End Of Antibiotic Treatment Research Articles

Lung clearance index short-term variability in cystic fibrosis: a pre-post pulmonary exacerbation study

BackgroundMultiple Breath washout (MBW) represents an important tool to detect early a possible pulmonary exacerbation especially in Cystic Fibrosis (CF) disease. Lung clearance index (LCI) is the most commonly reported multiple breath washout (MBW) index and in the last years was used as management measure for evaluation. Our aim was to analyze clinical utility of LCI index variability in pulmonary exacerbation in CF after intravenous (IV) antibiotic therapy.MethodsA single-center study was conducted at CF Unit of Bambino Gesù Children’s Hospital among hospitalized > 3 years patients for pulmonary exacerbations and treated with antibiotic IV treatment for 14 days. MBW and spirometry were evaluated within 72 h of admission to hospital and at the end of hospitalization. Descriptive analysis was conducted and correlations between quantitative variables were investigated.ResultsFifty-seven patients (M22/F35) with an average age 18.56 (± 8.54) years were enrolled. LCI2.5 was significantly reduced at the end of antibiotic treatment in both pediatric and adult populations with an average reduction of -6,99%; 37/57 patients denoted an improvement, 20/57 are stable or worsened in LCI2.5 values and 4/57 (7.02%) had a significant deterioration (> 15%) at end of treatment. On the contrary a significative elevation of FEV1 and FVC were found, respectively of + 7,30% and of + 5,46%. A positive good correlection among LCI 2.5 and Scond (rho = + 0,615, p = 0.000) and LCI 2.5 and Sacin (rho = + 0,649, p = 0.000) and a negative strong correlation between FEV1 and LCI 2.5 were found in post treatment period. A similar modification of LCI 2.5 and FEV1 was noticed in both adult and pediatric population.ConclusionsLCI may have a role in the routine clinical care of both adult and pediatric CF patients as a good tool to assess response to IV antibiotic end-therapy in the same way as FEV1.

Plasma neurofilament light significantly decreases following treatment in Lyme neuroborreliosis and is not associated with persistent symptoms.

Currently there is an unmet need for a highly standardized blood biomarker test to monitor treatment response in Lyme neuroborreliosis (LNB). Differentiating between active or past infection is challenged by the relatively high frequency of persistent symptoms after the end of antibiotic treatment (estimated 15%-20%), the variable clinical course and the long-lasting Borrelia burgdorferi antibodies. The aim was therefore to evaluate plasma neurofilament light chain (pNfL) as a marker for disease activity in LNB. This was a prospective cohort of definite LNB (N=36) with blood samples and clinical evaluation including Glasgow Outcome Score at treatment initiation and 3 and 6 months' follow-up. Consecutive plasma was retrospectively analysed for the content of neurofilament light chain by Quanterix® kits (Simoa® NF-light Kit). Plasma neurofilament light chain significantly decreased between treatment initiation and the 3-month follow-up (median 83 pg/ml vs. median 14 pg/ml (25 pairs), p < 0.0001). No significant change was observed between 3 and 6 months' follow-up (median 14 pg/ml vs. median 12 pg/ml (21 pairs), p=0.33). At treatment initiation 90% had pNfL above the age-defined reference compared to only 23% and 7% respectively at 3 and 6 months' follow-up. Decreases in pNfL were mirrored by increasing Glasgow Outcome Score. Reporting persistent symptoms at the 6-month follow-up was not associated with pNfL (relative change from reference or actual values) at baseline or at 6 months' follow-up. Plasma neurofilament light chain decreases following antibiotic treatment in LNB and is not associated with reporting persistent symptoms. It was therefore speculated that it may prove useful as a treatment response biomarker in LNB.

