Entomopathogenic Nematode Species Research Articles

Assessment of combined effects of some common agrochemicals and different entomopathogenic nematode species on the control of Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) under controlled conditions

Assessment of combined effects of some common agrochemicals and different entomopathogenic nematode species on the control of Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) under controlled conditions

Description of a new species of entomopathogenic nematode, Steinernema ramanai sp. n. from Kerala, India

Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India. Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'. Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species. Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected. Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy

Responses of two entomopathogenic nematode species from the genus Steinernema to ethanol and 1-nonene

Entomopathogenic nematodes (EPNs) parasitize insects in the soil and are applied as environmentally friendly means for pest control in agriculture. Knowledge of how EPN infective juveniles (IJs) find their prey can be used to increase their effectiveness. Chemical signals in the soil are undoubtedly important but exactly which ones is little known. We hypothesized that volatile compounds emitted by EPN-infected larval cadavers could act as such signals. The objective of the study was to test the behavioral effects of 1-nonene which is known as a volatile compound emitted by several EPN-infected insect cadavers. Behavioral tests revealed that 1-nonene was attractive to IJs of both Steinernema feltiae and S. carpocapsae. High concentrations of the compound were repellent to S. feltiae and attractive to S. carpocapsae IJs. Low concentrations were attractive to S. feltiae (those from 104 to 106 times lower than the repellent concentrations) but did not affect the behavior of S. carpocapsae. Ethanol (solvent used for control tests) was attractive to S. feltiae IJs and not to those of S. carpocapsae. Both compounds are new agents involved in the behavior control of these EPN species. Different responses of IJs of two taxonomically closely related EPN species to chemical compounds could indicate interspecific difference in foraging. Behavioral reactions of S. carpocapsae IJs are more in line with the strategy of the scavenger.

Group Movement in Entomopathogenic Nematodes: Aggregation Levels Vary Based on Context.

Maintenance of an aggregated population structure implies within-species communication. In mixed-species environments, species-specific aggregations may reduce interspecific competition and promote coexistence. We studied whether movement and aggregation behavior of three entomopathogenic nematode species changed when isolated, as compared to mixed-species arenas. Movement and aggregation of Steinernema carpocapsae, S. feltiae and S. glaseri were assessed in sand. Each species demonstrated significant aggregation when alone. Mixed-species trials involved adding two species of nematodes, either combined in the center of the arena or at separate corners. While individual species became less aggregated than in single-species conditions when co-applied in the same location, they became more aggregated when applied in separate corners. This increased aggregation in separate-corner trials occurred even though the nematodes moved just as far when mixed together as they did when alone. These findings suggest that maintenance of multiple species within the same habitat is driven, at least in part, by species-specific signals that promote conspecific aggregation, and when the species are mixed (as occurs in some commercial formulations involving multiple EPN species), these signaling mechanisms are muddled.

Biocontrol potential of entomopathogenic nematodes against the grey maize weevil Tanymecus dilaticollis (Coleoptera: Curculionidae) adults.

The grey maize weevil, Tanymecus dilaticollis, is a polyphagous species, which is among the most important pests of maize in Southeastern Europe. The efficacy of commercial products with two species of entomopathogenic nematodes (EPNs), Steinernema carpocapsae and Heterorhabditis bacteriophora, was investigated against adults of the grey maize weevil under laboratory conditions. Nemastar®, containing S. carpocapsae was more effective on T. dilaticollis adults than Nematop® containing H. bacteriophora, when applied uniformly to the surface of the soil, on Petri dishes containing T. dilaticollis adults. Results showed that S. carpocapsae rates of 83-333 infective juveniles/adult caused > 94% mortality in T. dilaticollis adults, whereas H. bacteriophora caused 27-61%, adult mortality, after exposure of insects to the commercial products of EPNs for 15days. The infection rates of EPNs increased with concentration applied and ranged from 70-83% and 19-64% for Nemastar® and Nematop®, respectively. Subsequent field and semi-field tests were conducted with Nemastar® (application rate of 50 million S. carpocapsae per 100m2) in maize crops with biological (mycoinsecticide Naturalis®, biofungicides and fertilizers) and chemical seed treatment (Gaucho® FS 600; active ingredient: imidacloprid) in Knezha, Bulgaria. Nematodes were found only in the dead specimens, in open plots and cages sprayed with the commercial nematode product. Nematode sprayings contributed for higher maize yields in the open maize plots in the fields with different seed treatments. We suggest that the use of powder formulation of S. carpocapsae in combination with biologically treated maize seeds can contribute to minimize the use of chemical insecticides against the grey maize weevil. The results obtained can be used as a base to further tests to ascertain the efficacy of EPNs products before they can be recommended for use in the integrated approach to T. dilaticollis management.

