Gel Electrophoresis Research Articles

Cryoprotectant-specific alterations in the proteome of Siberian sturgeon spermatozoa induced by cryopreservation

Cryopreservation is crucial for conserving genetic diversity in endangered species including the critically endangered group of sturgeons (Acipenseridae), but it can compromise sperm quality and protein profiles. Although cryopreservation with dimethyl sulfoxide (DMSO) and methanol (MeOH) results in the recovery of good post-thaw motility, DMSO-preserved sperm show reduced fertilization ability. This study was conducted in Siberian sturgeon as a model for Acipenserid fishes to explore the effects of DMSO and MeOH on the proteome of semen using advanced proteomics methods—liquid chromatography‒mass spectrometry and two-dimensional difference gel electrophoresis. We analyzed the proteomic profiles of fresh and cryopreserved spermatozoa and their extracellular medium and showed that cryopreservation decreases motility and viability and increases reactive oxygen species levels, membrane fluidity, and acrosome damage. Despite having similar post-thaw semen motility, sperm treated with DMSO had significantly lower fertilization success (6.2%) than those treated with MeOH (51.2%). A total of 224 and 118 differentially abundant proteins were identified in spermatozoa preserved with MeOH and DMSO, respectively. MeOH-related proteins were linked to chromosomal structure and mitochondrial functionality, while DMSO-related proteins impacted fertilization by altering the acrosome reaction and binding of sperm to the zona pellucida and nuclear organization. Additionally, cryopreservation led to alterations in the proacrosin/acrosin system in both cryoprotectants. This study provides the first comprehensive proteomic characterization of Siberian sturgeon sperm after cryopreservation, offering insights into how cryoprotectants impact fertilization ability.

Enhancing Salivary DNA Preservation via DNase I Inactivation: Role of Temperature and EDTA

Background Deoxyribonuclease I (DNase I) catalyzes the cleavage of double-stranded DNA into its end products. This enzyme requires cations for its activity. In addition, DNase activity is influenced by indirect DNase inhibitors (i.e. EDTA) and temperature. EDTA is an indirect DNase I inhibitor. Therefore, DNase inactivation is crucial for DNA preservation, especially for salivary samples, and the downstream application of genetic techniques using non-blood samples. Saliva is a complex mixture contaminated with oral microbes and contains DNase which is harmful for DNA preservation. This study aims to preserve salivary DNA through temperature and EDTA treatment. Methods This is an experimental study. Salivary DNA was extracted using the spin-column method. DNA degradation assays were carried out using either 5 µL of salivary supernatant or 2.5 mg/mL of DNase I which were incubated at -20°C, 2-8°C, room temperature, 40°C, and 50°C; and added with 0.125 mM, 0.25 mM, 0.5 mM, 1 mM, and 2 mM EDTA for 60 minutes. After incubation, the results were visualized using agarose gel electrophoresis. Results The average concentration of salivary DNA was 61.70 µg/mL (30.50-109.05) and the purity was 1.893 µg/mL (1.800-2.005). Incubation at -20°C, 2-8°C, and room temperature degraded salivary DNA but incubation at 40 and 50°C did not completely degrade DNA. Addition 0.125 mM, 0.25 mM, 0.5 mM, 1 mM, and 2 mM EDTA to 5 µL of salivary supernatant or 2.5 mg/mL DNase I preserved salivary DNA. Conclusions Temperature of 40 and 50°C, and 0.125 mM EDTA can inactivate DNase and preserve salivary DNA.

Identification and biological control of bacterial leaf spot disease of cucurbits

