End Of Intron Research Articles

Genome-wide analyses supported by RNA-Seq reveal non-canonical splice sites in plant genomes

BackgroundMost eukaryotic genes comprise exons and introns thus requiring the precise removal of introns from pre-mRNAs to enable protein biosynthesis. U2 and U12 spliceosomes catalyze this step by recognizing motifs on the transcript in order to remove the introns. A process which is dependent on precise definition of exon-intron borders by splice sites, which are consequently highly conserved across species. Only very few combinations of terminal dinucleotides are frequently observed at intron ends, dominated by the canonical GT-AG splice sites on the DNA level.ResultsHere we investigate the occurrence of diverse combinations of dinucleotides at predicted splice sites. Analyzing 121 plant genome sequences based on their annotation revealed strong splice site conservation across species, annotation errors, and true biological divergence from canonical splice sites. The frequency of non-canonical splice sites clearly correlates with their divergence from canonical ones indicating either an accumulation of probably neutral mutations, or evolution towards canonical splice sites. Strong conservation across multiple species and non-random accumulation of substitutions in splice sites indicate a functional relevance of non-canonical splice sites. The average composition of splice sites across all investigated species is 98.7% for GT-AG, 1.2% for GC-AG, 0.06% for AT-AC, and 0.09% for minor non-canonical splice sites. RNA-Seq data sets of 35 species were incorporated to validate non-canonical splice site predictions through gaps in sequencing reads alignments and to demonstrate the expression of affected genes.ConclusionWe conclude that bona fide non-canonical splice sites are present and appear to be functionally relevant in most plant genomes, although at low abundance.

Description of Molecular Prognostic Markers in AML Uruguayan Patients

Acute myeloblastic leukemias (AML) are the most frequent acute leukemias in adults. Recent genomic and candidate gene studies identified novel recurrent somatic mutations in patients with AML with biological, clinical and therapeutic significance. In Uruguay, the characterization of AML is dependent on the integration of cytomorphology, immunophenotype, cytogenetics and molecular biology (mutations in FLT3, NPM1, CEBPA and cKIT). This allows stratification in prognostic risk groups and rationalization of therapeutic resources. However, with this molecular markers, complete stratification is not always succesful in patients with normal karyotype ( NK) .In order to expand the AML genetic markers analysis in Uruguayan patients ( 3.000.0000 persons country ) ; DNA samples from 49 adult patients at the onset of the disease and 3 healthy controls were analyzed by next generation sequencing (NGS, Illumina) using a customized panel of 30 cancer associated genes. After excluding synonymous variants and those with a population frequency >1%, we ended with 493 variants in promoters and intron ends, and 173 in the 28 genes coding regions. Notably, all patients had at least one variant.While none of the non-coding region variants were reported as pathogenic in COSMIC and/or ClinVar databases, 45 of those falling in coding regions were reported as pathogenic. The pathogenic variants were detected in 36/49 patients and 1 healthy control distributed in 16 genes. The most affected genes were TET2, NRAS, DNMT3, FLT3 and cKIT with 7, 6, 5, 4, 4 variants respectively.This preliminar findings in this study, highlight the relevance of detecting gene variability underlying prognostic risk subgroups to deliver patient tailored clinical decision support. The correlation between the genetic abnormalities, associated with the clinicopahtological features and the epigenetic studies have prognostic significance, and are continued to be analyzed. DisclosuresNo relevant conflicts of interest to declare.