Attraction of entomopathogenic nematodes to black truffle and its volatile organic compounds: A new approach for truffle beetle biocontrol

The European truffle beetle, Leiodes cinnamomeus, is the most important pest in black truffle (Tuber melanosporum) plantations. Entomopathogenic nematodes (EPNs) are a promising biological control agents against L. cinnamomeus. EPNs may employ multiple sensory cues while seeking for hosts, such as volatile organic compounds (VOCs) and CO2 gradients. We report for the first time the attraction of EPNs to truffle fruitbodies, and identified some VOCs potentially playing a key role in this interaction. We conducted olfactometer assays to investigate the attraction behavior of Steinernema feltiae and Steinernema carpocapsae towards both T. melanosporum fruitbodies and larvae of L. cinnamomeus. Subsequently, a chemotaxis assay using agar plates was performed to determine which of the 14 of the main VOCs emitted by the fruitbodies attracted S. feltiae at low (0.1 %) and high (mg/100 g truffle) concentrations. Both EPN species were attracted to mature fruitbodies of T. melanosporum, which may enhance the likelihood of encountering L. cinnamomeus during field applications. L. cinnamomeus larvae in the presence of truffles did not significantly affect the behavior of EPNs 24 h after application, underscoring the importance of the chemical compounds emitted by truffles themselves. Chemotaxis assays showed that four long-chain alcohol compounds emitted by T. melanosporum fruitbodies attracted S. feltiae, especially at low concentration, providing a first hint in the chemical ecology of a little-studied ecological system of great economical value. Further studies should be conducted to gain a finer understanding of the tritrophic interactions between T. melanosporum, EPNs, and L. cinnamomeus, as this knowledge may have practical implications for the efficacy of EPNs in the biological control of this pest.

Heterorhabditis alii n. sp. (Nematoda: Heterorhabditidae), a novel entomopathogenic nematode from Egypt used against the fall armyworm, Spodoptera frugiperda (Smith 1797) (Lepidoptera: Noctuidae)

BackgroundIsolation of novel species of entomopathogenic nematodes (EPNs) with biocontrol potential against important insect pests is very important for the sustainable management of economic pests damaging food crops and providing protection to the agricultural environment. This study was aimed to new indigenous EPN isolates from Egyptian agricultural soils and studies its biocontrol potential for further use in the biological control programs. Five out of 15 soil samples obtained from a farm located at the Cairo–Alexandria desert highway was positive for the presence of EPN, using the greater wax moth baiting method.ResultsSequencing of the internal transcribed spacer (ITS) region of 4 of the nematode isolates suggested that they belong to the species Heterorhabditis indica. However, one isolate does not show a high similarity to any of the H. indica previously recorded in the database of the Gen Bank and hence was identified as a new Heterorhabditis species and was deposited at the National Center for Biotechnology Information (NCBI) and registered under accession no. (OP555450) under the name of Heterorhabditis alii. This new species was also registered in the ZooBank under the registration link of: LSID urn: lsid: zoobank.org: act: 306F9D57-CC30-4B8E-8B19-4F0E42B08F34. No males were found in this species. Morphological characterization using the light microscope (LM) and scanning electron microscope (SEM) confirmed the identification of this nematode as a new species of the genus Heterorhabditis. Moreover, virulence of this new species against the fall armyworm (FAW), Spodoptera frugiperda (Smith 1797) (Lepidoptera: Noctuidae) was tested in comparison with the foreign EPN species, Heterorhabditis bacteriophora (HP88) and the local Heterorhabditis indica (Mango 2 isolate) and proved to be more effective against this devastative insect pest than the two compared species.ConclusionsThe present study found out a new species of the EPN genus, Heterorhabditis in Egypt. Our results were confirmed by both morphological and molecular analyses. The efficacy of this new species against the FAW proved to be a potent and safe biocontrol agent that can be used in biological control programs against this invasive insect pest of corn in Egypt and other global countries.