Therapeutic beta-lactam dosages and broad-spectrum antibiotics are associated with reductions in microbial richness and diversity in persons with cystic fibrosis

Persons with cystic fibrosis (PwCF) suffer from pulmonary exacerbations (PEx) related in part to lung infection. While higher microbial diversity is associated with higher lung function, the data on the impact of short-term antibiotics on changes in microbial diversity is conflicting. Further, Prevotella secretes beta-lactamases, which may influence recovery of lung function. We hypothesize that sub-therapeutic and broad spectrum antibiotic exposure leads to decreasing microbial diversity. Our secondary aim was to evaluate the concerted association of beta-lactam pharmacokinetics (PK), antibiotic spectrum, microbial diversity, and antibiotic resistance on lung function recovery using a pathway analysis. This was a retrospective observational study of persons with CF treated with IV antibiotics for PEx between 2016 and 2020 at Children’s National Hospital; respiratory samples and clinical information were collected at hospital admission for PEx (E), end of antibiotic treatment (T), and follow-up (F). Metagenomic sequencing was performed; PathoScope 2.0 and AmrPlusPlus were used for taxonomic assignment of sequences to bacteria and antibiotic resistance genes (ARGs). M/W Pharm was used for PK modeling. Comparison of categorical and continuous variables and pathway analysis were performed in STATA. Twenty-two PwCF experienced 43 PEx. The study cohort had a mean age of 14.6 years. Only 12/43 beta-lactam courses had therapeutic PK, and 18/43 were broad spectrum. A larger decrease in richness between E and T was seen in the therapeutic PK group (sufficient − 20.1 vs. insufficient − 1.59, p = 0.025) and those receiving broad spectrum antibiotics (broad − 14.5 vs. narrow − 2.8, p = 0.030). We did not detect differences in the increase in percent predicted forced expiratory volume in one second (ppFEV1) at end of treatment compared to PEx based on beta-lactam PK (sufficient 13.6% vs. insufficient 15.1%) or antibiotic spectrum (broad 11.5% vs. narrow 16.6%). While both therapeutic beta-lactam PK and broad-spectrum antibiotics decreased richness between PEx and the end of treatment, we did not detect longstanding changes in alpha diversity or an association with superior recovery of lung function compared with subtherapeutic PK and narrow spectrum antimicrobials.

Using metabolic potential within the airway microbiome as predictors of clinical state in persons with cystic fibrosis.

Pulmonary exacerbations (PEx) in persons with cystic fibrosis (CF) are primarily related to acute or chronic inflammation associated with bacterial lung infections, which may be caused by several bacteria that activate similar bacterial genes and produce similar by-products. The goal of our study was to perform a stratified functional analysis of bacterial genes at three distinct time points in the treatment of a PEx in order to determine the role that specific airway microbiome community members may play within each clinical state (i.e., PEx, end of antibiotic treatment, and follow-up). Our secondary goal was to compare the change between clinical states with the metabolic activity of specific airway microbiome community members. This was a prospective observational study of persons with CF treated with intravenous antibiotics for PEx between 2016 and 2020 at Children's National Hospital. Demographic and clinical information as well as respiratory samples were collected at hospital admission for PEx, end of antibiotic treatment, and follow-up. Metagenomic sequencing was performed; MetaPhlAn3 and HUMANn3 were used to assign sequences to bacterial species and bacterial metabolic genes, respectively. Twenty-two persons with CF, with a mean age of 14.5 (range 7-23) years, experienced 45 PEx during the study period. Two-hundred twenty-one bacterial species were identified in the respiratory samples from the study cohort. Ten bacterial species had differential gene abundance across changes in the clinical state including Staphylococcus aureus, Streptococcus salivarius, and Veillonella atypica (all padj < 0.01 and log2FoldChange > |2|). These corresponded to a differential abundance of bacterial genes, with S. aureus accounting for 81% of the genes more abundant in PEx and S. salivarius accounting for 83% of the genes more abundant in follow-up, all compared to the end of treatment. Lastly, 8,653 metabolic pathways were identified across samples, with again S. aureus and S. salivarius contributing to the differential abundance of pathways (106 in PEx vs. 66 in follow-up, respectively). V. atypica was associated with a single metabolic pathway (UDP-N-acetyl-D-glucosamine biosynthesis) increased in follow-up compared to PEx. Taken together, these data suggest that the metabolic potential of bacterial species can provide more insight into changes across clinical states than the relative abundance of the bacteria alone.

