Electric Blender Research Articles

Nutrient composition of shade-dried Aldenia cissampeloides (monkey rope) leafy vegetable

Background: Our locally available vegetables are underutilized due to lack or insufficient information about their health benefit. Consequently, some are going into extinction due to low consumption. Adenia cissampeloides, a locally available vegetable used in the preparation of vegetable soup and or some therapeutic purposes is becoming unpopular due to insufficient nutritional and other information on it. Objective: The study investigated the nutrient composition of shade-dried Aldenia cissampeloides leafy vegetables. Methods: Fresh leaves of Adenia cissampeloides were harvested from Opi in Nsukka local Government Area of Enugu State in South Eastern Nigeria. The leaves were sorted, washed with water, and allowed to drain in a colander for about 20 minutes. The leaves were shade-dried for 7 days at room temperature and pulverized using Qlink electric blender model QBL/20L40. The proximate, mineral, and vitamins of the pulverized dried sample were analyzed using standard methods. Results: The proximate analysis showed an appreciable amount of carbohydrate (42.86%), crude fiber (16.79%), and protein (16.44%). Magnesium (2046.69mg), potassium (1031.33mg) and calcium (555.33mg) was the most abundant mineral while pro-vitamin A had the highest value (298.56 RE) among the analyzed vitamins. This was indicative that the vegetable is a good source of nutrients. Conclusion: Due to its nutrient-dense quality, it is recommended to be cultivated at home gardens for easy accessibility in meeting the family’s nutrient needs.

A Review on Influence of Titanium Dioxide, Molybdenum Disulfide and Glass Fibers on Polytetrafluoroethylene (Ptfe) for Wear Resistance

This study investigates the tribological performance of polytetrafluoroethylene (PTFE) composites reinforced with a synergistic combination of titanium dioxide (TiO2), molybdenum disulfide (MoS2), and glass fibers. The fabrication process involves blending the materials in an electric blender, followed by the addition of chopped glass fibers. The resulting mixture is molded, cold pressed, and sintered to create PTFE composites with varying compositions. The tribological tests are conducted under fixed conditions, including constant velocities of 1 m/s, 2 m/s, and 3 m/s, with load increments until specimen failure. The experiments are carried out using a hydraulic motor to apply loads rapidly, and various parameters such as normal load, speed, temperature, and friction torque are recorded. The study aims to understand the influence of each ingredient on the tribological behavior of the composite, with a focus on wear rates, specific wear energy, and specific wear rate calculations. The results contribute valuable insights into optimizing PTFE composites for enhanced friction and wear resistance, particularly in applications requiring superior tribological properties.

Antibacterial, Phytochemical and Antioxidant Activity of Gliricidia sepium Crude Extract against Human Pathogenic Bacteria

Aim: The present study is aimed at examine the antibacterial effect of crude extract of G. sepium to human pathogenic bacteria and its contents of its phytochemical and antioxidant properties.
 Place and Duration of the Study: The study was conducted in the Department of Science Laboratory Technology. Ekiti State University Ado Ekiti Nigeria under ambient temperature and humidity between May and September 2023.
 Methodology: The collected plant sample was identified by Mr. Omotayo F.O. of the Department of Plant Science and Biotechnology at Ekiti State University Ado Ekiti, Ekiti State. The plant was oven dried at 61.9°C for two hours and thirty minutes, then ground into a fine powder using an electric blender after being airdried for four weeks in a cold environment. 100 g of powdered leaves were steeped in 500 ml of distilled water, N-hexane, dichloromethane, and methanol, respectively, to prepare the extracts. Following the mixes' filtration via muslin fabric. Salmonella typhi, Staphylococcus aureus, Escherichia coli, and Proteus vulgaris were obtained from Federal Teaching Hospital Ido Ekitti in Ekiti State, Nigeria. The antibacterial activity of was determined using the agar diffusion method.
 Results: The results of the crude extract's antibacterial activity showed that the water extract had the largest zone of inhibition (12.00 ± 1:00 mm) against E. coli, while N-hexane had the lowest zone of inhibition (3.33 ± 5.77 mm) against S. typhi and P. vulgaris. Phenol content ranged from the lowest (6.19±0.01) in water extract to the highest (47.19 ± 0.02) in DCME. The plant demonstrated good amount in the Ferric Reducing Antioxidant Power (FRAP) and DPPH scavenging assays. Methanol extract had the highest DPPH (23.53 ± 0.03) at the lowest concentration of 100 µg/ml, and it also produced the highest DPPH (62.63 ± 5.77) at the highest concentration of sample, 500 µg/ml. 
 Conclusion: The present work highlights the possible use of G. sepium leaf extracts as a source of antibacterial agents that can be used to prevent human diseases.