STEINERNEMA ADAMSI N. SP. (RHABDITIDA: STEINERNEMATIDAE), A NEW ENTOMOPATHOGENIC NEMATODE FROM THAILAND.

A new species of entomopathogenic nematode, Steinernema adamsi n. sp., was recovered from the soil of a longan tree (Dimocarpus sp.) in Mueang Lamphun District, Thailand, using baiting techniques. Upon analysis of the nematode's morphological traits, we found it to be a new species of Steinernema and a member of the Longicaudatum clade. Molecular analyses of the ITS rDNA and D2D3 of 28S rDNA sequences further confirmed that S. adamsi n. sp. is a new species of the Longicaudatum clade, which is closely related to Steinernema guangdongense and Steinernema longicaudam. Using morphometric analysis, the infective juveniles measure between 774.69 and 956.96 μm, males have a size range of 905.44 to 1,281.98 μm, and females are within the range of 1,628.21 to 2,803.64 μm. We also identified the symbiotic bacteria associated with the nematode based on 16S sequences as Xenorhabdus spp. closely related toXenorhabdus griffiniae. Furthermore, we have successfully assessed a cryopreservation method for the long-term preservation of S. adamsi n. sp. Successful cryopreservation of this new species will allow for the longer preservation of its traits and will be valuable for its future use. The discovery of this new species has significant implications for the development of effective biological control agents in Thailand, and our work contributes to our understanding of the diversity and evolution of entomopathogenic nematodes.

Biocidal Efficacy of a New and Native Species of Entomopathogenic Nematode against Gram Pod Borer, Helicoverpa armigera (Hubner)

Efficacy of new and native species of entomopathogenic nematode (EPN), Heterorhabditis casmirica SKUAST-K 104 was evaluated against gram pod borer, Helicoverpa armigera in laboratory conditions. Larval mortality was directly proportional to time period as well as time period but inversely proportional to larval size. H. casmirica SKUAST-K 104 applied @ 50, 100, 150 and 200 IJs per 2nd instar larva resulted in pest mortality by 0.00, 8.33, 16.66, and 25.00 per cent, respectively at 24 hours and they were statistically significant (p ≤ 0.05) from each other. At 200 IJs inoculum level, 8.33, 16.66, 25.0, 41.66 and 50 per cent mortality of 5th instar larva was recorded at 24, 48, 72, 96 and 120 hours post inoculation, respectively. LC50 values was directly proportional to the size of larva but inversely proportional to size of nematode inoculum level. On the other hand, LT50 values was directly proportional to the size of larva but inversely proportional to size of nematode inoculum level. LC50 values calculated at 24 hours for 2nd, 3rd, 4th and 5th instar larvae was 256.88, 277.24, 326.25 and 384.25, respectively, whereas at 120 hours it was 126.11, 160.22, 184.36 and 219.14, respectively. Similarly, LT50 values calculated at inoculum level of 50 IJs per 2nd, 3rd, 4th and 5th instar larvae were 105.0, 113, 122 and 131 hours, respectively but at highest inoculum level of 200 IJs, it was 75, 89, 94 and 100 hours, respectively. Nematode multiplication rate within the host cadaver was directly proportional to the size of the host. Minimum and maximum number of IJs/ larva was 2.72 x 105 and 1.03 x 105, obtained from 2nd and 5th instar larva, respectively.

Efficacy of commercially available entomopathogenic nematodes against insect pests of canola in Alberta, Canada.

Certain entomopathogenic nematodes (EPNs) in the families Steinernematidae and Heterorhabditidae are among the most studied biocontrol tools, some of which are commercially available against pest insects. Their use against foliar and subterranean insect pests is largely unexplored in the Canadian Prairies. We conducted a laboratory-based study to produce baseline information on the biocontrol potential of a few commercial EPN species. Percent mortality of flea beetles, diamondback moths (DBMs), lygus, cabbage root maggots, and black cutworms (BCWs) was assessed after 72 hours exposure to Steinernema carpocapsae, S. kraussei, S. feltiae, and Heterorhabditis bacteriophora at varying concentrations (25, 50, 100, and 200 infective juveniles (IJs) per larvae, pupae, or cm2 of soil surface). Irrespective of concentration level, S. carpocapsae and S. kraussei caused significant mortality in DBM and BCW larvae compared with H. bacteriophora.S. kraussei, and S. feltiae were more efficient than S. carpocapsae in controlling root maggot larvae. H. bacteriophora caused zero mortality to root maggots at any concentration. Root maggot pupae were resistant to entry to EPN species tested, likely due to hard outer covering. Compared with root maggot pupae, a moderate level of mortality was observed in DBM pupae, suggesting differential ability of the tested EPNs in killing different life stages of certain pests. All nematode species tested caused low mortality (≤10%) in flea beetle adults. The findings of this investigation form fundamental data essential for carrying out field-based studies on canola and other related crops aimed at control and management of these pest species.