Incidence, functional outcomes and cure rate of hematogenous infection in a 2,498 Total Knee Arthroplasties cohort

PurposeThe primary aim of the present study is to report the late acute hematogenous (LAH) prosthetic joint infection (PJI) cure rate following Total knee arthroplasty (TKA) treated by means of debridement, antibiotics, and implant retention (DAIR) in a long-term follow-up. The secondary purpose is to report the functional outcomes at that follow-up and to compare them with a non-infected group.Material and MethodsThis study cohort consists of 2,498 TKA performed from September 2005 to April 2010 that had a minimum follow-up of 10 years. The diagnosis of PJI and classification into LAH was done in accordance with the Zimmerli criteria. The primary outcome was the failure rate, defined as death before the end of antibiotic treatment, a further surgical intervention for treatment of infection, life-long antibiotic suppressive treatment or chronic infection. The Knee Society Score (KSS) was used to evaluate clinical outcomes.ResultsTen patients were diagnosed with acute hematogenous PJI during the study period (0.4%). All of them were managed with DAIR, which was performed by a knee surgeon and/or PJI surgeon. The failure rate was 0% at the 8.5-year (SD, 2.4) follow-up mark. The KSS score was 82.1 vs. 84.1 (p n.s.) at final follow-up.ConclusionAlthough the literature suggests that TKA DAIR for LAH periprosthetic joint infection is associated with high rates of failure, the results presented here suggest a high cure rate with good functional outcomes.Level of evidenceLevel II, prospective cohort study.

Long-term impact of persistent vegetations at 6 month followup after treatment of infective endocarditis: a substudy of the Partial Oral vs Intravenous Antibiotic Treatment of Endocarditis (POET) tria

Abstract Background Our knowledge of changes in vegetation size throughout the course of infective endocarditis (IE) and the impact of persistent vegetations on mortality or embolization after completed antibiotic treatment is sparse. No study has previously investigated the prevalence or clinical impact of persistent vegetations on transthoracic echocardiography (TTE) at 6-months follow-up after ended IE treatment. Purpose To investigate the association between persistent vegetations at the 6-months TTE after treatment for IE and long-term prognosis as assessed in the POET trial. Methods The POET trial was a nationwide, multicenter RCT, randomizing 400 patients to either partial oral or intravenous (IV) antibiotic treatment of left-sided IE, after initial stabilization of infection using conventional IV therapy. A persistent vegetation was defined as a vegetation seen on 6-months follow-up TTE (4–7 months) after ended antibiotic treatment for IE. In the POET trial, primary outcome was defined as 1) all-cause mortality, 2) unplanned cardiac surgery, 3) embolic events or 4) relapse of bacteremia, in the 5-year follow-up period. Patients without TTE due to death or lack of available TTE were excluded. Results Out of 400 patients, 20 were excluded due to death during 6-months follow-up, and 201 were excluded due to unavailable TTE, leaving 179 TTEs for analysis. At 6-months follow-up, a persistent vegetation was seen in 30 patients (16.7%, 21 males (70%), mean age 69.6 years (SD 7.7)) (Table 1). Seventeen patients (56.7%) had a persistent vegetation on the aortic valve and 13 patients (43.3%) on the mitral valve. More patients without a persistent vegetation had undergone initial surgical treatment of IE than those with a vegetation (57.7 vs 23.3%, p=0.001). In all surgically treated patients with persistent vegetation at 6-months follow-up, the vegetation was found on another valve than the operated valve. The composite primary outcome from 6-months follow-up and until 5-year follow-up occurred in 8 patients (26.7%) with a persistent vegetation, compared to 38 patients (25.5%) (p=1.00) without. (Table 2) In patients randomized for peroral treatment, no significant difference in prevalence of persistent vegetation was found (15 patients (50%) with persistent vegetations vs. 74 patients (49.7%) without, p=1.00). Conclusion The occurrence of persistent vegetations at 6 months follow-up was 16.7%. There was no association between persistent vegetations at 6-months follow-up and the occurrence of the primary outcome after 5 years follow-up, suggesting that the risk associated with residual vegetations after end of antibiotic treatment is negligible after 6-months. Funding Acknowledgement Type of funding sources: Foundation. Main funding source(s): The Danish Heart Foundation