Objective: The present study was conducted for isolation and detection of the phyto-pathogen responsible for bacterial leaf spot disease of cucurbits as well as evaluation of its biological control techniques. Methods: The pathogen of the disease was isolated from infected leaf of bitter gourd and cultured on Luria-Bertani (LB) growth medium. The morphological tests and biochemical tests revealed the isolated bacteria as gram negative. Furthermore, advanced molecular technique was applied to facilitate proper detection of the isolated bacteria. The PCR of the bacterial genomic DNA using specific primers generated clear band of approximately 1450 bp in gel electrophoresis. Results: In gram staining test, the bacterial strain was found to be rod shaped and pinkish in color and Gram-negative. All the biochemical test showed positive without mannitol salt agar. The nucleotide sequencing of 16S rDNA gene of the bacterial isolate showed 86.02% similarities with the original sequence of Xanthomonas cucurbitae. In antibiotic sensitivity assay, the antibiotic cefixime showed highest 28.0±0.7 mm diameter of inhibition zone against the tested bacteria. The highest antibacterial activity was 8.0±0.5 mm zone of inhibition by of Allium sativum. Conclusion: The present findings may be benevolent for the detection, characterization and development of biological control techniques to prevent the leaf spot disease of cucurbits crops in Bangladesh. It may help to find out the specific signaling pathway techniques for plant microbes relationship for disease formation in future.

Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.

CircRHBDD1 promotes immune escape via IGF2BP2/PD-L1 signaling and acts as a nanotherapeutic target in gastric cancer

BackgroundCircular RNAs (circRNAs) have been implicated in the development and progression of gastric cancer (GC). However, it remains unclear whether dysregulated circRNA affects immune escape and the efficacy of immunotherapy in GC. Our aim is to investigate the molecular mechanism of circRNA affecting GC immunotherapy and identify effective molecular therapeutic targets.MethodsThe differential expression profile of circRNAs was established through circRNA sequencing, comparing three paired GC tissues with their adjacent non-cancerous gastric tissues. The expression level of circRHBDD1 in GC tissues was then assessed using quantitative reverse transcription polymerase chain reaction (qRT-PCR). The biological characteristics of circRHBDD1 were verified through a series of experiments, including agarose gel electrophoresis assays, RNase R treatment, and actinomycin D experiments. The prognostic value of circRHBDD1 in GC was evaluated by conducting both univariate and multivariate survival analyses. Furthermore, loss- and gain-of-function approaches were utilized to investigate the impact of circRHBDD1 on GC immune escape. RNA-sequencing, immunoprecipitation, flow cytometry, and methylated RNA immunoprecipitation (meRIP) analysis were performed to elucidate the underlying molecular mechanisms.ResultsWe discovered that circRHBDD1 exhibited remarkably high expression levels in GC tissues and cell lines. Notably, the high expression of circRHBDD1 was significantly correlated with poor overall survival and disease-free survival among GC patients. Both in vitro and in vivo experiments revealed that circRHBDD1 upregulated the expression of PD-L1 and impeded the infiltration of CD8+ T cells. Further, we found that circRHBDD1 binds to IGF2BP2, disrupting the interaction between E3 ligase TRIM25 and IGF2BP2, and ultimately inhibiting IGF2BP2 ubiquitination and degradation. Intriguingly, IGF2BP2 enhances PD-L1 mRNA stability through m6A modification. Additionally, we developed Poly (lactide-co-glycolic acid) (PLGA)-Polyethylene glycol (PEG)-based nanoparticles loaded with circRHBDD1 siRNA. In vivo experiments validated that the combination of PLGA-PEG(si-circRHBDD1) and anti-PD-1 offers a safe and efficacious nano-drug regimen for cancer immunotherapy.ConclusionOur results demonstrated that circRHBDD1 promoted GC immune escape by upregulating the expression of PD-L1 and reprogramming T cell-mediated immune response. Inhibition of circRHBDD1 expression could potentially enhance the response of GC patients to immunotherapy, thus improving treatment outcomes. Additionally, the development of a nanodrug delivery system provides a feasible approach for future clinical applications.