Virulence of entomopathogenic nematodes and their symbiotic bacteria, under laboratory conditions, aiming controlling Saccharicoccus sacchari (Cockerell, 1895) (Hemiptera: Pseudococcidae) on sugarcane.

Sugarcane crops Saccharum spp. (Poales: Poaceae) produces different derivatives to the world: sugar, ethanol and bioenergy. Despite the application of pesticides, insect pests still cause economic losses, among these the pink sugarcane mealybug Saccharicoccus sacchari (Cockerell, 1895) (Hemiptera: Pseudococcidae) causing direct and indirect damage to the plant. This study assess the virulence of three entomopathogenic nematodes (EPNs) species and their symbiont bacteria against the pink sugarcane mealybug, under laboratory conditions. Fourteen treatments represented by control (distilled water), Heterorhabditis bacteriophora Poinar, 1976 (HB EN01) (Rhabditida: Heterorhabditidae), Steinernema rarum (Doucet, 1986) (PAM25) and Steinernema carpocapsae Weiser, 1955 (All) (Rhabditida: Steinermatidae) at concentrations of 25, 50, 75 and 100 infective juveniles (IJs)/insect, and the standard chemical product, thiamethoxam, were assayed. In a second experiment, the bacteria Photorhabdus luminescens (Thomas and Poinar, 1979), Xenorhabdus szentirmaii Lengyel, 2005 and Xenorhabdus nematophila (Poinar and Thomas, 1965) (Enterobacterales: Morganellaceae) at 3.0 x 109 cells/ml were assessed for each treatment. Ten replications were stablished, each one counting ten females/mealybugs inside a 10 cm Petri dish, amounting 100 individuals/treatment. All treatments were kept under stable conditions (25±1 ºC, H 70±10%, in the dark). All nematodes species infected S. sacchari. Steinerma rarum (PAM25) provided the highest mortality against the pink sugarcane mealybug (79.25%), followed by H. bacteriophora (HB EN01) (58.25%) and S. carpocapsae (All) (42.50%) (P<0.001). The mortality rate caused by X. szentirmaii, P. luminescens and X. nematophila were 40, 45 and 20%, respectively. Steinerma rarum (PAM25) has conditions to be a potential agent to be incorporate into the integrated pest management in sugarcane.

Study of entomopathogenic nematodes and their role in microbial control of pests

An essential part of managing insect pests is the use of entomopathogenic nematodes and in preventing environmental contamination. Their use has been increasing in recent years. So far, about 30 to 40 nematode families are in contact with insects and other vertebrates. Among these families, the group widely studied as the so-called "entomopathogenic nematodes," also known as EPN, are Heterorhabditidae and Steinernematidae. Two species of Oscheius (Oscheius chongmingensis and Oscheius carolinensis) have been added in recent years to the EPNs group, and we expect that several species will be added to EPNs. ENP has a wide range of host insects found in a species of EPN that can attack over 250 different kinds of insects from several families. Suitable environments for EPNs include insect hemocoels, soil pores, or river bottoms that grow in contact with these environments. Occurrence, mobility, distribution, and stability of EPN under the influence of several factors, including intrinsic factors such as behavioral, physiological, and genetic characteristics. Biological nature included are hosted and non-host arthropods, predators, parasites, diseases, and aberrant environmental elements like temperature, moisture content, texture, pH, and UV radiation. Proper mass production and application are essential for the biological control effectiveness of entomopathogenic nematodes (EPN). In addition, there is no problem in applying EPNs because they are simple to spray with common equipment and are compatible with almost all chemical fertilizers, but the compatibility is different from chemical pesticides.