Altered Splicing from a Mutated Alternate Branch Point Is Common in Severe Alpha-Spectrin Linked Inherited Anemia

Hereditary spherocytosis (HS), the most common inherited hemolytic anemia in Northern Europeans, is dominantly inherited in ~two third of cases. Clinically, patients with nondominant HS (ndHS) are more severely affected than those with typical, dominant HS. Biochemical and genetic studies implicate defects of α-spectrin in most ndHS patients and in patients with the related disorder hereditary pyropoikilocytosis (HPP). However, in most cases, neither the precise genetic basis nor the mechanism of disease are known. We studied individuals from 23 kindreds: 10 ndHS kindreds, 3 HPP kindreds, and 10 kindreds with transfusion-dependent (TD) anemia, using whole exome sequencing. A variety of novel mutant SPTA1 alleles were identified, including nonsense, splicing, and insertion/deletion mutations, frequently in trans to missense mutations. One patient had no SPTA1 mutations and 14 patients had only one SPTA1 mutation. Patients with 0 or 1 mutation all carried the common ndHS-linked α-spectrinBug Hill allele. We hypothesized that a production-defective SPTA1 allele is shared by these patients and is in linkage disequilibrium with the αBug Hill allele. Whole genome sequencing was performed on 2 ndHS patients heterozygous for the αBug Hill variant. Data were compared to samples in the 1000 Genomes database with the αBug Hill variant. A series of genetic analyses revealed a single common SPTA1 variant, the αLEPRA allele. This variant, described in a ndHS patient in trans to an SPTA1 nonsense mutation (JCI 98:2300, 1996), was associated with an elongated α-spectrin mRNA transcript. The αLEPRA allele was only present on 4 of 4610 alleles in 1000 Genomes. In all 4 cases, it was heterozygous and in cis to the αBugHill allele. Analysis of αBugHill haplotypes revealed 3 predominant patterns with the haplotype of the ndHS patients identical to the 4 heterozygous αLEPRA individuals. Genotyping the mutation-negative patient alleles revealed all carried the αLEPRA mutation. In the original report, RT-PCR of reticulocyte RNA demonstrated the αLEPRA allele was associated with an elongated α-spectrin mRNA transcript originating 70nt from the 3' end of intron 30. It was unclear if or how the αLEPRA mutation influenced α-spectrin mRNA splicing, as identical elongated α-spectrin mRNA transcripts are observed in erythroid cells from patients who do not carry the αLEPRA allele. Splicing analysis of intron 30 using SCROOGLE predicted: 1) a branch point at the expected location 31bp 5' of exon 31 (branch point 1, BP1); 2) an alternate upstream branch point centered on an “A” 2bp 3' of the αLEPRA mutation (BP2) 98bp 5' of exon 31; 3) identified a novel alternate 3' acceptor site downstream of BP2; and 4) the αLEPRA mutation significantly improves BP2. To determine if BP2 is a functional BP, we studied SPTA1 splicing using minigene assays in K562 cells. Wild type (WT) minigenes produced a small amount of elongated α-spectrin mRNA, while mutation of the obligate “A” of BP2 completely eliminated elongated transcript production. Mutation of the BP2 “A” using CRISPRCas9-based gene editing on a WT background in K562 cells eliminated the elongated α-spectrin mRNA transcripts. Minigene assays also revealed deletion of the alternate 3' acceptor splice site or improvement of BP1 to a U2 consensus site both eliminated the elongated transcript. Thus the αLEPRA mutation in intron 30, located upstream of an alternate 3' acceptor site, changes a weak alternate BP to a strong BP in the context of a poor primary BP. These changes lead to increased utilization of an alternate 3'acceptor site, creating an elongated transcript that leads to frameshift with a novel termination codon. This termination codon is in a position predicted to activate nonsense mediated decay (NMD). To address whether NMD of the elongated transcript is the mechanism of α-spectrin deficiency, we created K562 cells homozygous for the αLEPRA allele using gene editing and treated them with emetine or cycloheximide, NMD inhibitors. In both WT and homozygous αLEPRA cells, the total amount of elongated transcript increased relative to WT. These studies resolve an important unanswered question by demonstrating a novel mechanism of genetic disease is responsible for many cases of ndHS, HPP, and TD anemia. These data will facilitate disease diagnosis, as most current diagnostic gene panels do not include this intronic region, and they identify a new target for therapeutic gene manipulation. DisclosuresNo relevant conflicts of interest to declare.