Study of factors related to recurrence within 30 days after pneumonia treatment for community-onset pneumonia

IntroductionIt is not uncommon for patients hospitalized with pneumonia to experience an early relapse. Here, we investigated the factors related to pneumonia recurrence in Japan. PurposeWe aimed to elucidate the factors related to early recurrence after completion of pneumonia treatment. MethodsWe examined 696 patients with community-acquired pneumonia (CAP) and nursing and healthcare-associated pneumonia (NHCAP) who were admitted to our hospital between October 2010 and February 2018, excluding those who died during hospitalization. Logistic regression analysis was used to assess the endpoint of recurrence within 30 days after the end of antibiotic treatment. ResultsNHCAP, chronic lung disease and duration of antibiotic treatment were significant risk factors for recurrence of pneumonia within 30 days after antibiotic discontinuation. Aspiration pneumonia was not be a significant factor in the early recurrence of pneumonia. ConclusionsLong-term use of antimicrobials may be a risk factor in early recurrence of pneumonia.

Importance of beta-lactam pharmacokinetics and pharmacodynamics on the recovery of microbial diversity in the airway of persons with cystic fibrosis

Cystic fibrosis (CF) is a chronic lung disease characterized by acute pulmonary exacerbations (PExs) that are frequently treated with antibiotics. The impact of antibiotics on airway microbial diversity remains a...

Clinical features and outcome of Streptococcus agalactiae bone and joint infections over a 6-year period in a French university hospital

Bone and joint infections (BJIs) due to Streptococcus agalactiae are rare but has been described to increase in the past few years. The objective of this study was to describe clinical features and outcomes of cases of S. BJIs. We conducted a retrospective analysis of adult cases of S. agalactiae BJIs that occurred between January 2009 and June 2015 in a French university hospital. The treatment success was assessed until 24 months after the end of antibiotic treatment. Among the 26 patients included, 20 (77%) were male, mean age was 62 years ± 13 and mean Charlson comorbidity index score was 4.9 ± 3.2. Diabetes mellitus was the most common comorbidity (n = 14, 54%). Six had PJI (Prosthetic Joint Infections), five osteosynthesis-associated infections, 11 osteomyelitis and four native septic arthritis. Eleven patients had a delayed or late infection: six with a prosthetic joint infection and five with an internal fixation device infection. Sixteen patients (62%) had a polymicrobial BJI, most commonly with Gram-positive cocci (75%) notably Staphylococcus aureus (44%). Polymicrobial infections were more frequently found in foot infections (90% vs 44%, p = 0.0184). During the two-year follow-up, three patients died (3/25, 12%) and seven (7/25, 28%) had treatment failure. Diabetes mellitus was the most common comorbidity. We observed an heterogenous management and a high rate of relapse.

99mTc-white blood cell SPECT/CT to assess diabetic foot osteomyelitis remission: contribution of semi-quantitative scoring system.

We previously reported that 99mTc-White blood cell (WBC) single-photon emission computed tomography (SPECT/CT) could be a useful tool to assess diabetic foot osteomyelitis (DFO) remission and guide the duration of antibiotic treatment. The aim of the present study was to evaluate the performance and reproducibility of two analysis methods to diagnose DFO remission using 99mTc-WBC-SPECT/CT. 99mTc-WBC-SPECT/CT performed for patients with DFO at the end of antibiotic treatment were retrospectively read by two nuclear physicians (one senior and one junior). Assessment by conventional visual analysis and by the use of a semi-quantitative scoring system, the composite score index (CSI), was performed. The performance and reproducibility of methods were compared between the two nuclear physicians. Successful treatment of DFO was defined by the absence of DFO relapse at the same site within 1 year. A total of 68 patients with 74 DFO were included. Three were excluded from the analysis due to the low quality of SPECT/CT; among the 71 DFO analyzed, 11 (15.5%) had a relapse during follow-up. Performances of 99mTc-WBC-SPECT/CT to predict DFO remission with conventional visual assessment were significantly lower for junior than for senior nuclear physician with moderate inter-rater agreement (Kappa: 0.417). Performances with the use of CSI were similar between the two readers with good inter-rater agreement (Kappa: 0.756). The study found that conventional visual assessment of 99mTc-WBC-SPECT/CT to assess DFO remission requires experience, and supported that CSI could be useful for junior nuclear physician to discriminate residual infections and inflammatory post-treatment uptake.