Determining the Genetic Markers of Schizophrenia using Molecular Diagnosis

Schizophrenia poses a considerable disease burden, notwithstanding its relatively low incidence rate. The escalation in population size and mean age has led to a substantial rise in the incidence of illness linked to schizophrenia, particularly in countries with moderate levels of prosperity. Therefore, it is necessary to find a way to detect and recognize the illness as fast as possible to stop the consequences from occurring and stop symptoms from appearing before they even start. Within this study’s scope, fifteen distinct primers were selected randomly to determine whether or not they could recognize schizophrenia. To accomplish this, a Randomly Amplified Polymorphic DNA-polymerase chain reaction (RAPD-PCR) was conducted utilizing DNA samples obtained from individuals afflicted with the condition and those in good health. The outcomes of the gel electrophoresis and subsequent analysis revealed that solely three primers including C12, E02 and E03 exhibited monomorphic characteristics. However, it was observed that 80% of the primers, precisely eleven out of fifteen, exhibited polymorphism. The results indicated that among the 15 primers tested, the primer labeled as H01 failed to generate any detectable bands. Subsequent examination of the polymorphic primers revealed that the primer efficiency varied between 0 and 0.0755, while the discrimination power ranged from 0 to 20 percent. The study observed variations in the frequency of disease occurrence between patients and healthy individuals. H05 primer utilization yielded three distinct polymorphic bands exhibiting diverse lengths. The band exhibiting the greatest length measured 1190 bp, whereas the other two bands had 480 and 430 bp lengths respectively. The two polymorphic bands exhibited 100% prevalence in the patient population while being completely absent in the healthy control group. Based on the available data, it appears that utilizing this primer to identify schizophrenia is a valid and valuable claim. Overall, DNA-based diagnostics may overlook a number of difficulties as laboratories have the ability to extract DNA from various sources easily. In this scenario, molecular and genetic techniques may be crucial for diagnosing some diseases.

Separation methods for food protein purification and analysis

The extraction, separation, and purification of dietary proteins from a variety of food sources are crucial for their targeted use in food applications. To achieve this, proteins should be effectively separated from non-protein components such as cell wall structures, polysaccharides, and lipids. Traditional protein purification methods can be time-consuming, highlighting the need for automated, cost-effective, and sustainable alternatives. This comprehensive review critically assesses various protein purification instruments from an analytical perspective, weighing their advantages and disadvantages. The methods under evaluation include ultrafiltration, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), fast protein liquid chromatography (FPLC), high-performance liquid chromatography (HPLC), ultra performance liquid chromatography (UPLC), and microfluidic chips. Among these, FPLC stands out as an affordable and efficient technique that allows for high protein recovery. However, HPLC and UPLC provide faster results but may denature proteins, leading to lower recovery rates. Ultrafiltration is a cost-effective and straightforward method that doesn’t require complex equipment. Microchip-based approaches are emerging as innovative techniques for rapidly analyzing small samples. While SDS-PAGE is user-friendly, it denatures proteins, particularly those linked to other biomolecules. The choice of the most appropriate instrument depends on factors such as cost, energy efficiency, processing time, the characteristics of the target protein, desired outcomes, protein recovery, and resource availability. By critically examining these analytical instruments for protein purification, this review aims to assist researchers and practitioners in selecting the most suitable method for their specific needs, ultimately promoting efficient and successful protein purification endeavors in the field of food science and technology.

Rapid and reliable detection of Leishmania antibodies in canine serum with double-antigen sandwich homogeneous chemical luminescence

BackgroundLeishmaniasis, caused by Leishmania spp. parasites, is an important zoonotic disease globally, posing severe threats to humans and animals. In the absence of effective vaccines, reliable serological diagnostic methods are critical for disease control. However, the enzyme-linked immunosorbent assay (ELISA) and immunochromatographic assay have limitations due to complexity, time required and/or sensitivity. Therefore, our objective was to develop an accurate, rapid and user-friendly detection method of canine leishmania antibody based on double-antigen sandwich homogeneous chemical luminescence.MethodsHomogeneous chemiluminescent technology was employed, and expressed recombinant fusion proteins containing full-length K9, K39 and K26 repeat sequences were used as diagnostic antigens. To establish a dual-antigen sandwich serological assay capable of detecting various antibody types, a factorial design was used to optimize concentrations of diagnostic antigen-receptor microspheres and of biotinylated diagnostic antigens, as well as of reaction solution composition and reaction duration. To evaluate and validate this newly developed method, we collected 41 Leishmania-positive serum samples, 30 Leishmania-negative control serum samples and 78 clinical serum samples for which no diagnostic information was available. Comparative analyses were performed using parasitological testing and an indirect ELISA as reference methods, focusing on diagnostic sensitivity and specificity.ResultsSodium dodecyl sulfate–polyacrylamide gel electrophoresis confirmed the purification of the diagnostic antigens, which exhibited clear bands without impurities. Based on results from the 41 Leishmania-positive samples and 30 Leishmania-negative samples, there was sufficient sensitivity to detect samples diluted up to 256-fold, with analytical specificity of 100%. Overall diagnostic sensitivity was 100% and diagnostic specificity was 93.3%. Diagnostic performance was highly consistent between the newly developed method and the indirect ELISA (Kappa = 0.82, P < 0.01). Testing could be completed within 35 min with the new methodConclusionsWe have developed a novel double-antigen sandwich homogeneous chemical luminescence method to detect canine Leishmania antibodies, with high sensitively and specificity, a short incubation interval and a simple protocol. This streamlined approach not only offers a sensitive and efficient method for clinical diagnosis but also has great potential for use in automated testing.Graphical