A naturally occurring insertion in the RsFLC2 gene associated with late-bolting trait in radish (Raphanus sativus L.)

Premature flowering reduces the yield and quality of the harvested fleshy taproot in radish. However, there has been little molecular marker research on the radish late-bolting trait. In this study, F2 and F2:3 populations derived from a cross of “Ninengo” (late-bolting) and “Maer” (early-bolting) were analyzed to map late-bolting genes. Five hundred insertion and deletion (InDel) markers were designed according to the whole-genome resequencing data of the two parents. A genetic map was constructed based on the F2 population, and a late-bolting gene was detected in a 1.1-cM region between the markers InDel520 and InDel535 on chromosome R02 that explained the highest (76.4%) phenotypic variance. RsFLC2 was identified as a candidate gene in this region. Notably, “Ninengo” contains a 1627-bp insertion near the 5′ end of the first intron of RsFLC2. Allelic variation analyses in the F2 population further validated that RsFLC2was associated with the late-bolting trait in radish. The expression pattern of RsFLC2 was significantly different between “Ninengo” and “Maer” during vernalization. Vernalization suppressed RsFLC2 expression, and the 1627-bp insertion in the first intron weakened gene repression in “Ninengo” plants, resulting in late-bolting. This study lays a foundation for uncovering the molecular mechanism of late-bolting and marker-assisted selection for breeding late-bolting varieties of radish.

Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, some significant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

Splice-site mutation causing partial retention of intron in the FLCN gene in Birt-Hogg-Dub\xe9 syndrome: a case report

BackgroundBirt-Hogg-Dubé syndrome (BHD) is an autosomal dominant disorder caused by germline mutations in the folliculin gene (FLCN). Nearly 150 pathogenic mutations have been identified in FLCN. The most frequent pattern is a frameshift mutation within a coding exon. In addition, splice-site mutations have been reported, and previous studies have confirmed exon skipping in several cases. However, it is poorly understood whether there are any splice-site mutations that cause translation of intron regions in FLCN.Case presentationA 59-year-old Japanese patient with multiple pulmonary cysts and pneumothorax was hospitalized due to dyspnea. BHD was suspected and genetic testing was performed. The patient exhibited the splice-site mutation of FLCN in the 5′ end of intron 9 (c.1062 + 1G > A). Total mRNA was extracted from pulmonary cysts, and RT-PCR assessment and sequence analyses were done. Two distinct bands were generated; one was wild-type and the other was a larger-sized mutant. Sequence analysis of the latter transcript revealed the insertion of 130 base pairs of intron 9 from the beginning of the splice-site between exons 9 and 10.ConclusionTo our knowledge, this is the first report of distinct intron insertion using a BHD patient’s diseased tissue-derived mRNA. The present case suggests that a splice-site mutation can lead to exon skipping as well as intron reading mRNA. The splicing process may be dependent in part on whether the donor or acceptor site is affected.

A mechanistic base for alternative splicing of human immune system-derived thyroid stimulating hormone (TSH) β-subunit.

Abstract Thyroid stimulating hormone (TSH) is a glycoprotein hormone consisting of an α and a β chain. Within the hypothalamus-pituitary-thyroid axis, TSH is produced by thyrotropic cells in the anterior pituitary. Upon release into the circulation, TSH binds to receptors in the thyroid, resulting in the release of triiodothyronine (T3) and thyroxine (T4). T3 and T4 regulate nearly every aspect of mammalian physiology, including basal metabolism, growth and development, mood, and cognition. Although TSHβ has been known for years to be produced by cells of the immune system, the functional significance of that has remained unclear. My laboratory identified a splice variant of human TSHβ (TSHβv) that consists of a truncated but biologically active portion of TSHβ made from exon 3 with the deletion of exon 2. The signal peptide of TSHβv is coded for by a portion of the 3′ end of intron 2. TSHβv is primarily produced by bone marrow cells and peripheral blood leukocytes, particularly though not exclusively by cells of the myeloid/monocyte lineage. An unresolved question pertains to the molecular mechanisms that account for TSHβv alternative splicing, Here, a model is presented whereby TSHβv is made through a series of unique genetic reorganization steps. These findings have implications not only for understanding how the TSHβv isoform is made, but also for gaining insights into the involvement of immune system TSHβ in health and disease.