Monitoring Persister Resuscitation with Flow Cytometry.

Persister cells are defined as a small fraction of phenotypic variants in a cell population that are temporarily tolerant to bactericidal antibiotics. Persisters are not mutant cells; they generally survive lethal concentrations of antibiotics due to their transient nongrowing state. Persister cells have the ability to resuscitate after the end of antibiotic treatment. Despite significant advancements in the understanding of the molecular mechanisms underlying persister formation, we still have little information about their resuscitation mechanisms. In this chapter, we describe a method to detect and monitor persister resuscitation at the single-cell level using flow cytometry analysis. This method enables us to not only assess the resuscitation characteristics of persisters but also determine and quantify various subpopulations in antibiotic-treated cultures, including viable but nonculturable (VBNC) and dead cells.

Oral switch versus standard intravenous antibiotic therapy in left-sided endocarditis due to susceptible staphylococci, streptococci or enterococci (RODEO): a protocol for two open-label randomised controlled trials

IntroductionLeft-sided infective endocarditis (IE) is a serious infection with a heavy burden for patients and healthcare system. Oral switch after initial intravenous antibiotic therapy may reduce costs and improve patients’...

Prognostic value of residual vegetation after antibiotic treatment for infective endocarditis: A retrospective cohort study

BackgroundThe prognostic impact of residual vegetation (RV) after medical treatment for endocarditis remains unknown. Methods134 consecutive patients hospitalized for infective endocarditis, not surgically treated, with the presence of vegetation at diagnosis, were included retrospectively. The follow-up started at the end of antibiotic treatment when healing was complete. The presence or absence of RV was assessed at this time. The primary endpoint was a composite of the occurrence of embolic events, recurrence of endocarditis, or death from any cause. ResultsEighty-five patients were men (63%), mean age was 69 ± 15 years, and median follow-up was 16.3 (IQR: 5–30) months. Sixty-six patients (49%) had RV, 15 (11%) had RV > 10 mm and nine (7%) had RV with an increase in size relative to that of the diagnosis. The primary endpoint occurred in 23 patients (35%) in the group with RV, and in 16 patients (24%) without RV, which was not statistically relevant (HR 1.70; 95% confidence interval (CI) 0.89–3.22; p = 0.10). Based on univariate Cox regression analysis, the occurrence of the primary endpoint was associated with RV that increased (HR 3.90 95% CI 1.61–9.43; p < 0.01), RV size (HR 1.05; 95% CI 1.01–1.09; p < 0.01) or RV > 10 mm (HR 3.35; 95% CI 1.51–7.39; p < 0.01). Only RV > 10 mm remained significant in multivariate Cox regression: HR3.29; 95% CI 1.20–8.96; p = 0.02. ConclusionsRV is frequent but has no clear prognostic impact in itself; however, its size, particularly in comparison with the start-of-treatment data, merits particular attention as being potentially associated with increased risk.

Prognostic value of residual vegetation after antibiotic treatment for infective endocarditis: A retrospective cohort study

Infective endocarditis is associated with significant morbidity and mortality. Natural history of vegetations under antibiotic treatment is poorly understood, and the long-term prognostic impact of residual vegetations after complete treatment remains unknown. To evaluate prognostic impact of residual vegetation after complete and successful antibiotic treatment. In a retrospective cohort study, we included 134 patients hospitalized for infective endocarditis in a tertiary center, with presence of vegetation at diagnosis, treated with complete antibiotic therapy, from January 2013 to December 2017. The follow-up started at the end of antibiotic treatment, when healing was complete. Presence or absence of residual vegetation was assessed at this time. The primary endpoint was a composite of the occurrence of embolic event, recurrence of endocarditis or death from any cause. Eighty-five patients were men (63%), mean age was 69 ± 15-years-old and median follow-up was 16.3 (IQR: 5 to 30) months. Sixty-six (49%) patients have residual vegetations at the end of treatment. The primary endpoint occurred in 23 patients (35%) in the group with residual vegetation and in 16 patients (24%) without, which was not statistically relevant (OR 1.74; 95% confidence interval 0,82–3,67; P = 0.15). By univariate analysis, the occurrence of the primary endpoint was associated with an increasing size of vegetation under treatment (OR 5.94;95% CI 1.52–23.15; P = 0.01), or a size of vegetation over 10 mm at the end of treatment (OR 3.47;95% CI 1,19–10,08; P = 0.02); however, it was not corroborated by multivariate analysis. There was a trend of the antiplatelet therapy to be protective of the occurrence of the primary endpoint (0R = 0.30; 95% CI 0.09–0.99; P = 0.04) ( Table 1 , Fig. 1 ). Persistence of vegetation after healing is frequent but has no clear prognostic impact in patients treated for infective endocarditis.