A comparison of the chemical compositions and nutrient values of the sanim and srithong varieties of the farmed golden apple snails (Gastropoda; Ampullariidae; Pomacea canaliculata)

The comparison of the Sanim (SN) and Srithong (ST) varieties of the farmed apple snail Pomacea canaliculata as an alternative protein source has shown that ST contained more hydroxyproline and possessed a greater firmness than SN. Nevertheless, both varieties yielded similar protein contents of 20.90–23.07 % and exhibited similar texture, color, cooking yields and cooking losses after cooking. Good palatability with high liking score was obtained from both snail meat samples, particularly color, texture, and overall attributes. Snail meats possessed good nutritive value with an amount of protein and low fat content, whereas SN contained higher protein and total energy(P < 0.05). Other nutritionally useful chemicals (such as calcium, sodium, iron, vitamins B1 and B2) are present. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) results discovered that myosin heavy chain, paramyosin, and actin were the prevalent protein components. Differences in nitrogen content distribution were observed between SN and ST, in which alkaline-soluble protein was the major fraction. Amino acid composition and fatty acid content varied regarding snail varieties with a large amount of essential amino acids and good source of MUFA and PUFA. Therefore, both farmed SN and ST snails could be an effective alternative protein source with a significant amount of nutritive value.

Design, synthesis, structural inspection, and DFT calculation of some novel imine ciprofloxacin metal chelates: A novel approach for pharmaceutical applications and DNA interaction

Novel compounds with pharmacological activity were synthesized from Pd (II), Fe (III), Cr (III), Ni (II), and Cu (II) ions with 4‐{2‐(3‐carboxy‐1‐cyclopropyl‐6‐fluoro‐7‐piperazin‐1‐yl‐2,3‐dihydro‐1H‐quinolin‐4‐ylideneamino)‐phenylimino}‐1‐cyclopropyl‐6‐fluoro‐7‐piperazin‐1‐yl‐1,4‐dihydro‐quinoline‐3‐carboxylic acid (CFPD). The newly synthesized compounds have been investigated by 1H‐ and 13C‐NMR spectra, Fourier transform infrared spectra, CHN analyses, ultraviolet‐visible spectra, mass spectra, molar conductivity, and magnetic moment measurements. In addition, the pH profile of the CFPD complexes showed remarkable stability, and their stability constant was identified in solution. To find out essential characteristics for CFPD and its complexes and to investigate the molecular geometry, computational analysis occurred. Through its nitrogen and OH of carboxylate groups, the ligand interacted with the metal ions to form CFPDPd complex with a square planar geometry and CFPDCu, CFPDCr, CFPDNi, and CFPDFe complexes with octahedral geometry. The M:L ratio of 1:1 was demonstrated by the molar ratio and sequence variation techniques’ outcomes. The effect of the investigated CFPD imine ligand on bacterial community and its metal chelate was examined within vitro using a range of fungal and viral pathogens The findings showed that the effectiveness of antimicrobial went with the directive: CFPDPd complex when compared to the highly suppressor complex, fluconazol and ofloxacin as model medication. The novel ligand’s and its complexes’ in vitro cytotoxic potential against the Hep‐G2, MCF‐7, and HCT‐116 cell lines was also studied. The findings once more indicated that, when compared to vinblastine medication, the CFPDPd chelate is the most active agent. In addition, the complexes showed high reactivity in catching free radicals when their antioxidant activity was examined. By the application of viscosity, spectrum analysis, and gel electrophoreses, the interaction among metal chelates and DNA was determined. Studies on viscosity and spectrophotometric titration showed that every substance in test is a strong DNA binder. Increased hydrophobic and electrostatic interactions between aromatic rings could be the cause of this. In conclusion, these complexes have the potential to be effective bioactive agents.