Potential control of Vespula germanica and Polistes dominula (Hymenoptera: Vespidae) using entomopathogens

ABSTRACT The first recordings in South Africa of the invasive social wasps, Vespula germanica and Polistes dominula (Hymenoptera: Vespidae) were in 1974 and again in 2008. These wasps are known to represent a significant threat to the biodiversity of ecosystems and socio-economic activities in countries they invade. Here, the susceptibility of V. germanica and P. dominula larvae to indigenous species of entomopathogenic nematodes (EPNs), namely Heterorhabditis bacteriophora, H. noenieputensis and Steinernema yirgalemense, and entomopathogenic fungus (EPF) Beauveria bassiana was tested both in laboratory bioassays and in situ wasp nests application in the Western Cape province. The bioassay results indicate that both P. dominula and V. germanica larvae are susceptible to all biocontrol agents used. All larvae of both wasp species were dead and infected after exposure to 200 IJ/insect within four days after inoculation. Similar results were obtained seven days after inoculation with B. bassiana. To test in-field pathogenicity against P. dominula, wasp nests were treated with B. bassiana, H. bacteriophora, a mixture of the EPF and EPN species and a control of distilled water. The number of larvae and pupae infected 168 h after application were determined. In both cases, the mixture of EPF/EPN performed best, with a mean percentage of 31.39% ± 4.75% larvae infected, and only 3.42% ± 0.68% of pupae infected. The results obtained suggest that higher concentrations of selected biologicals can be used as inundative biological control agents within an integrated management programme for the control of P. dominula and V. germanica in South Africa.

Assessment of Entomopathogenic Nematodes in Oil Emulsions to Control Scyphophorus acupunctatus in Agave under Laboratory Conditions

The weevil Scyphophorus acupunctatus Gyllenhal causes damage and losses in agave crops and has traditionally been controlled using contact and systemic agrochemicals. Implementing microbial control strategies is proposed as an alternative to mitigate the environmental impact associated with agrochemicals. The objective of this study was to determine the survival of entomopathogenic nematodes in oil emulsions for the control of adult S. acupunctatus. Three species of entomopathogenic nematodes were evaluated: Steinernema carpocapsae, S. glaseri, and Heterorhabditis bacteriophora. We used two concentrations (50 ± 5 and 100 ± 10 infectious juvenile nematodes), and oil emulsions derived from Salvia hispanica, Triticum vulgare, and Olea europea with oil purity of 20% and 40%. The effectiveness of these treatments was assessed by determining the mortality rate of S. acupunctatus. The results indicate that the combination of S. glaseri and H. bacteriophora, at concentrations of 50 ± 5 and 100 ± 10 nematodes, respectively, with T. vulgare and O. europea oils, achieved a mortality rate of 85.76% in S. acupunctatus adults at 24 h. At 120 h, a mortality rate of 100% was achieved with specific formulations, such as S. glaseri with 100 ± 10 nematodes + O. europea, and H. bacteriophora with 100 ± 10 nematodes + O. europea. Consequently, we conclude that oil formulations combined with nematodes show potential as an effective and environmentally friendly alternative for the control and management of S. acupunctatus.

Host-foraging strategies of five local entomopathogenic nematode species in South Africa

Entomopathogenic nematodes (EPNs) are obligate parasites of soil-dwelling insects and are used as biological control agents for many insect pests. These nematodes have a free-living third growth stage called infective juveniles (IJs), which are responsible for foraging and infecting suitable insect hosts. Infective juveniles exhibit three host-foraging strategies: cruising, ambushing, and intermediate foraging strategies. The foraging strategy of EPNs is important for successful infection but is poorly understood. The current study investigated the host-foraging strategies of five local South African EPN species including Heterorhabditis noenieputensis, H. safricana, Steinernema fabii, S. jeffreyense, and S. yirgalemense by assessing their dispersal behavior. Of the five EPN species, H. noenieputensis, H. safricana, S. jeffreyense, and S. yirgalemense showed a positive response to the presence of the wax moth larvae, whereas S. fabii showed a negative response. The four EPN species that showed a positive response to the presence of the host also caused 100% mortality of wax moth larvae that were buried in sand at a depth of 10 cm, whereas S. fabii caused the lowest mortality of 34%. The average distance traveled by all five EPN species decreased on rough textured substrate compared with smooth textured substrate. The observed behavioral patterns suggested that H. noenieputensis, H. safricana, S. jeffreyense, and S. yirgalemense use a cruiser foraging strategy whereas S. fabii uses an ambusher foraging strategy.