PREVALENCE OF TETRACYCLINE RESISTANCE GENES IN ESCHERICHIA COLI ISOLATED FROM FOOD SAMPLES IN AND AROUND MICHAEL AND CECILIA IBRU UNIVERSITY, NIGERIA

Background: Genes that confer resistance to tetracycline, a common antibiotic used in both human and veterinary medicine, are among the antibiotic resistance genes of most concern. Tetracycline treatment, a crucial weapon in the fight against bacterial infections, can become ineffective because of this resistance. Aim: Determination of the prevalence of tetracycline resistance genes within Escherichia coli strains found in food samples obtained from local food vendors in and around Michael and Cecilia Ibru University, Agbarha-Otor. Methods: Food samples were obtained from 6 out of 10 selected food vendors in and around MCIU campus. A total sample size of 100 respondents were administered questionnaires. Out of a total food sample size of 28, about 25grams of food samples were homogenized with 225 ml of buffered peptone water (BPW) in an electric blender (Vitamix 5200 model). Eosin Methylene Blue (EMB) agar was subsequently used as the culture media. About 0.5 ml aliquots of the inoculum were taken to extract DNA by the modified Boiling Lysis Method. Polymerase Chain Reaction (PCR) was performed using a thermocycler for the detection of tetA gene in E. coli isolates using specific primers (tetA-F CGCCTTTCCTTTGGGTTCTCTATATC; tetA-R CAGCCCACCGAGCAC AGG; Size=182 base pairs). Thereafter, gel electrophoresis was done at 200 volts for 15 minutes and studied under UV light Gel Documentation System (Cleaver Scientific, UK). Statistical analysis was conducted using Chi-square tests to identify significant differences (p<0.05) in resistance patterns among the food categories. Results: Tetracycline resistant gene (tetA) was investigated among 18 of 28 cultured samples which had E. coli growth indicating 64% prevalence. Electrophoresis results indicated the presence of tetA gene in 11 out of the 18 E. coli positive samples as the prevalence of tetA gene was 61%. Lane 2, 4, 5, 6, 7, and 10 showed bands at 182 bp confirming the isolate contained tetA gene. Lane 5 showed additional bands at 780 bp which indicated possible superficial polymorphism of the tetA gene in isolates. The presence of bands at 182 bp confirmed the presence of the gene, and the presence of additional bands at 780 bp in Lane 5 suggested potential genetic variation in the tetA gene. Conclusion: The study contributes to a broader understanding of antibiotic resistance patterns, gene prevalence, and genetic variations in bacterial isolates, with particular reference to E. coli. It underscores the need for continued surveillance and research into antimicrobial resistance, particularly in environments where E. coli contamination is of concern, such as food vendor settings. Peer Review History: Received: 20 June 2023; Revised: 14 July; Accepted: 27 August, Available online: 15 September 2023 Academic Editor: Dr. A.A. Mgbahurike, University of Port Harcourt, Nigeria, amaka_mgbahurike@yahoo.com Received file: Reviewer's Comments: Average Peer review marks at initial stage: 6.0/10 Average Peer review marks at publication stage: 7.0/10 Reviewers: Prof. Hassan A.H. Al-Shamahy, Sana'a University, Yemen, shmahe@yemen.net.ye Dr. Bilge Ahsen KARA, Ankara Gazi Mustafa Kemal Hospital, Turkey, ahsndkyc@gmail.com

Profiling of fungi associated with Lycopersicum esculentum mill. spoilage in Nigeria using internal transcribed spacer (its) sequence of rDNA method

Lycopersicum esculentum Mill often referred to as Tomato is among important vegetable fruits widely cultivated the world over. The fruits are made up of soft endocarp which make them susceptible to spoilage by fungi mold. The fungi produce mycotoxins that are injurious and detrimental to human health. This study is aimed at profiling fungi mold associated with Lycopersicum esculentum rot /spoilage and identify the putative fungi responsible for its spoilage in Nigeria, particularly Akwa Ibom State metropolis. Tomato fruits heavily infested with fungi mold were collected and marshed using a sterile electric blender. Serial dilution of sample in normal saline were made and grown on prepared plates of Potato Dextrose Agar (PDA) to obtain pure culture. High quality genomic DNA was isolated from the samples; it was quantified and checked for purity. The DNA samples were subjected to PCR amplification. The amplicons were gel eluted, sequenced and checked for homology by using Basic local alignment search tool - BLAST. Identification was obtained from the top similarility outcomes of the samples. Four fungal isolates identified were Aspergilus spp., Fusarium spp., Mucor spp. and Penicillium citrinium. The economic importance of fungi molds are not in doubt as some of them are important precursor of diseases as they produces mycotoxins which is capable of causing diseases in both humans and animals, while other sare important in the field of medicine, in industrial production of antibiotics especially Penicillin.

