsp. laumondii TT01T and P. laumondii subsp. clarkei BOJ-47T are 65% and 63%, respectively. In addition, we observed that average nucleotide identity (ANI) values between CRI-LCT and its two relative species P. laumondii subsp. laumondii TT01T and P. laumondii subsp. clarkei BOJ-47T are 95.8% and 95.5%, respectively. These values are below the 70% dDDH and the 95–96% ANI divergence thresholds that delimits prokaryotic species. Based on these genomic divergence values, and the phylogenomic separation, we conclude that CRI-LCT represents a novel bacterial species, for which we propose the name Photorhabdus africana sp. nov. with CRI-LCT (= CCM 9390T = CCOS 2112T) as the type strain. The following biochemical tests allow to differentiate P. africana sp. nov. CRI-LCT from other species of the genus, including its more closely related taxa: β-Galactosidase, citrate utilization, urease and tryptophan deaminase activities, indole and acetoin production, and glucose and inositol oxidation. Our study contributes to a better understanding of the taxonomy and biodiversity of this important bacterial group with great biotechnological and agricultural potential.

Assessment of combined effects of some common agrochemicals and different entomopathogenic nematode species on the control of Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) under controlled conditions

Assessment of combined effects of some common agrochemicals and different entomopathogenic nematode species on the control of Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) under controlled conditions

Description of a new species of entomopathogenic nematode, Steinernema ramanai sp. n. from Kerala, India

Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India. Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'. Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species. Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected. Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy

Responses of two entomopathogenic nematode species from the genus Steinernema to ethanol and 1-nonene

Entomopathogenic nematodes (EPNs) parasitize insects in the soil and are applied as environmentally friendly means for pest control in agriculture. Knowledge of how EPN infective juveniles (IJs) find their prey can be used to increase their effectiveness. Chemical signals in the soil are undoubtedly important but exactly which ones is little known. We hypothesized that volatile compounds emitted by EPN-infected larval cadavers could act as such signals. The objective of the study was to test the behavioral effects of 1-nonene which is known as a volatile compound emitted by several EPN-infected insect cadavers. Behavioral tests revealed that 1-nonene was attractive to IJs of both Steinernema feltiae and S. carpocapsae. High concentrations of the compound were repellent to S. feltiae and attractive to S. carpocapsae IJs. Low concentrations were attractive to S. feltiae (those from 104 to 106 times lower than the repellent concentrations) but did not affect the behavior of S. carpocapsae. Ethanol (solvent used for control tests) was attractive to S. feltiae IJs and not to those of S. carpocapsae. Both compounds are new agents involved in the behavior control of these EPN species. Different responses of IJs of two taxonomically closely related EPN species to chemical compounds could indicate interspecific difference in foraging. Behavioral reactions of S. carpocapsae IJs are more in line with the strategy of the scavenger.

Group Movement in Entomopathogenic Nematodes: Aggregation Levels Vary Based on Context.

Maintenance of an aggregated population structure implies within-species communication. In mixed-species environments, species-specific aggregations may reduce interspecific competition and promote coexistence. We studied whether movement and aggregation behavior of three entomopathogenic nematode species changed when isolated, as compared to mixed-species arenas. Movement and aggregation of Steinernema carpocapsae, S. feltiae and S. glaseri were assessed in sand. Each species demonstrated significant aggregation when alone. Mixed-species trials involved adding two species of nematodes, either combined in the center of the arena or at separate corners. While individual species became less aggregated than in single-species conditions when co-applied in the same location, they became more aggregated when applied in separate corners. This increased aggregation in separate-corner trials occurred even though the nematodes moved just as far when mixed together as they did when alone. These findings suggest that maintenance of multiple species within the same habitat is driven, at least in part, by species-specific signals that promote conspecific aggregation, and when the species are mixed (as occurs in some commercial formulations involving multiple EPN species), these signaling mechanisms are muddled.

Biocontrol potential of entomopathogenic nematodes against the grey maize weevil Tanymecus dilaticollis (Coleoptera: Curculionidae) adults.