Transcriptome-wide Interrogation of the Functional Intronome by Spliceosome Profiling

Full understanding of eukaryotic transcriptomes and how they respond to different conditions requires deep knowledge of all sites of intron excision. Although RNA sequencing (RNA-seq) provides much of this information, the low abundance of many spliced transcripts (often due to their rapid cytoplasmic decay) limits the ability of RNA-seq alone to reveal the full repertoire of spliced species. Here, we present "spliceosome profiling," a strategy based on deep sequencing of RNAs co-purifying with late-stage spliceosomes. Spliceosome profiling allows for unambiguous mapping of intron ends to single-nucleotide resolution and branchpoint identification at unprecedented depths. Our data reveal hundreds of new introns in S.pombe and numerous others that were previously misannotated. By providing a means to directly interrogatesites of spliceosome assembly and catalysis genome-wide, spliceosome profiling promises to transform our understanding of RNA processing in the nucleus, much as ribosome profiling has transformed our understanding mRNA translation in the cytoplasm.

A splice site variant in the SUV39H2 gene in Greyhounds with nasal parakeratosis.

Hereditary nasal parakeratosis (HNPK), described in the Labrador Retriever breed, is a monogenic autosomal recessive disorder that causes crusts and fissures on the nasal planum of otherwise healthy dogs. Our group previously showed that this genodermatosis may be caused by a missense variant located in the SUV39H2 gene encoding a histone 3 lysine 9 methyltransferase, a chromatin modifying enzyme with a potential role in keratinocyte differentiation. In the present study, we investigated a litter of Greyhounds in which six out of eight puppies were affected with parakeratotic lesions restricted to the nasal planum. Clinically and histologically, the lesions were comparable to HNPK in Labrador Retrievers. Whole genome sequencing of one affected Greyhound revealed a 4-bp deletion at the 5'-end of intron 4 of the SUV39H2 gene that was absent in 188 control dog and three wolf genomes. The variant was predicted to disrupt the 5'-splice site with subsequent loss of SUV39H2 function. The six affected puppies were homozygous for the variant, whereas the two non-affected littermates were heterozygous. Genotyping of a larger cohort of Greyhounds revealed that the variant is segregating in the breed and that this breed might benefit from genetic testing to avoid carrier × carrier matings.

Nitrogen use efficiency is regulated by interacting proteins relevant to development in wheat.

SummaryWheat (Triticum aestivum) has low nitrogen use efficiency (NUE). The genetic mechanisms controlling NUE are unknown. Positional cloning of a major quantitative trait locus for N‐related agronomic traits showed that the vernalization gene TaVRN‐A1 was tightly linked with TaNUE1, the gene shown to influence NUE in wheat. Because of an Ala180/Val180 substitution, Ta VRN‐A1a and Ta VRN‐A1b proteins interact differentially with Ta ANR1, a protein encoded by a wheat orthologue of Arabidopsis nitrate regulated 1 (ANR1). The transcripts of both TaVRN‐A1 and TaANR1 were down‐regulated by nitrogen. TaANR1 was functionally characterized in TaANR1::RNAi transgenic wheat, and in a natural mutant with a 23‐bp deletion including 10‐bp at the 5′ end of intron 5 and 13‐bp of exon 6 in gDNA sequence in its gDNA sequence, which produced transcript that lacked the full 84‐bp exon 6. Both Ta ANR1 and Ta HOX1 bound to the Ala180/Val180 position of Ta VRN‐A1. Genetically incorporating favourable alleles from TaVRN‐A1, TaANR1 and TaHOX1 increased grain yield from 9.84% to 11.58% in the field. Molecular markers for allelic variation of the genes that regulate nitrogen can be used in breeding programmes aimed at improving NUE and yield in novel wheat cultivars.