212. Outcomes of Adults with Uncomplicated Staphylococcus aureus Bacteremia Receiving Short-Course Vs. Prolonged-Course Antibiotic Therapy in a Multicenter, Propensity Score–Matched Cohort

BackgroundThe recommended duration of antibiotic treatment for uncomplicated Staphylococcus aureus bloodstream infections is 14 days. We compared the outcomes of patients receiving short-course (6–10 days) vs. prolonged-course (11–16 days) antibiotic therapy for S. aureus bacteremia (SAB).Methods30-day outcome of patients with penicillin (PSSAB, n = 202)) or methicillin-susceptible SAB (MSSAB, n = 203) treated with in vitro active therapy in the range of 6–16 days was analyzed using pooled data from two previously published, observational studies. Individuals were matched 1:1 by nearest neighbor propensity score matching without replacement. Regression analysis was performed to estimate the risk of all-cause mortality within 30 days after the end of antibiotic treatment. Eligible individuals had to have >1 day of follow-up after discontinuation of antimicrobials. Individuals with a diagnosis of endocarditis, bone infection, meningitis or pneumonia were excluded.ResultsThere were 107 well-balanced matched pairs; 58 in the PSSAB and 39 in the MSSAB cohort. For PSSAB, the median duration of therapy was 8 (interquartile range [IQR], 7–10) in the short-course group and 12 days (IQR, 10–13) in the prolonged-course group. For the MSSAB cohort, these numbers were 9 days (IQR, 7–10) and 14 days (IQR, 13–16 days), respectively. No difference in mortality between short-course and prolonged-course treatment was observed (adjusted hazard ratio [aHR], 0.74; 95% confidence interval [CI], .23–2.41) and 1.14; 95% CI, 0.31–4.20), respectively for PSSAB and MSSAB.ConclusionShort courses of antibiotic therapy yielded similar clinical outcomes as prolonged courses of antibiotic therapy for S. aureus bacteremia. The findings warrant a randomized clinical trial to study the safety and efficacy of shortened antimicrobial therapy for the treatment of uncomplicated SAB. Disclosures All authors: No reported disclosures.

Penicillin V four times daily for five days versus three times daily for 10 days in patients with pharyngotonsillitis caused by group A streptococci: randomised controlled, open label, non-inferiority study

ObjectiveTo determine whether total exposure to penicillin V can be reduced while maintaining adequate clinical efficacy when treating pharyngotonsillitis caused by group A streptococci.DesignOpen label, randomised controlled non-inferiority study.Setting17 primary...

Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome

PurposePro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure.MethodsThe synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts.ResultsAntibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery.ConclusionsThere are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.

Is 99mTc-HMPAO-leukocyte imaging an accurate method in evaluating therapy result in prosthetic joint infection and diagnosing suspected chronic prosthetic joint infection?