Ubiquitous Domain Adaptation at the Edge for Vibration-Based Machine Status Monitoring

This article presents a ubiquitous domain adaptation (UDA) and generalizability technique for vibration-based automated machine status monitoring at the edge. The method significantly reduces the effects of signal noise artifacts and device/usage-specific vibration signatures using basic time-frequency domain signal operations and a lightweight ensemble of data-driven classifiers, allowing the method to be used for reliable domain-invariant status monitoring of motorized equipment. An experimental setup using vibration data from an air-cooled electric blender motor (source domain) is used to train an automated machine state identification classifier that can identify the operating states of an eccentric rotating mass vibration motor (target domain). Initial deployment of this method on target-domain motorized devices resulted in a machine status monitoring accuracy of at least 81.6% and a maximum training accuracy of almost 99% on known data of the source domain and 91.49% for unseen data in the target domain within an acceptable time frame. The performance of the proposed method is also comparable across platforms ranging from resource-constrained edge to a resource-rich cloud. This approach facilitates the use of noisy or uncalibrated sensor data in data-driven machine status monitoring tasks, therefore allowing for the development of reusable, low-cost monitoring systems that require meagre developmental effort, resulting in accelerated deployment times.

Effect of “Uchakiri”(Vitex doniana),“Uturukpa” (Pterocarpus santalinoides) and “Ewa” (Solanum americanum) Methanoic Extract on Iron Status of Rats

Background: Iron deficiency anaemia is a hidden hunger which can affect at every stage of human development especially pregnant women and children.
 Aim: The study was carried out to ascertain the effect of “ewa”, “uturukpa” and “uchakiri” on iron status of rat.
 Methods: The vegetables were purchased from Oriemba market Akpugo in Nkanu West Local Government Area of Enugu State. The vegetables were trimmed, washed with deionized water and drained. The vegetables were ground using electric blender. Methanolic extraction was done using a modified method. All the analysis were carried out using a standard method.
 Results: The results obtained were 2.67-3.52 mg iron, 0.52-0.89 mg copper, 1.56-7.43 mg zinc, 2.42-120.70 mg calcium 10.16-39.10 mg magnesium, and 68.80-90.40 mg potassium. The mean serum ferritin, haemoglobin, packed cell volume and RBC all increased gradually after consumption of leaves extract.
 Conclusion: The result showed that ethanol leaf extract of Vitex doniana, “ewa” and “uturukpa” posseses anti-anemic potentials that are capable of reducing the risk of iron deficiency anemia in the society.

Toxic effects of calcium carbide forced ripened pawpaw on the kidney of the Wistar rats

There is a global upsurge in terminal diseases due to unnoticed intake of toxic chemicals. One of such chemical is Calcium carbide, which has been used to ripen fruits by vendors. The aim of this study is to showcase the toxic effect of Calcium carbide coerced ripened Pawpaw on the kidney. Mature unripe Pawpaw’s were plucked off from the parent plant at Yenagoa, Bayelsa State. The fruits were dividing into two groups; one group was kept and allowed to rip at normal room temperature while the other group was induced with Calcium Carbide to ripe at the Histology Laboratory, Bayelsa Medical University, Yenagoa, Bayelsa State. 10gram of Calcium carbide was placed in a bowl containing 5ml of water for dissolution in a closed metal bucket containing 1kg of the fruit [pawpaw] rapped with black nylon and was allowed for two days[48 hours] for ripening. After ripening, sampled fruits were washed and juiced. 600g of both the naturally ripened and calcium carbide ripened pawpaw were peeled separately and blended in an electric blender with 350ml/1L of deionized water. The juice was filtered and poured into clean bottles labeled [CaC2 induced ripened juice and naturally ripened pawpaw juice]; then stored in a refrigerator for subsequent use. 21 adult Wister rats of both sexes weighing between 126.9- 214.3g were used. They were divided into three groups for each sex, based on the body weight and then different concentrations of naturally ripened and calcium carbide induced ripened Pawpaw were administered orally. LD50 was carried out using Lorke, 1983 [13] method for administration of samples using nine [9] Wistar rats. 12 Wistar rats were used for the main experiment. Group 1: Normal control group of 4 rats [2 males and 2 females] receive normal water and feeds only as placebo. Group 2 : Treatment Group [1] of 4 rats [2 males and 2 females] received 5ml/kg naturally ripened pawpaw juice. Group 3: Treatment Group [2] of 4 Wistar rats [2 males and 2 females] received Calcium Carbide ripened pawpaw for 4 weeks. 5ml/kg for both the natural fruit and the CaC2 ripened fruits were administered against each body weight of the adult Wistar rats. The Wistar rats were weighed, one was sacrificed in the groups, each week and blood and organ samples were collected from the three groups for hematological and histopathological analysis. Results showed increase in Creatinine, Urea, and Albumin of the treated groups in contrast to the control (p<0.05). Also there is moderate to severe renal tubular degeneration and tubular necrosis of the Calcium Carbide treated group as against the control. In conclusion Calcium carbide causes complete renal failure and subsequently death may arise.