Fruiting Characteristics and Molecular-Assisted Identification of Korla Fragrant Pear Bud Mutation Materials

Korla fragrant pear is a high-quality local pear variety native to Xinjiang, China. Currently, the low fruit-setting rate and low calyx shedding rate problems in Korla fragrant pears have been highlighted, which seriously affect the fruit yield and quality. It is of great significance to research the fruiting characteristics and molecular-assisted identification of Korla fragrant pear bud mutation materials for enriching the germplasm resources of Korla fragrant pear. In this research, a natural pollination group (YB) of Korla fragrant pear bud mutation materials and a natural pollination group (CK) of Korla fragrant pears were established. On the fruiting characteristics, the fruit-setting rate and calyx-removal rate of the two groups were investigated. In terms of fruit quality, the fruit shape index, fruit specific gravity, soluble solids content, sugar:acid ratio, soluble sugar content, and other indicators were measured. For the anatomical structure of the calyx tube, the detachment cells were observed. The formation time of the two groups of detached cells was compared. In the GBS simplified genome sequencing, a phylogenetic tree was constructed based on the obtained SNP sites. A principal component analysis, population genetic structure analysis, and genetic diversity index analysis were carried out. In the aspect of SSR molecular marker identification, the SSR types were counted. Polyacrylamide gel electrophoresis was performed. The results demonstrate the following: (1) the fruit-setting rate (30.87%) and calyx-removal rate (68.11%) in the YB group were significantly higher than those in the CK group (19.37%) and the calyx-removal rate (55.18%). (2) There was no significant difference in fruit quality indexes, such as average fruit weight (127.10–130.00 g) and soluble sugar content (9.47–9.56%) between the two groups. (3) Abscission-layer cells were observed at 2, 4, 6, 8, and 10 h after calyx tube discoloration in the YB group and at 48, 72, and 96 h after calyx tube discoloration in the CK group. (4) The genetic background of the YB group and the CK group was similar at the GBS level, but there were differences at the DNA level. This research finally shows that Korla fragrant pear bud mutation material is a good germplasm resource. This germplasm resource can promote the structural optimization of Korla fragrant pear varieties and the healthy development of the industry.

DETERMINATION OF THE CIRCADIAN OSCILLATION PATTERN OF UNFOLDED PROTEIN RESPONSE SIGNALING COMPONENTS IN HUMAN EMBRYONIC KIDNEY HEK293 CELLS

Objective: The circadian rhythm is one of the primary regulatory systems with near 24-hour oscillations. It has a crucial role in regulating physiological conditions in the human body, including body temperature and the secretion of hormones. Numerous disorders, such as cancer and diabetes, have been linked to disruptions of the cellular circadian rhythm. Herein, we aimed to investigate the relationship between the circadian rhythm and unfolded protein response (UPR) signaling, which is one of the important physiological mechanisms in mammalian cells and has recently been associated with drug resistance, invasion and metastasis in cancer. Material and Method: Human embryonic kidney cell line HEK293 was provided from the American Type Culture Collection and propagated in DMEM containing 10% FBS and growth ingredients. For in vitro circadian synchronization, cells were exposed to 50% and then the oscillation pattern of gene and protein expression of UPR-related target genes was analyzed by agarose gel electrophoresis and immunoblotting, respectively. The oscillation pattern was commented on through curve-fitting analysis. Result and Discussion: Our findings demonstrated that UPR components, including IRE1α, XBP-1s, eIF2α, phospho(Ser51)-eIF2α, PERK, ATF4, GADD34 and ATF6, tightly exhibit oscillation patterns under a circadian rhythm on a 48-hour time scale like the PER1 gene that is a core component of the circadian rhythm. Moreover, endoplasmic reticulum (ER) stress genes, BiP/GRP78 and CHOP, were similar to UPR components under the circadian rhythm. Additionally, we found the activation of UPR signaling harmoniously modulated with the circadian rhythm. Present data indicated that the expression level of UPR components exhibited strict oscillation under the circadian rhythm. Our findings may guide experimental studies of new-generation UPR-targeted drugs to be developed to treat various pathologies in accordance with the circadian rhythm.