To investigate the sensitivity and specificity of 99mTc-HMPAO-leukocyte imaging in evaluating therapy result in patients with prosthetic joint infection (PJI) and in diagnosing suspected chronic PJI. Sixty-two patients (63 joints) with microbiologically verified PJI were examined by leukocyte imaging to evaluate therapy result during or at the end of antibiotic treatment or if the patient had a chronic PJI after treatment. Group 1 consisted of 49 patients with on-going or within less than 14 days of ending antibiotic treatment examined to evaluate response. Group 2 consisted of 13 patients examined after completed treatment on suspicion of chronic PJI with no or recently initiated renewed antibiotic treatment. This study applied a combination of different imaging approaches of 99mTc-HMPAO-leukocyte scintigraphy: delayed and late planar images, bone marrow imaging and SPECT/CT imaging. All joints were examined with at least two of the approaches and 53 joints with all three approaches. The report was based on the combined results of the approaches used. A chronic PJI was confirmed with a positive microbiological culture. A cured infection was confirmed with either a negative culture or at least 24 months antibiotic-free follow-up with no relapse. In the therapy evaluation group sensitivity was 0.57 and specificity was 0.81. In the suspected chronic infection group sensitivity was 1.00 and specificity 0.91. 99mTc-HMPAO-leukocyte imaging appears to be an accurate method to diagnose or exclude chronic PJI, but cannot be recommended for therapy evaluation of PJI in patients with on-going antibiotic treatment.

Four versus six weeks of antibiotic therapy for osteoarticular infections after implant removal: a randomized trial.

The optimal duration of antibiotic therapy for treating orthopaedic implant infections after surgical drainage and complete implant removal is unknown. This was a single-centre, unblinded, prospective trial randomizing (1:1) eligible patients to either 4 or 6 weeks of systemic, pathogen-targeted antibiotic therapy. Clinical trial registration number: ClinicalTrials.gov (NCT0362209). We analysed 123 eligible patients (62 in the 4 week antibiotic arm and 61 in the 6 week arm) in the ITT analysis. The patients' median age was 64 years, 75 (61%) were men and 38 (31%) were immunocompromised. The most common types of infection treated included: two-stage exchange procedure for prosthetic joint infection (n = 38); orthopaedic plate infection (44) and infected nail implants (11). The median duration of post-explant intravenous antibiotic therapy was 4 days. Overall, 120 episodes (98%) were cured microbiologically and 116 (94%) clinically after a median follow-up period of 2.2 years. During follow-up, four patients had a clinical recurrence with a pathogen other than the initial causative agent. We noted recurrence of clinical infection in four patients in the 4 week arm and three patients in the 6 week arm (4/62 versus 3/61; χ2 test; P = 0.74); in all cases, this occurred at around 2 months following the end of antibiotic treatment. We found no statistically significant difference in the rates of clinical or microbiological remission between patients randomized to only 4 compared with 6 weeks of systemic antibiotic therapy after removal of an infected osteoarticular implant.

Application of white blood cell SPECT/CT to predict remission after a 6 or 12week course of antibiotic treatment for diabetic foot osteomyelitis.

Diabetic foot osteomyelitis is a major risk factor for amputation. Medical treatment allows remission in 53-82% of cases. However, the optimal duration of antibiotic therapy remains controversial as a validated marker of osteomyelitis remission is lacking. The aim of this cohort study was to assess prospectively the remission rate of diabetic foot osteomyelitis medically treated using white blood cell (WBC)-single-photon emission computed tomography (SPECT)/computed tomography (CT) as a predictive marker of remission. Individuals with diabetic foot osteomyelitis that was non-surgically treated between April 2014 and December 2015 were included. All participants were treated with antibiotics alone. WBC-SPECT/CT was performed at 6weeks and antibiotic treatment discontinued if the clinical signs of soft-tissue infection had resolved and there was no abnormal uptake of labelled WBCs. Treatment was otherwise continued for a total of 12weeks and then discontinued. For these individuals, another WBC-SPECT/CT was performed at 12weeks. Remission was defined as the absence of recurrence of osteomyelitis at the same location at 1year. Forty-five individuals were included; overall remission rate was 84% at 1year. A 6week course of antibiotics was used in 23 participants, 22 of whom were in remission at 1year (96%); a 12week course was used for 22 participants, 16 of whom were in remission at 1year (73%). Sensitivity of WBC-SPECT/CT at 12weeks was 100%, specificity 56%, positive predictive value 46% and negative predictive value 100%. The study suggests that WBC-SPECT/CT could predict remission at the end of antibiotic treatment. ClinicalTrials.gov NCT02927678.