Postcatalytic spliceosome structure reveals mechanism of 3'-splice site selection.

Introns are removed from eukaryotic messenger RNA precursors by the spliceosome in two transesterification reactions-branching and exon ligation. The mechanism of 3'-splice site recognition during exon ligation has remained unclear. Here we present the 3.7-angstrom cryo-electron microscopy structure of the yeast P-complex spliceosome immediately after exon ligation. The 3'-splice site AG dinucleotide is recognized through non-Watson-Crick pairing with the 5' splice site and the branch-point adenosine. After the branching reaction, protein factors work together to remodel the spliceosome and stabilize a conformation competent for 3'-splice site docking, thereby promoting exon ligation. The structure accounts for the strict conservation of the GU and AG dinucleotides at the 5' and 3' ends of introns and provides insight into the catalytic mechanism of exon ligation.

Overlapping RdDM and non-RdDM mechanisms work together to maintain somatic repression of a paramutagenic epiallele of maize pericarp color1.

Allelic variation at the Zea mays (maize) pericarp color1 (p1) gene has been attributed to epigenetic gene regulation. A p1 distal enhancer, 5.2 kb upstream of the transcriptional start site, has demonstrated variation in DNA methylation in different p1 alleles/epialleles. In addition, DNA methylation of sequences within the 3’ end of intron 2 also plays a role in tissue-specific expression of p1 alleles. We show here a direct evidence for small RNAs’ involvement in regulating p1 that has not been demonstrated previously. The role of mediator of paramutation1 (mop1) was tested in the maintenance of somatic silencing at distinct p1 alleles: the non-paramutagenic P1-wr allele and paramutagenic P1-rr’ epiallele. The mop1-1 mutation gradually relieves the silenced phenotype after multiple generations of exposure; P1-wr;mop1-1 plants display a loss of 24-nt small RNAs and DNA methylation in the 3’ end of the intron 2, a region close to a Stowaway transposon. In addition, a MULE sequence within the proximal promoter of P1-wr shows depletion of 24nt siRNAs in mop1-1 plants. Release of silencing was not correlated with small RNAs at the distal enhancer region of the P1-wr allele. We found that the somatic silencing of the paramutagenic P1-rr’ is correlated with significantly reduced H3K9me2 in the distal enhancer of P1-rr’; mop1-1 plants, while symmetric DNA methylation is not significantly different. This study highlights that the epigenetic regulation of p1 alleles is controlled both via RdDM as well as non-RdDM mechanisms.

A novel HER2 gene body enhancer contributes to HER2 expression

The transcriptional regulation of the human epidermal growth factor receptor-2 (HER2) contributes to an enhanced HER2 expression in HER2-positive breast cancers with HER2 gene amplification and HER2-low or HER2-negative breast cancers following radiotherapy or endocrine therapy, and this drives tumorigenesis and the resistance to therapy. Epigenetic mechanisms are critical for transcription regulation, however, such mechanisms in the transcription regulation of HER2 are limited to the involvement of tri-methylated histone 3 lysine 4 (H3K4me3) and acetylated histone 3 lysine 9 (H3K9ac) at the HER2 promoter region. Here, we report the identification of a novel enhancer in the HER2 3’ gene body, which we have termed HER2 gene body enhancer (HGE). The HGE starts from the 3’ end of intron 19 and extends into intron 22, possesses enhancer histone modification marks in specific cells and enhances the transcriptional activity of the HER2 promoters. We also found that TFAP2C, a known regulator of HER2, binds to HGE and is required for its enhancer function and that DNA methylation in the HGE region inhibits the histone modifications characterizing enhancer and is inversely correlated with HER2 expression in breast cancer samples. The identification of this novel enhancer sheds a light on the roles of epigenetic mechanisms in HER2 transcription, in both HER2-positive breast cancer samples and individuals with HER2-low or HER2-negative breast cancers undergoing radiotherapy or endocrine therapy.