Investigating the pro-inflammatory differentiation of macrophages with bacterial ghosts in potential infection control.

In the complex realm of bacterial infections, particularly those caused by Staphylococcus aureus (S. aureus), macrophages play a pivotal role in orchestrating the immune response. During the initial stages of infection, the monocytes give rise to macrophages with a pro-inflammatory (M1 type) behaviour, engulfing and neutralizing the invading pathogens. However, under the sustained influence of S. aureus infection, monocytes can undergo a transition into an anti-inflammatory M2 state (pro-infection) rather than the M1 state (anti-infection), thereby compromising effective infection control. Therefore, it is necessary to develop a strategy that would preserve the pro-inflammatory functions of macrophages, in a safe and controlled manner. For this, we focused on harnessing the potential of S. aureus-derived ghost cells (GCs) which are non-live empty envelopes of bacterial cells, but with the antigenic determinants intact. Through a unique Lugol's-iodine treatment, we generated GCs and characterization of these GCs using gel electrophoresis, FTIR, flow cytometry, TEM, and SEM confirmed their structural integrity. Following this, we assessed the extend of cellular association of the GCs with RAW267.4 macrophages, and observed an immediate interaction between the two, as evident from the flowcytometry and microscopy studies. We then performed macrophage polarisation on a human monocyte-macrophage model cell line, THP-1. Our findings revealed that GCs effectively activated macrophages, and promoted a pro-inflammatory polarisation with the expression of M1 differentiation markers (CD86, TNFα, IL-1β, IL-6, IL-12) evaluated through both qPCR and ELISA. Interestingly an intermediary expression of M2 markers viz., CD206 and IL-10 was also observed, but was overruled by the enhanced expression of M1 markers at a later time point. Overall, our study introduces a novel approach utilizing GCs to guide naïve macrophages towards M1 subtypes, thereby potentiating immune responses during microbial infections. This innovative strategy can modulate macrophage function, ultimately improving outcomes in S. aureus infections and beyond.

Synthesis and characterisation of dipyrromethene Cu(II) complexes: A preliminary DNA intercalation study

Copper complexes of the bilirubin bile pigment have been shown to affect DNA. It was suggested that the copper ions within these metal-bilirubin therapeutics bind to bilirubin through the two dipyrromethene moieties, thus highlighting the potential therapeutic impact of these dipyrromethene moieties. Here, we report the synthesis and characterization of two bilirubin biomimetic copper complexes, CuL1 and CuL2, featuring tetrahedral dipyrromethene moieties. DNA binding studies reveal significant affinities for both complexes, with CuL1 displaying a log Ka of 4.70 ± 0.02, with a corresponding Gibbs free energy change (ΔG) of –26.8 kJ/mol at 25 °C, indicating a moderate-to-high DNA affinity. CuL2 showed a slightly higher affinity with log Ka of 4.88 ± 0.02, with a corresponding ΔG of –27.4 kJ/mol at 25 °C. These experimental findings aligned closely with computational docking G-scores, which yielded –32.9 kJ/mol for CuL1 and –34.8 kJ/mol for CuL2, respectively. Viscosity, gel electrophoresis, and absorption studies support an intercalative binding mechanism, which was further confirmed by computational docking and molecular dynamics simulations. These findings suggest that copper dipyrromethene complexes may exert therapeutic effects through DNA interaction, warranting further investigation involving in vitro cell cultures for drug development potential.

Co-existence of two plasmids harboring transferable resistance-nodulation-division pump gene cluster, tmexCD1-toprJ1, and colistin resistance gene mcr-8 in Klebsiella pneumoniae