Multifaceted Health Benefit of Ficus capensis Fruits and Vegetables

This study was carried out to evaluate the chemical properties of Ficus capensis fruits and vegetables. Ficus capensis vegetables and fruits were separately plucked, sorted, cleaned and milled using electric blender until the desired particle size was obtained (150 - 850 microns). Analyses of the proximate, mineral, vitamins, phytochemicals and anti-nutrient contents of the vegetables and fruits were carried out using standard methods. Proximate analysis showed that Ficus capensis had a protein mean value of 6.11and 8.02 g/100 g, ash 7.63 and 2.92 g/100 g, fibre 9.82 and 6.33 g/100 g, moisture 43.28 and 45.20 g/100 g, carbohydrate 31.48 and 35.61 g/100 g and fat content of 1.68 and 1.92 g/100 g for the vegetables and fruits respectively. Mineral constituents were iron 14.24 and 11.68 mg/100 g, calcium 25.46 and 24.20 mg/100 g, magnesium 21.48 and 28.10 mg/100 g, zinc 2.42 and 5.22 mg/100 g, sodium 0.51 and 1.25 mg/100 g, potassium 126.80 and 5.01 mg/100 g and phosphorus 0.62 and 1.24 mg/100 g for the vegetables and fruits respectively. However, Ficus capensis had some anti-nutrients such as tannin 4.28 and 1.67 mg/100 g, cyanide 1.97 and 0.09 mg/100 g, oxalate 5.10 and 2.64 mg/100 g, phytate 9.26 and 7.01 mg/100g and saponin 2.97 and 1.20 mg/100 g for the vegetables and fruits respectively. The results showed that the fruits and vegetables of Ficus capensis is an underutilized fruits and vegetable with high nutrient profile especially iron which when incorporated to the diet could help to fight iron in a community with high prevalence of anemia.

Development of an automated bitter leaf processing machine

Bitter leaf is known to be a delicacy and nutritious leaf in Nigeria which is commonly consumed by lots of people. The bitter sap or juice is extracted for medical use or disposed, while the leaf is used for cooking. Manual processing of bitter leaf could lead to injury to the palm and fingers and such could lead to the contamination of the processed leaves or become avenue for infection of injury that may be sustained. Also, processing a small or large amount of bitter leaf for domestic or commercial use could be tasking. For this reason, an automated bitter leaf processing machine was developed in this work to eliminate the risk of contamination and injuries by reducing human intervention to the minimum. The machine is timing-based and comprises the following components: water heater (500W), electric blender (200W), microcontroller(ATmega8A), MOC3021 optocoupler, BT151-500R thyristor, Relay module 12v, Tact button switch, Solenoid valve, I2C LCD interface, voltage regulator L7805CV, MOSFET (IRFZ44 55V 49A), etc. The processing of the bitter leaf with different masses (0.01, 0.025, 0.05, 0.075 and 0.1 kg) using a constant mass of water (0.5 kg) for every cycle was carried out at varying processing chamber (blender) spinning time of 5, 7.5 and 10 min. The results obtained showed that the total removal of the bitterness from the leaf was achieved at 5 min spinning and rinsing time, for 0.01 and 0.025 kg of bitter leaf. At 7.5 min and 10 min, slightly bitter results were recorded for processed bitter leaf masses of 0.05 and 0.075 kg. The results obtained show that the system is suitable for processing bitter leaf both for domestic and commercial purposes.

ASSESSMENT OF THE BIOCHEMICAL PARAMETERS ON THE FIRST FILIAL GENERATION FROM THE WISTAR RATS FED WITH CALCIUM CARBIDE RIPENED ORANGE.