The grey maize weevil, Tanymecus dilaticollis, is a polyphagous species, which is among the most important pests of maize in Southeastern Europe. The efficacy of commercial products with two species of entomopathogenic nematodes (EPNs), Steinernema carpocapsae and Heterorhabditis bacteriophora, was investigated against adults of the grey maize weevil under laboratory conditions. Nemastar®, containing S. carpocapsae was more effective on T. dilaticollis adults than Nematop® containing H. bacteriophora, when applied uniformly to the surface of the soil, on Petri dishes containing T. dilaticollis adults. Results showed that S. carpocapsae rates of 83-333 infective juveniles/adult caused > 94% mortality in T. dilaticollis adults, whereas H. bacteriophora caused 27-61%, adult mortality, after exposure of insects to the commercial products of EPNs for 15days. The infection rates of EPNs increased with concentration applied and ranged from 70-83% and 19-64% for Nemastar® and Nematop®, respectively. Subsequent field and semi-field tests were conducted with Nemastar® (application rate of 50 million S. carpocapsae per 100m2) in maize crops with biological (mycoinsecticide Naturalis®, biofungicides and fertilizers) and chemical seed treatment (Gaucho® FS 600; active ingredient: imidacloprid) in Knezha, Bulgaria. Nematodes were found only in the dead specimens, in open plots and cages sprayed with the commercial nematode product. Nematode sprayings contributed for higher maize yields in the open maize plots in the fields with different seed treatments. We suggest that the use of powder formulation of S. carpocapsae in combination with biologically treated maize seeds can contribute to minimize the use of chemical insecticides against the grey maize weevil. The results obtained can be used as a base to further tests to ascertain the efficacy of EPNs products before they can be recommended for use in the integrated approach to T. dilaticollis management.

Attraction of entomopathogenic nematodes to black truffle and its volatile organic compounds: A new approach for truffle beetle biocontrol

The European truffle beetle, Leiodes cinnamomeus, is the most important pest in black truffle (Tuber melanosporum) plantations. Entomopathogenic nematodes (EPNs) are a promising biological control agents against L. cinnamomeus. EPNs may employ multiple sensory cues while seeking for hosts, such as volatile organic compounds (VOCs) and CO2 gradients. We report for the first time the attraction of EPNs to truffle fruitbodies, and identified some VOCs potentially playing a key role in this interaction. We conducted olfactometer assays to investigate the attraction behavior of Steinernema feltiae and Steinernema carpocapsae towards both T. melanosporum fruitbodies and larvae of L. cinnamomeus. Subsequently, a chemotaxis assay using agar plates was performed to determine which of the 14 of the main VOCs emitted by the fruitbodies attracted S. feltiae at low (0.1 %) and high (mg/100 g truffle) concentrations. Both EPN species were attracted to mature fruitbodies of T. melanosporum, which may enhance the likelihood of encountering L. cinnamomeus during field applications. L. cinnamomeus larvae in the presence of truffles did not significantly affect the behavior of EPNs 24 h after application, underscoring the importance of the chemical compounds emitted by truffles themselves. Chemotaxis assays showed that four long-chain alcohol compounds emitted by T. melanosporum fruitbodies attracted S. feltiae, especially at low concentration, providing a first hint in the chemical ecology of a little-studied ecological system of great economical value. Further studies should be conducted to gain a finer understanding of the tritrophic interactions between T. melanosporum, EPNs, and L. cinnamomeus, as this knowledge may have practical implications for the efficacy of EPNs in the biological control of this pest.

Heterorhabditis alii n. sp. (Nematoda: Heterorhabditidae), a novel entomopathogenic nematode from Egypt used against the fall armyworm, Spodoptera frugiperda (Smith 1797) (Lepidoptera: Noctuidae)