Screening five local entomopathogenic nematode species for their virulence against pupae of the Eucalyptus snout beetle, Gonipterus sp. n. 2, under laboratory conditions

The Eucalyptus snout beetle, Gonipterus sp. n. 2, is an important pest of eucalypt trees in South Africa and other countries. The pest is partially controlled with a mymarid egg parasitoid, Anaphes nitens. Identifying additional biological control agents that target other developmental stages of Gonipterus sp. n. 2 is necessary to improve control. Entomopathogenic nematodes (EPNs) are used as biological control agents for numerous soil pests and thus have the potential to be used against the pupal stage of Gonipterus sp. n. 2, which occurs in the soil. In this study, five South African EPN species were screened for their virulence on uncased pupae of Gonipterus sp. n. 2. At a concentration of 200 IJs/pupa in 50 μl of sterile water, Steinernema jeffreyense, S. fabii, Heterorhabditis noenieputensis and H. safricana caused pupal mortality of less than 40 %, while S. yirgalemense caused the highest pupal mortality of 100 % two days post-inoculation. Steinernema yirgalemense was selected and applied at different concentrations, namely 0, 12, 25, 50, 100, 200, and 400 IJs/pupa to determine its lethal concentration. Probit analysis indicated that the LC50 and LC90 of S. yirgalemense were 48.29 and 260.63 IJs/pupa, respectively. The study also showed that the pupal cases do not affect the efficacy of S. yirgalemense as it caused more than 90 % mortality of cased pupae of Gonipterus sp. n. 2 in soil bioassays. In addition, pupal age did not affect the efficacy of S. yirgalemense. Based on our findings, S. yirgalemense is a potential candidate for the biological control of pupae of Gonipterus sp. n. 2.

Taxonomic and molecular characterization of a new entomopathogenic nematode species, Heterorhabditis casmirica n. sp., and whole genome sequencing of its associated bacterial symbiont

BackgroundNematodes of the genus Heterorhabditis are important biocontrol agents as they form a lethal combination with their symbiotic Photorhabdus bacteria against agricultural insect pests. This study describes a new species of Heterorhabditis.MethodsSix Heterorhabditis nematode populations were recovered from agricultural soils in Jammu and Kashmir, India. An initial examination using mitochondrial and nuclear genes showed that they belong to a new species. To describe this new species, a variety of analyses were conducted, including reconstructing phylogenetic relationships based on multiple genes, characterizing the nematodes at the morphological and morphometric levels, performing self-crossing and cross-hybridization experiments, and isolating and characterizing their symbiotic bacteria.ResultsThe newly discovered species, Heterorhabditis casmirica n. sp., shares 94% mitochondrial cytochrome C oxidase subunit I gene (COI) sequence identity with Heterorhabditis bacteriophora and Heterorhabditis ruandica, and 93% with Heterorhabditis zacatecana. Morphologically, it differs from H. bacteriophora in its infective juvenile phasmids (present vs. inconspicuous) and bacterial pouch visibility in the ventricular portion of the intestine (invisible vs. visible); genital papilla 1 (GP1) position (at manubrium level vs. more anterior), and in its b ratio (body length/neck length), c ratio (tail length/bulb width), and D% [(excretory pore/neck length) × 100]. Other morphological differences include anterior end to the nerve ring distance (77–100 vs. 121–130 μm), V% [(anterior end of vulva/body length) × 100] (46–57 vs. 41–47) in hermaphroditic females; rectum size (slightly longer than the anal body diameter vs. about three times longer), phasmids (smaller vs. inconspicuous), body length (0.13–2.0 vs. 0.32–0.39 mm), body diameter (73–150 vs. 160–220 μm), anterior end to the excretory pore distance (135–157 vs. 174–214 μm), and demanian ratios in amphimictic females. Morphological differences with H. ruandica and H. zacatecana were also observed. Furthermore, H. casmirica n. sp. did not mate or produce fertile progeny with other Heterorhabditis nematodes reported from India. It was also discovered that H. casmirica n. sp. is associated with 'Photorhabdus laumondii subsp. clarkei symbiotic bacteria.ConclusionsThe discovery of H. casmirica n. sp. provides novel insights into the diversity and evolution of Heterorhabditis nematodes and their symbiotic bacteria. This new species adds to the catalog of entomopathogenic nematodes in India.Graphical