Purpose and Methods: The use of chemicals for fruit ripening is constantly on the increase and inadvertently, such chemicals are consumed unperceived. The aim of the study is the assess the Biochemical parameters of the Pups from the Wistar rats fed with Calcium Carbide induced ripened orange. Unripe mature oranges were gotten for the parent plant at Ogu, Yenagoa, Bayelsa State. The fruits were divided into two; the first group was allowed to ripe at normal room temperature and 1kg of the second oranges wrapped with black nylon were forced to ripe within 48 hours with 10grams of Calcium carbide which was dissolved in 5ml of water in a closed steel bucket. 600g of each groups of the ripened oranges were peeled differently and blended in an electric blender with 350ml/1L distilled water. The juice was filtered with a clean fine sieve and were poured into clean bottles labeled accordingly and stored in a refrigerator for future use. 24 adult Wistar rats [12 male and female of each sex] weighing between 126.9- 213.3g were used. They were acclimatize for two [2] weeks and was fed with standard grower mash with clean water ad libitum. The Wistar rats were grouped into three, [1] Control, of 8 rats [4 males and 4 females] receive normal water and feeds only as placebo. [2] Treatment group I, containing 8 rats [4 males and 4 females] received 5ml/kg of the naturally ripened orange juice [3] Treatment II of 8 rats [4 males and 4 females] received 5ml/kg of the Calcium carbide induced ripened orange juice orally against their body weight for four weeks. The Wistar rats copulates freely during this period. Birthing occurred in the three groups and the Pups were collected weight at birth, at one week and the two week. They were sacrifice at second week and blood sample collected for the Biochemical analysis. Data collected from this study was analyzed as Mean ± Standard Error of Mean [SEM]. Significant difference among the groups was determined as P<0.05; by two-way ANOVA; using Statistical Analysis Program for Social Sciences [SPSS 22.0 Version].
 Findings and recommendations: The results of this study showed statistically significant increase in the mean AST, ALT, ALP, Creatinine, Urea, Total Biluribin and Lactate Dehydrogenase of the pup of the Wistar rats fed with Calcium carbide forced ripened orange juice in contrast with the control group (p<0.05). There was significant reduction in the mean Albumin, Total Protein and Total Cholesterol in the pups from the Wistar rats fed with Calcium carbide forced ripened orange juice when compared with the control group (p<0.05). In conclusion, there is nutritional programming of Calcium Carbide forced ripened fruit when consumed by a mother and could cause hepatic and/or extra-hepatic toxicity, renal failure, heart failure, coronary heart diseases of the offspring. Thus; we recommend strongly, the abolishment of Calcium carbide as an agent for fruit ripening.

Nutritional programming assessment on the second filial generation pups of the Wistar rats fed with calcium carbide coerced ripened orange: The Haematological Perspective.

The explicit use of chemicals for fruit ripening is increasing daily and with eminent consequences. The aim of this study is to check nutritional programming on the second filial generation pups of the Calcium Carbide coerced orange juice fed Wistar rats. Mature unripe oranges were gotten from the orange plant in Ogu, Yenagoa, Bayelsa state. The oranges were coerced to ripe with 10gram of Calcium Carbide which was placed in a bowl with 5ml of water for dissolution in a closed metal bucket containing 1kg of the matured orange rapped with black nylon and kept two days to ripe. After ripening, sampled fruits were washed and juiced. 600g of calcium carbide coerced ripened orange was peeled, blended in an electric blender with 350ml/L of distilled water to form the orange juice and was filtered with a clean fine sieve then poured into clean bottles which were labeled and stored in a refrigerator for future use. 21 adult Wister rats [10 males and 11 females] weighing between 126.9- 213.3g were used for this study. The experimental Wistar rats were cohort into two and was allowed to acclimatize for two weeks (fed with grower mash with clean water ) at libitum then, different dosage of the Calcium carbide coerced ripened orange juice was administered orally based on their body weight. A sub-acute test [LD50] was done [with 9 Wistar rats] to assess the lethal dose, using Lorke (1983) formula for administration of samples. Group 1: Normal control group of 6 rats [3 males and 3 females] receive normal water and feeds only as placebo. Group 2: Treatment Group [2] of 6 rats [3 males and 3 females] received Calcium Carbide ripened orange juice. The treatment lasted for four weeks. The Wistar rats were allowed to copulate freely during and after the acclimatization and treatment period. Wistar rats birthed and the Pups of the different groups were collected according to the treatment protocols. The parent Wistar rats were still kept in their distinctive cages without treatment but was allowed free access to feed on the growers mash, clean water and copulation at libitum. In the second birthing the Pups were weighed at birth, at one week and two weeks, then they were sacrificed at the end of the second week and blood samples were collected from the two distinctive cohorts for haematological analysis. The data was analyzed using Statistical Analysis Program for Social Sciences [SPSS 22.0 Version]. The results showed significant increase in PCV, hemoglobin, Total RBC, lymphocytes and reduction in Total WBC, Platelet and Monocytes in the second filial generation pups from the Wistar rats fed with Calcium carbide coerced orange juice. Haematological Indices are biomarkers that indicates functionality of the blood cells with regards to low, normal or high range. There is evidence of nutritional programming in the second filial generation pups as seen in this results.