BackgroundIsolation of novel species of entomopathogenic nematodes (EPNs) with biocontrol potential against important insect pests is very important for the sustainable management of economic pests damaging food crops and providing protection to the agricultural environment. This study was aimed to new indigenous EPN isolates from Egyptian agricultural soils and studies its biocontrol potential for further use in the biological control programs. Five out of 15 soil samples obtained from a farm located at the Cairo–Alexandria desert highway was positive for the presence of EPN, using the greater wax moth baiting method.ResultsSequencing of the internal transcribed spacer (ITS) region of 4 of the nematode isolates suggested that they belong to the species Heterorhabditis indica. However, one isolate does not show a high similarity to any of the H. indica previously recorded in the database of the Gen Bank and hence was identified as a new Heterorhabditis species and was deposited at the National Center for Biotechnology Information (NCBI) and registered under accession no. (OP555450) under the name of Heterorhabditis alii. This new species was also registered in the ZooBank under the registration link of: LSID urn: lsid: zoobank.org: act: 306F9D57-CC30-4B8E-8B19-4F0E42B08F34. No males were found in this species. Morphological characterization using the light microscope (LM) and scanning electron microscope (SEM) confirmed the identification of this nematode as a new species of the genus Heterorhabditis. Moreover, virulence of this new species against the fall armyworm (FAW), Spodoptera frugiperda (Smith 1797) (Lepidoptera: Noctuidae) was tested in comparison with the foreign EPN species, Heterorhabditis bacteriophora (HP88) and the local Heterorhabditis indica (Mango 2 isolate) and proved to be more effective against this devastative insect pest than the two compared species.ConclusionsThe present study found out a new species of the EPN genus, Heterorhabditis in Egypt. Our results were confirmed by both morphological and molecular analyses. The efficacy of this new species against the FAW proved to be a potent and safe biocontrol agent that can be used in biological control programs against this invasive insect pest of corn in Egypt and other global countries.

STEINERNEMA ADAMSI N. SP. (RHABDITIDA: STEINERNEMATIDAE), A NEW ENTOMOPATHOGENIC NEMATODE FROM THAILAND.

A new species of entomopathogenic nematode, Steinernema adamsi n. sp., was recovered from the soil of a longan tree (Dimocarpus sp.) in Mueang Lamphun District, Thailand, using baiting techniques. Upon analysis of the nematode's morphological traits, we found it to be a new species of Steinernema and a member of the Longicaudatum clade. Molecular analyses of the ITS rDNA and D2D3 of 28S rDNA sequences further confirmed that S. adamsi n. sp. is a new species of the Longicaudatum clade, which is closely related to Steinernema guangdongense and Steinernema longicaudam. Using morphometric analysis, the infective juveniles measure between 774.69 and 956.96 μm, males have a size range of 905.44 to 1,281.98 μm, and females are within the range of 1,628.21 to 2,803.64 μm. We also identified the symbiotic bacteria associated with the nematode based on 16S sequences as Xenorhabdus spp. closely related toXenorhabdus griffiniae. Furthermore, we have successfully assessed a cryopreservation method for the long-term preservation of S. adamsi n. sp. Successful cryopreservation of this new species will allow for the longer preservation of its traits and will be valuable for its future use. The discovery of this new species has significant implications for the development of effective biological control agents in Thailand, and our work contributes to our understanding of the diversity and evolution of entomopathogenic nematodes.

Biocidal Efficacy of a New and Native Species of Entomopathogenic Nematode against Gram Pod Borer, Helicoverpa armigera (Hubner)

Efficacy of new and native species of entomopathogenic nematode (EPN), Heterorhabditis casmirica SKUAST-K 104 was evaluated against gram pod borer, Helicoverpa armigera in laboratory conditions. Larval mortality was directly proportional to time period as well as time period but inversely proportional to larval size. H. casmirica SKUAST-K 104 applied @ 50, 100, 150 and 200 IJs per 2nd instar larva resulted in pest mortality by 0.00, 8.33, 16.66, and 25.00 per cent, respectively at 24 hours and they were statistically significant (p ≤ 0.05) from each other. At 200 IJs inoculum level, 8.33, 16.66, 25.0, 41.66 and 50 per cent mortality of 5th instar larva was recorded at 24, 48, 72, 96 and 120 hours post inoculation, respectively. LC50 values was directly proportional to the size of larva but inversely proportional to size of nematode inoculum level. On the other hand, LT50 values was directly proportional to the size of larva but inversely proportional to size of nematode inoculum level. LC50 values calculated at 24 hours for 2nd, 3rd, 4th and 5th instar larvae was 256.88, 277.24, 326.25 and 384.25, respectively, whereas at 120 hours it was 126.11, 160.22, 184.36 and 219.14, respectively. Similarly, LT50 values calculated at inoculum level of 50 IJs per 2nd, 3rd, 4th and 5th instar larvae were 105.0, 113, 122 and 131 hours, respectively but at highest inoculum level of 200 IJs, it was 75, 89, 94 and 100 hours, respectively. Nematode multiplication rate within the host cadaver was directly proportional to the size of the host. Minimum and maximum number of IJs/ larva was 2.72 x 105 and 1.03 x 105, obtained from 2nd and 5th instar larva, respectively.