BackgroundThe emergence of plasmid-mediated mobile colistin resistance (mcr) gene poses a great challenge to the clinical application of polymyxins. To date, mcr-1 to mcr-10 have been found in animals, humans, and the environment. Among them, mcr-8 was first identified in Klebsiella pneumoniae (K. pneumoniae) of swine origin, and then mcr-8.1 to mcr-8.5 were successively identified. Notably, K. pneumoniae is the major host of the mcr-8 gene in both animals and humans. This study aims to explore the characteristics of K. pneumoniae strains carrying the mcr-8 gene and tmexCD1-toprJ1 gene cluster and investigate the correlation between these two antibiotic resistance genes.MethodsThe isolates from the poultry farms and the surrounding villages were identified by mass spectrometer, and the strains positive for mcr-1 to mcr-10 were screened by polymerase chain reaction (PCR). The size of the plasmid and the antimicrobial resistance genes carried were confirmed by S1-nuclease pulsed-field gel electrophoresis (S1-PFGE) and Southern hybridization, and the transferability of the plasmid was verified by conjugation experiments. Antimicrobial susceptibility testing (AST) and whole genome sequencing (WGS) were used to characterize the strains.ResultsTwo K. pneumoniae isolates (KP26 and KP29) displaying polymyxin resistance were identified as mcr-8 gene carriers. Besides that, tigecycline-resistant gene cluster tmexCD1-toprJ1 was also found on the other plasmid which conferred strain resistance to tigecycline. Through epidemiological analysis, we found that the mcr-8 gene has dispersed globally, circulating in the human, animals, and the environment. Furthermore, our analysis suggests that the coexistence of mcr-8 and tmexCD1-toprJ1 on a single plasmid might evolved through plasmid recombination.ConclusionsAlthough the mcr-8 and tmexCD1-toprJ1 gene clusters in the two strains of K. pneumoniae in this study were on two different plasmids, they still pose a potential threat to public health, requiring close monitoring and further study.

Analytical and Functional Characterization of Plasmid DNA Topological Forms and Multimers.

Plasmid DNA (pDNA) is an essential tool in genetic engineering that has gained prevalence in cell and gene therapies. Plasmids exist as supercoiled (SC), open circular (OC), and linear forms. Plasmid multimerization can also occur during the manufacturing process. Even though the SC forms are thought to provide optimal knock-in (KI) efficiency, there is no strong consensus on the effect of the topological forms and multimers on the functional activity. In addition, the results obtained for conventional pDNAs (>5 kbp) do not necessarily translate to smaller pDNAs (∼3 kbp). In this study, a workflow was developed for the analytical and functional characterization of pDNA topological forms and multimers. An anion exchange chromatography (AEC) method was first developed to quantify the topological forms and multimers. Four AEC columns were initially compared, one of which was found to provide superior chromatographic performance. The effect of mobile phase pH, various salts, column temperature, and acetonitrile content on the separation performance was systematically studied. The method performance, including precision and accuracy, was evaluated. The final AEC method was compared to capillary gel electrophoresis (CGE) by analyzing several pDNA sequences and lots. A forced degradation study revealed unexpectedly high degradation of the SC forms. Finally, the KI efficiency was compared for the SC and OC forms, and the multimers.

Investigation of induced electroosmotic flow in small-scale capillary electrophoresis devices: Strategies for control and reversal.

Electroosmotic flow (EOF) is the bulk flow of solution in a capillary or microchannel induced by an applied electric potential. For capillary and microchip electrophoresis, the EOF enables analysis of both cations and anions in one separation and can be varied to modify separation speed and resolution. The EOF arises from an electrical double layer at the capillary wall and is normally controlled through the pH and ionic strength of the background buffer or with the use of additives. Understanding and controlling the electrical double layer is therefore critical for maintaining acceptable repeatability during method development. Surprisingly, in fused silica capillaries at low pH, studies observe an EOF even though the capillary surface should be neutralized. Previous work has suggested the presence of an "induced electroosmotic flow" from radial electric fields generated across the capillary wall due to the separation voltage and grounded components external to the capillary. Using thin-wall (15µm) fused silica separation capillaries to facilitate the study of radial fields, we show that the EOF mobility depends on both the separation voltage and the location of external grounds. This is consistent with the induced EOF model, in which radial electric fields embed positive charges at the capillary walls to create an electrical double layer. The magnitude of the effect is characterized and shown to have long-range influences that are difficult to completely null by moving grounded components away from the separation capillary. Instead, active EOF control using externally applied potentials or a passive approach using a negative separation voltage are discussed as two possible methods for controlling the induced EOF. Both methods can reverse the EOF and improve the resolution and peak efficiency in amino acid separations.