Optimization of trans-Splicing for Huntington's Disease RNA Therapy

Huntington's disease (HD) is a devastating neurodegenerative disorder caused by a polyglutamine (polyQ) expansion in exon 1 of the Huntingtin (HTT) gene. We have previously demonstrated that spliceosome-mediated trans-splicing is a viable molecular strategy to specifically reduce and repair mutant HTT (mtHTT). Here, the targeted tethering efficacy of the pre-mRNA trans-splicing modules (PTM) in HTT was optimized. Various PTMs that targeted the 3′ end of HTT intron 1 or the intron 1 branch point were shown trans-splice into an HTT mini-gene, as well as the endogenous HTT pre-mRNA. PTMs that specifically target the endogenous intron 1 branch point increased the trans-splicing efficacy from 1–5 to 10–15%. Furthermore, lentiviral expression of PTMs in a human HD patient iPSC-derived neural culture significantly reversed two previously established polyQ-length dependent phenotypes. These results suggest that pre-mRNA repair of mtHTT could hold therapeutic benefit and it demonstrates an alternative platform to correct the mRNA product produced by the mtHTT allele in the context of HD.

Bm-muted, orthologous to mouse muted and encoding a subunit of the BLOC-1 complex, is responsible for the otm translucent mutation of the silkworm Bombyx mori

“Tanaka's mottled translucent” (otm) is a mutation of the silkworm Bombyx mori that exhibits translucent skin during larval stages. We performed positional cloning of the gene responsible for otm and mapped it to a 364-kb region on chromosome 5 that contains 22 hypothetical protein-coding genes. We performed RNA-seq analysis of the epidermis and fat body of otm larvae and determined that the gene BGIBMGA002619 may be responsible for the otm mutation. BGIBMGA002619 encodes the biosynthesis of lysosome-related organelles complex 1 (BLOC-1) subunit 5, whose ortholog is responsible for the Muted mutant in mouse. Accordingly, we named this gene Bm-muted. We discovered that the expression of Bm-muted in the epidermis and fat body of otm mutants was dramatically suppressed compared with the wild type. We determined the nucleotide sequences of the full-length cDNA and genomic region corresponding to Bm-muted and found that a 538-bp long DNA sequence similar to B. mori transposon Organdy was inserted into the 3′ end of the first intron of Bm-muted in two otm strains. The Bm-muted cDNA of otm mutants lacked exon 2, and accordingly generated a premature stop codon in exon 3. In addition, short interfering RNA (siRNA)-mediated knockdown of this gene caused localized partial translucency of larval skin. These data indicate that the mutation in Bm-muted caused the otm-mutant phenotype. We propose that the insertion of Organdy caused a splicing disorder in Bm-muted in the otm mutant, resulting in a null mutation of Bm-muted. This mutation is likely to cause deficiencies in urate granule formation in epidermal cells that result in translucent larval skin.

Unsupervised detection of regulatory gene expression information in different genomic regions enables gene expression ranking

BackgroundThe regulation of all gene expression steps (e.g., Transcription, RNA processing, Translation, and mRNA Degradation) is known to be primarily encoded in different parts of genes and in genomic regions in proximity to genes (e.g., promoters, untranslated regions, coding regions, introns, etc.). However, the entire gene expression codes and the genomic regions where they are encoded are still unknown.ResultsHere, we employ an unsupervised approach to estimate the concentration of gene expression codes in different non-coding parts of genes and transcripts, such as introns and untranslated regions, focusing on three model organisms (Escherichia coli, Saccharomyces cerevisiae, and Schizosaccharomyces pombe). Our analyses support the conjecture that regions adjacent to the beginning and end of ORFs and the beginning and end of introns tend to include higher concentration of gene expression information relatively to regions further away. In addition, we report the exact regions with elevated concentration of gene expression codes. Furthermore, we demonstrate that the concentration of these codes in different genetic regions is correlated with the expression levels of the corresponding genes, and with splicing efficiency measurements and meiotic stage gene expression measurements in S. cerevisiae.ConclusionWe suggest that these discoveries improve our understanding of gene expression regulation and evolution; they can also be used for developing improved models of genome/gene evolution and for engineering gene expression in various biotechnological and synthetic biology applications.