Screening of two native isolates of entomopathogenic nematodes, Heterorhabditis indica and Heterorhabditis bacteriophora, for temperature and moisture stress tolerance

Entomopathogenic nematodes (EPNs) are obligate parasites infecting a wide range ofinsect species and are oneof promising biocontrol agents with potential in insect pest management. Temperature and soil moisture play an important role for their sustenance in soil and their efficiency varies greatly under different climatic conditions. The present studywas aimed to study the effect oftemperature and soil moisture on survival, infectivity and reproduction of two EPNs viz., Heterorhabditis indica and H. bacteriophora. The IJs of both the EPNs were exposed to different temperatures and soil moisture levels. Results revealed that survival of both EPNs effected at 5ºC. Survival of H. indica decreased from 54% to 29% after exposure to 5ºC for 48 h. None of the EPNs survived at 35ºC and 40ºC. Infectivity and reproduction potential of both the EPNs tested was highest at 30ºC. No decrease in infectivity was observed with increase in exposure time to different temperatures in both the EPN species. Slight decrease in reproductive potential was observed in H. bacteriophora when exposed to 30ºC for 48h. None of the tested EPNs infected Galleria mellonella larva at 5ºC, 35ºC and 40ºC. Both the EPNs tested showed high infectivity at soil moistures more than 10%. Minimum infection was observed at soil moistures below 10%. Our study revealed that temperature range of 20ºC-30ºC and soil moisture of &gt;10% was found optimum for survival, infectivity and reproduction ofthe testedEPNs. Both the EPNs in this study showed similar temperature and moisture requirements.

In vitro liquid mass production of a South African isolate of Heterorhabditis zealandica

Developing repeatable protocols for the in vitro liquid mass production of entomopathogenic nematodes (EPNs) is a difficult task and depends on the nematode species being cultured. Of critical importance is the establishment of a monoxenic population of nematodes as a stock culture for optimisation and experimental purposes. Establishing a new stock inoculum culture flask of pure infective juveniles (IJs) is challenging, particularly for the Heterorhabditis species, due to their affinity for developing into an amphimictic second generation that does not copulate in liquid culture flasks. Developing mass production protocols for multiple EPNs is advisable because different pest insects are susceptible to different species of EPN. This study attempted to mass-produce a South African isolate of Heterorhabditis zealandica and its symbiotic bacteria, Photorhabdus thracensis, using in vitro liquid culture technology methods previously developed for Steinernema species. The results indicate that the pre-culture protocols developed for Steinernema species are applicable to a H. zealandica isolate. Moreover, the results, in terms of the protein source optimisation experiments, confirm that different EPN species have different culture conditions and nutrient requirements, with H. zealandica seeming to prefer soy-based protein instead of egg yolk, having higher recovery and producing more hermaphrodites, using soy protein. This study illustrates the importance of developing dependable and infallible preculture methods, prior to the flask mass production process.

Bazı pestisitlerin entomopatojen nematodların (Rhabditida: Heterorhabditidae ve Steinernematidae) yönelimleri üzerine etkisi

Entomopathogenic nematodes (EPNs) play a crucial role in biological control, but they can be also applied together with pesticides. Therefore, the compatibility of pesticides with EPNs and the influence on their behavior significantly affect field success. This study investigated how selected pesticides (Deltamethrin, Imidacloprid, Pendimethalin, 2,4-D, and Boscalid + Pyraclostrobin) affect the orientation behavior of three commercial EPN species. Trials were conducted using steel olfactometers followed by the assessment of EPN dispersal ratios after 24 hours. The study was conducted in the Laboratory of the Plant Protection Department, Faculty of Agriculture and Natural Sciences, Bilecik Şeyh Edebali University between 2022 and 2023. According to the results, while nearly all pesticides exhibited a significant impact on the dispersal behavior of EPNs, the most notable effects were observed in the trials involving 2,4-D and Imidacloprid. These two pesticides demonstrated both repellent and attractive effects on different EPN species. The impact of other pesticides was comparatively negligible. All EPN species exhibited higher orientation towards larvae than the control application. The orientation behavior displayed variations depending on the pesticide type and the EPN species involved. It is expected that this study will contribute to our understanding of the relationship between EPNs and pesticides, and ultimately enhancing the efficacy of EPNs.