Assessment of the Biochemical Parameters of the Second Filial Generation Pups From the Wistar Rats Fed with Calcium Carbide Ripened Orange

Fruits are useful food substances that provide unique and essential nutrients for the body. This present study is aimed at evaluation the toxic effect on the Biochemical indices of the second filial generation pup from the Wistar rats fed with Calcium Carbide forced ripened orange fruits. Mature unripe oranges were plucked off from the orange plant in Ogu, Yenagoa, Bayelsa state. They were forced to ripe with 10g calcium carbide which was placed in a bowl containing 5ml of water apparently used to dissolved it in a closed metal bucket containing 1kg of the matured orange rapped with black nylon and was kept two days [48 hours] to ripe. After ripening, sampled fruits were washed and juiced. 600g of calcium carbide forced ripened orange was peeled and blended in an electric blender with 350ml/L of distilled water to form the orange juice. The orange juice was filtered with a clean fine sieve and was poured into clean bottles labeled [CaC2 forced ripened orange juice] which was then stored in a refrigerator for further usage. 21 adult Wister rats [10 males and 11 females] weighing between 126.9- 213.3g were used for this study. The experimental Wistar rats were cohort into two and was allowed to acclimatize for two weeks (fed with grower mash with clean water ) at libitum then, different dosage of the fruit juice were administered orally based on their body weight. Group 1: Normal control group of 6 rats [3 males and 3 females] receive normal water and feeds only as placebo. Group 2: Treatment Group [2] of 6 rats [3 males and 3 females] received Calcium Carbide ripened orange juice. The treatment lasted for four weeks. The adult Wistar rats were allowed to copulate freely during and after the acclimatization and treatment period. Wistar rats birthed and the Pups of the different groups were collected according to the treatment protocols. The parent Wistar rats was still kept in their distinctive cages without treatment but was allowed free access to feed on the growers mash, clean water and copulation at libitum. They birthed again for the second time [Second Filial Generation] and the Pups were weighed at birth, at one week and two weeks, then they were sacrificed at the end of the second week and blood samples were collected from the two distinctive cohorts for Biochemical assay. Biochemical assay was done and results indicates reduction all the tested indices; AST, ALT, ALP, Creatinine, Urea, Albumin, Tottal protein, Total Cholesterol, Bilirubin, Lactate Dehydrogenase[LDH] in the Second Filial Generation Pups of the Calcium Carbide treated Wistar rat. Nutrients from the fruit induced with Calcium Carbide consumed during pregnancy permanently impact on the developing fetus of the Wistar rats which is expressed later in life.

Investigation of the Haematological Indices of the First Generation of the Wistar Rats Fed with Calcium Carbide Ripened Orange

Various chemicals have been consumed unnoticed by human in the advent of solving problems. The study is aimed at investigating the haematological indices of the first generation of the Wistar rat fed with Calcium Carbide induced ripened orange. Mature unripe oranges were plucked off from the Orange plant in Yenagoa, Bayelsa State. The fruits were divide into two groups, one group was kept and allowed to rip at normal room temperature and the other group was induced with Calcium Carbide to ripe. 10gram of calcium carbide was dissolved in 5ml of water in a closed metal bucket containing 1kg of the orange rapped with black nylon and was allowed for two days [48 hours] for ripening. After ripening, sampled fruits were washed and juiced. 600g of both the naturally ripened and calcium carbide ripened orange were peeled separately and blended in an electric blender with 350ml/1L of deionized water. The juice was filtered with a clean fine sieve and was poured into clean bottles labeled [CaC2 ripened orange juice and naturally ripened orange juice]; and was stored in a refrigerator for subsequent use. A total of 24 adult Wister rats [12 male and female of each sex] weighing between 126.9- 213.3g were used. They were kept in standard environmental condition, acclimatize for two [2] weeks and was fed with standard grower mash with clean water ad libitum. The rats were divided into three groups based on the body weight and then different concentrations of naturally ripened and calcium carbide induced ripened orange were administered orally. Group 1: Normal control group of 8 rats [4 males and 4 females] receive normal water and feeds only as placebo. Group 2: Treatment Group [1] of 8 rats [4 males and 4 females] received 5ml/kg of the naturally orange juice. Group 3: Treatment Group [2] of 8 rats [4 males and 4 females] received 5ml/kg of the Calcium Carbide ripped orange juice for 4 weeks. They were allowed to mate freely during the acclimatization and treatment period [One Month and two weeks]. The Wistar rats birthed and the pups of the three different groups were collected according to the treatment protocols. The Pups were weighed at birth, one week and two weeks and then sacrificed and blood samples were collected for haematological analysis. Results showed reduce Packed Cell Volume, Total White Blood Count, Hemoglobin, Red Blood Cell Count, Platelets, Lymphocytes, in the pups from the Calcium carbide treated Wistar rats (p>0.05). But there was an increase in Neutrophil, Monocytes and Eosinophil level of the pups from the Calcium carbide treated group. Calcium carbide has shown devastating effect on the haemtological parameters from the Pups of the Wistar rats fed with Calcium carbide. Blood cells production is impeded due its negative effect on hemapoietic stem cells, protection against foreign bodies is compromised due to low TWBC, resulting to tissue hypoxia, hemorrhage, and stunted growth and amongst other negative consequences; which are passed from parents to offspring as clearly exposed in this study.