SF3B1 Interactions with Chromatin Are Dynamic and Regulated in a Cell Cycle-Dependent Manner

Splicing factor 3B1 (SF3B1) is a member of the U2 snRNP complex that is a key regulator of RNA splicing. RNA splicing begins with the recognition of splice sites (ss) at the 5' and 3' ends of introns and ends with the removal of introns and joining of exons flanking them. SF3B1 plays an important role in this process by facilitating the recognition of the 3'ss. SF3B1 is frequently mutated in numerous cancers as well as the myelodysplastic syndromes (MDS). Mutations within the HEAT domain of the protein potentially contribute to disease pathogenesis. In addition to influencing splicing by binding to pre-mRNA, SF3B1 has been shown to affect splicing of exons by associating with them directly on chromatin via histone/nucleosome interactions. However, it is not understood if or how SF3B1 association with chromatin is regulated. Given that N-terminal serine and threonine residues on SF3B1 are known substrates of cyclin E-Cdk2, which phosphorylates histone subunits and other chromatin associated proteins, we hypothesized that CDK2 activity regulates SF3B1-nucleosome interactions. Although SF3B1 is phosphorylated during splicing catalysis, the function of this phosphorylation has remained unknown. We have now discovered, using nucleosome preparations and histone subunit co-immunoprecipitation assays in synchronized cells, that endogenous SF3B1 interacts with nucleosomes in a highly cell-cycle dependent manner, while total cellular abundance of SF3B1 remains invariant during cell cycle progression. In human and mouse cells, including hematopoietic cell lines, SF3B1 is excluded from chromatin during both G0 (quiescence) and G2/M phases of cell cycle. Notably, SF3B1 is enriched within chromatin maximally during S-phase. Unexpectedly, we found that the inhibition of Cdc2 (Cdk1) during G2/M enforces the SF3B1-chromatin interaction, pointing to a direct role for Cdc2 in restraining this interaction during mitosis. Further, SF3B1 loading onto chromatin during early cell cycle progression from G0 to S-phase is inhibited by Cdk2 inhibition. Thus, Cdk2 and Cdc2 appear to have antagonistic roles in controlling SF3B1-chromatin interactions during the cell cycle. Our findings suggest that Cdk activity may regulate the recruitment of the spliceosome machinery in order to coordinate splicing of particular transcripts with cell cycle progression. Current studies are focusing on how disease-associated mutations in the HEAT domain of SF3B1 affect the dynamics of its cell cycle-dependent interaction with nucleosomes and corresponding alterations to splicing outcomes. DisclosuresNo relevant conflicts of interest to declare.

Chtop (Chromatin target of Prmt1) auto-regulates its expression level via intron retention and nonsense-mediated decay of its own mRNA

Chtop (chromatin target of Prmt1) regulates various aspects of gene expression including transcription and mRNA export. Despite these important functions, the regulatory mechanism underlying Chtop expression remains undetermined. Using Chtop-expressing human cell lines, we demonstrate that Chtop expression is controlled via an autoregulatory negative feedback loop whereby Chtop binds its own mRNA to retain intron 2 during splicing; a premature termination codon present at the 5′ end of intron 2 leads to nonsense-mediated decay of the mRNA. We also show that Chtop interacts with exon 2 of Chtop mRNA via its arginine-glycine-rich (RG) domain, and with intron 2 via its N-terminal (N1) domain; both are required for retention of intron 2. In addition, we show that hnRNP H accelerates intron 2 splicing of Chtop mRNA in a manner dependent on Chtop expression level, suggesting that Chtop and hnRNP H regulate intron 2 retention of Chtop mRNA antagonistically. Thus, the present study provides a novel molecular mechanism by which mRNA and protein levels are constitutively regulated by intron retention.