Efficacy of commercially available entomopathogenic nematodes against insect pests of canola in Alberta, Canada.

Certain entomopathogenic nematodes (EPNs) in the families Steinernematidae and Heterorhabditidae are among the most studied biocontrol tools, some of which are commercially available against pest insects. Their use against foliar and subterranean insect pests is largely unexplored in the Canadian Prairies. We conducted a laboratory-based study to produce baseline information on the biocontrol potential of a few commercial EPN species. Percent mortality of flea beetles, diamondback moths (DBMs), lygus, cabbage root maggots, and black cutworms (BCWs) was assessed after 72 hours exposure to Steinernema carpocapsae, S. kraussei, S. feltiae, and Heterorhabditis bacteriophora at varying concentrations (25, 50, 100, and 200 infective juveniles (IJs) per larvae, pupae, or cm2 of soil surface). Irrespective of concentration level, S. carpocapsae and S. kraussei caused significant mortality in DBM and BCW larvae compared with H. bacteriophora.S. kraussei, and S. feltiae were more efficient than S. carpocapsae in controlling root maggot larvae. H. bacteriophora caused zero mortality to root maggots at any concentration. Root maggot pupae were resistant to entry to EPN species tested, likely due to hard outer covering. Compared with root maggot pupae, a moderate level of mortality was observed in DBM pupae, suggesting differential ability of the tested EPNs in killing different life stages of certain pests. All nematode species tested caused low mortality (≤10%) in flea beetle adults. The findings of this investigation form fundamental data essential for carrying out field-based studies on canola and other related crops aimed at control and management of these pest species.

Virulence of entomopathogenic nematodes and their symbiotic bacteria, under laboratory conditions, aiming controlling Saccharicoccus sacchari (Cockerell, 1895) (Hemiptera: Pseudococcidae) on sugarcane.

Sugarcane crops Saccharum spp. (Poales: Poaceae) produces different derivatives to the world: sugar, ethanol and bioenergy. Despite the application of pesticides, insect pests still cause economic losses, among these the pink sugarcane mealybug Saccharicoccus sacchari (Cockerell, 1895) (Hemiptera: Pseudococcidae) causing direct and indirect damage to the plant. This study assess the virulence of three entomopathogenic nematodes (EPNs) species and their symbiont bacteria against the pink sugarcane mealybug, under laboratory conditions. Fourteen treatments represented by control (distilled water), Heterorhabditis bacteriophora Poinar, 1976 (HB EN01) (Rhabditida: Heterorhabditidae), Steinernema rarum (Doucet, 1986) (PAM25) and Steinernema carpocapsae Weiser, 1955 (All) (Rhabditida: Steinermatidae) at concentrations of 25, 50, 75 and 100 infective juveniles (IJs)/insect, and the standard chemical product, thiamethoxam, were assayed. In a second experiment, the bacteria Photorhabdus luminescens (Thomas and Poinar, 1979), Xenorhabdus szentirmaii Lengyel, 2005 and Xenorhabdus nematophila (Poinar and Thomas, 1965) (Enterobacterales: Morganellaceae) at 3.0 x 109 cells/ml were assessed for each treatment. Ten replications were stablished, each one counting ten females/mealybugs inside a 10 cm Petri dish, amounting 100 individuals/treatment. All treatments were kept under stable conditions (25±1 ºC, H 70±10%, in the dark). All nematodes species infected S. sacchari. Steinerma rarum (PAM25) provided the highest mortality against the pink sugarcane mealybug (79.25%), followed by H. bacteriophora (HB EN01) (58.25%) and S. carpocapsae (All) (42.50%) (P<0.001). The mortality rate caused by X. szentirmaii, P. luminescens and X. nematophila were 40, 45 and 20%, respectively. Steinerma rarum (PAM25) has conditions to be a potential agent to be incorporate into the integrated pest management in sugarcane.