Toxic Assessment of Calcium Carbide Ripened Pawpaw on the Haematological Parameters of the Wistar Rats

Fruits are sweet fleshy products of a plants, that contain various nutrients and when consumed help the human in diverse ways. Some build up muscles, some burst immune system, some are anti-oxidant and amongst other functions. Because of the high commercial demand, naturally ripe fruits are scarce, thus; alternative (artificial) ways of making them ripe for consumption has become inevitable and uncontrollable. The aim of this study is to evaluate the effect of Calcium Carbide ripened fruit (Pawpaw) on the Haematological parameters of the Wistar rats. Mature unripe pawpaw’s were plucked off from the parent plant and were divide into two groups, one group was kept and allowed to rip at normal room temperature and the other group was induced with Calcium Carbide to ripe for 48 hours.10g of the CaC2 was placed in a bowl and 5ml of water was used to dissolved it in a closed metal bucket containing 1kg of the fruit [Pawpaw] rapped with black nylon and was allowed for two days [48 hours] for ripening. After ripening, sampled fruits were washed and juiced. 600g of both the naturally ripened and calcium carbide induced ripened fruits [Pawpaw] were peeled separately and blended in an electric blender with 350ml/1L of deionized water. The two sets of juice was filtered with a clean fine sieve and was poured into clean bottles labeled [CaC2 ripened and naturally ripened pawpaw juice]. A total of 21 adult Wister rats of both sexes weighing between 126.9g- 213.3g were used for this study. 9 Wistar rats were used for Sub Acute Test (LD50). The rest 12 Wistar rats were divided into three groups (Control, Natural and CaC2). 5ml/kg of the naturally ripened and calcium carbide induced ripened fruits [Pawpaw] were administered orally to the rats based on the body weight. The rats were weighed weekly, then one rat was sacrificed in each group and blood samples were collected from the three groups for hematological analysis. The result showed reduction in mean Pack Cell Volume, Total White Blood Count, Hemoglobin, Red Blood Cells, Platelets, Neutrophil, Monocytes for both the Wistar rats fed with Naturally ripened and CaC2 ripened groups in comparison with the control group. There is evidence of increase in the mean Lymphocytes level for both the Wistar rats fed with naturally ripened and CaC2 ripened groups in comparison with the control group, but the CaC2 treated group tend to be higher. Eosinophil levels are higher in the CaC2 treated group. In a nutshell, The consumption of fruits ripened with Calcium Carbide pose devastating effect on the bone marrow, deleterious effect on the circulating blood, heart and brain, that will evenly lead to myocardiac infarction, Eosinophilia, Anemia, thrombocythopenia, paralysis, stroke, seizure and mortality may eventually arise.