The Werner syndrome RECQ helicase targets G4 DNA in human cells to modulate transcription.

The Werner syndrome (WS) is a prototypic adult Mendelian progeroid syndrome in which signs of premature aging are associated with genomic instability and an elevated risk of cancer. The WRN RECQ helicase protein binds and unwinds G-quadruplex (G4) DNA substrates in vitro, and we identified significant enrichment in G4 sequence motifs at the transcription start site and 5' ends of first introns (false discovery rate < 0.001) of genes down-regulated in WS patient fibroblasts. This finding provides strong evidence that WRN binds G4 DNA structures at many chromosomal sites to modulate gene expression. WRN appears to bind a distinct subpopulation of G4 motifs in human cells, when compared with the related Bloom syndrome RECQ helicase protein. Functional annotation of the genes and miRNAs altered in WS provided new insight into WS disease pathogenesis. WS patient fibroblasts displayed altered expression of multiple, mechanistically distinct, senescence-associated gene expression programs, with altered expression of disease-associated miRNAs, and dysregulation of canonical pathways that regulate cell signaling, genome stability and tumorigenesis. WS fibroblasts also displayed a highly statistically significant and distinct gene expression signature, with coordinate overexpression of nearly all of the cytoplasmic tRNA synthetases and associated ARS-interacting multifunctional protein genes. The 'non-canonical' functions of many of these upregulated tRNA charging proteins may together promote WS disease pathogenesis. Our results identify the human WRN RECQ protein as a G4 helicase that modulates gene expression in G4-dependent fashion at many chromosomal sites and provide several new and unexpected mechanistic insights into WS disease pathogenesis.

Intermediate introns in nuclear genes of euglenids - are they a distinct type?

BackgroundNuclear genes of euglenids contain two major types of introns: conventional spliceosomal and nonconventional introns. The latter are characterized by variable non-canonical borders, RNA secondary structure that brings intron ends together, and an unknown mechanism of removal. Some researchers also distinguish intermediate introns, which combine features of both types. They form a stable RNA secondary structure and are classified into two subtypes depending on whether they contain one (intermediate/nonconventional subtype) or both (conventional/intermediate subtype) canonical spliceosomal borders. However, it has been also postulated that most introns classified as intermediate could simply be special cases of conventional or nonconventional introns.ResultsSequences of tubB, hsp90 and gapC genes from six strains of Euglena agilis were obtained. They contain four, six, and two or three introns, respectively (the third intron in the gapC gene is unique for just one strain). Conventional introns were present at three positions: two in the tubB gene (at one position conventional/intermediate introns were also found) and one in the gapC gene. Nonconventional introns are present at ten positions: two in the tubB gene (at one position intermediate/nonconventional introns were also found), six in hsp90 (at four positions intermediate/nonconventional introns were also found), and two in the gapC gene.ConclusionsSequence and RNA secondary structure analyses of nonconventional introns confirmed that their most strongly conserved elements are base pairing nucleotides at positions +4, +5 and +6/ -8, −7 and −6 (in most introns CAG/CTG nucleotides were observed). It was also confirmed that the presence of the 5' GT/C end in intermediate/nonconventional introns is not the result of kinship with conventional introns, but is due to evolutionary pressure to preserve the purine at the 5' end. However, an example of a nonconventional intron with GC-AG ends was shown, suggesting the possibility of intron type conversion between nonconventional and conventional. Furthermore, an analysis of conventional introns revealed that the ability to form a stable RNA secondary structure by some introns is probably not a result of their relationship with nonconventional introns. It was also shown that acquisition of new nonconventional introns is an ongoing process and can be observed at the level of a single species. In the recently acquired intron in the gapC gene an extended direct repeats at the intron-exon junctions are present, suggesting that double-strand break repair process could be the source of new nonconventional introns.Electronic supplementary materialThe online version of this article (doi:10.1186/s12862-016-0620-5) contains supplementary material, which is available to authorized users.