Exploring Gene Polymorphisms Associated with Otitis Media through Variable Number Tandem Repeats (VNTR) Region

Background: Otitis is an inflammation and infection of the inner lining of the middle ear. The problem known as suppurative otitis media if there are droplets and holes in the tympanic membrane due to this inflammation and infection of the mucous membrane. The present study focused on specific genes suspected to be associated with otitis media in 60 subjects clinically diagnosed with OM The study focuses on two genes, MUC5B and IL-1RN, whose genes mutations by variable number of tandem repeat (VNTR) regionsMethods: Variable numbers of tandem repeats (VNTR) regions were used to genotype 60 patients with otitis media and 30 healthy individuals for genotypic polymorphisms for the MUC5B and IL-1RN genes by number of tandem repeats (VNTR) regions on a variable basis Blood samples were collected from participants, and three milliliters were placed directly into EDTA tubes. Subsequently, PCR products were detected by agarose gel electrophoresis and visualized by ethidium bromide staining. The size of amplified DNA fragments was determined by comparison with a 100-bp DNA ladder molecule size markerResults: About the same, the paper represents the association of gene polymorphisms with otitis media by genotyping a total of 60 patients as OM, and, on the other hand, 30 individuals were noted to be healthy. This was to determine genotypic polymorphisms for the two genes, that is, MUC5B and IL1RN, within the VNTR region. The results showed that the carriers of allele 2 in the genotypic position had a risk of nearly twofold getting otitis media.Conclusion: Polymorphism of the MUC5B and IL-1RN genes can be responsible for the severity of the inflammatory process in the middle ear, complicated by otitis media or hearing loss.Keywords: Otitis media; Gene polymorphism; MUC5B; IL-1RN; VNTR

Genomic identification of expressed globulin storage proteins in oat.

Oats, a highly nutritious cereal known for their health benefits, contain various macromolecules of significant biological value, including abundant and highly digestible proteins. Despite their importance, oat proteins have not been extensively studied. Here, we present a complete set of the expressed globulins genes, which code for the main storage protein in oats as well as their chromosomal positions. Published expressed sequence tags for globulins were used as queries in the Sang oat genome. In addition, globulin proteins were fractionated from oat flour by solvent extraction based on differential solubility with other classes of cereal proteins. The protein fractions were separated by gel electrophoresis and analyzed by tandem mass spectrometry to confirm their identity and expression in seed. In total 32 globulin gene sequences were identified on the oat genome. Out of these, the expression on RNA level could be confirmed and 27 were also detected as expressed proteins by MS. Our results provide the most extensive set of salt-soluble oat globulin sequences to date, paving the way for further understanding their implications for human nutrition. In addition, a simple methodology to fractionate oat proteins is presented.

Extraction and characterization of collagen from the skin of Pterygoplichthys spp. (armored catfish) from Chiapas

Because of its biocompatibility and safety, collagen is a valuable biomaterial that is used in various industries. While traditionally sourced from terrestrial mammals, collagen extracted from fish waste is a promising alternative due to its chemical properties and low cost. In Mexico, Pterygoplichthys spp. is considered an invasive species, inedible, and of limited commercial importance due to the low muscle content and skin covered with rigid bony plates. This study aimed to extract and characterize collagen from the skin of Pterygoplichthys spp. obtained from two communities in Chiapas, Mexico. Our results show that the extracted collagen is type 1, with a yield of 43.0% (dry weight). Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis revealed the presence of two alpha chains (α1, α2) and a beta and gamma component, consistent with type 1 collagen. Liquid chromatography coupled to mass spectrophotometry analysis identified peptide sequences homologous to those reported in other species. This study highlights the potential of Pterygoplichthys spp. skin collagen as a viable alternative to mammalian collagen. The efficiency of the extraction process and the identification of peptides resembling those of the other species underscore the feasibility of utilizing collagen from the skin of Pterygoplichthys spp. in industrial applications, offering a sustainable solution to environmental and economic challenges. Practical Application: Collagen extracted from the skin of Pterygoplichthys spp., an invasive fish species, can serve as a sustainable alternative to mammalian collagen, offering a cost-effective biomaterial with properties suitable for various industrial applications.