Effect of Cucumis sativus and Prunus armeniaca Juices on Blood Glucose, Insulin and Electrolytes of Alloxan Induced Diabetic Male Sprague Dawley Rats

Aims: To investigate the effects of Cucumis sativus and Prunus armeniaca juices on blood glucose, insulin and electrolytes of alloxan-induced Diabetic male Sprague Dawley rats.
 Study Design: An experimental study involving a total of eighty (80) male Sprague Dawley rats was used.
 Place and Duration of Study: Department of Medical Laboratory Science, Rivers State University, Nigeria, between January 2021 and February 2022.
 Methodology: 80 male Sprague Dawley rats were grouped into eight groups of ten rats each and housed in separate cages in an animal house. They were induced for diabetes with 150 mg/kg alloxan monohydrate intraperitoneally apart from group 1. They were then treated with various doses of apricot and cucumber juices. The juices were extracted by blending the pulp of each fruit using an electric blender and the juice sieved into a water bottle. Group 1 was the positive control, group 2 negative control, group 3 high dose apricot, group 4 low dose apricot, group 5 high dose cucumber, group 6 low dose cucumber, group 7 a combination of apricot and cucumber juices, group 8 metformin. The rats were treated for a period of 5 weeks and sacrificed. Blood glucose was estimated using the glucose oxidase method, electrolytes (Sodium, Potassium, Chloride) measured using serum electrolytes analyser, insulin was measured using Crystal Chem’s Rat insulin ELISA method. Phytochemical analysis was done using Cleg Anthrone method for carbohydrate, Boham and Kocipaiabyazari test for flavonoid and Harbone method for alkaloids. Statistical analysis was done using GraphPad prism and results expressed as mean ±SD (P < 0.05).
 Results: The results showed that high dose cucumber significantly reduced (P = 0.03) blood glucose level (5.4 mmol/L) compared to positive control (10.5 mmol/L); apricot and cucumber juices improved insulin level significantly (2.03 µIU/ml) (P < 0.01) compared to positive control (0.77 µIU/ml); a combination of apricot and cucumber juices improved potassium level (3.73 mmol/L) significantly (P = 0.03) compared to control (3.4 mmol/L). High Dose Cucumber also significantly reduced blood glucose level better than high dose apricot (P < 0.01).
 Conclusion: Cucumber juice therefore improved diabetic condition in diabetic male Sprague Dawley rats and a combination of apricot and cucumber juices boosted potassium level in diabetic rats.

Wound Healing Functionality of Mangosteen Extracts on Viscose Fabric

The aim of this study was to introduce novel dressing with different extracts of mangosteen for quick blood clotting and wound healing. Insufficient use of natural biomaterials for blood clotting and wound healing in the medical textile sector has been observed. In order to improve the situation, viscose woven fabrics treated with mangosteen leaf, peel and pericarp extract were examined. Fresh mangosteens were collected from local market and different pastes were prepared by using an electric blender. The pretreated viscose woven fabrics were dyed with these pastes using glycerin as mordant. After the sample preparation, an antibacterial test, odor test, blood clotting test, strength test, color fastness tests were done. The treated samples exhibited good antibacterial activity against gram negative bacteria and mild antibacterial activity against gram positive bacteria, especially the fabrics treated with mangosteen leaf and pericarp. Besides, the treated samples did not create annoying odors as like the untreated one. To justify healing properties, implementations of the samples were done on a rabbit. Leaf and pericarp treated fabrics exhibited good blood clotting in comparison with untreated fabric. All the treated samples exhibited average to good color fastness to wash and rubbing properties with sufficient tensile strength. Morphological changes of the treated and untreated fibers were examined by SEM and FTIR analysis and the results clearly showed the differences in the untreated and treated samples. The experiments were carried out in an environment friendly way which indicates the production and processing of these dressing materials can have an enormous contribution to sustainable operations and products for the development of medical textiles sector.

Assessment of Nutritional and Bioactive Components of Garcinia kola Chips

Garcinia kola otherwise known as bitter kola has been used in traditional African medicine for centuries, and is considered to havemany beneficial properties. The study was aimed at assessing the nutritional and bioactive components of bitter kola chips. Freshlyharvested seeds of Garcinia kola were purchased from local markets in Ado Ekiti, Nigeria. The seeds were thoroughly washed with cleanwater, de-husked, sliced and fast-dried at room temperature under high air current, to obtain bitter kola chips. The dried bitter kolachips were ground into fine powder using an electric blender. The fine powder was then analysed for its proximate, minerals, vitamins,phytochemicals and essential oil content. The results showed low moisture content (8.47 %), moderate levels of protein (12.7 %), fat(6.27 %), ash (7.47 %) and crude fibre (6.27 %), as well as very high levels of carbohydrate (58.77 %) and metabolizable energy (3000Kcal/Kg). The micronutrients present in bitter kola consists of Fe2+, Zn2+, Mg2+, Ca2+, K+, PO3-, ascorbic acid, thiamine, niacin, andriboflavin at concentrations of 9.37, 0.23, 23.33, 238.33, 26.67, 323.33, 18.23, 0.27, 0.13 and 0.60 mg/100g respectively. The bitter kolachips contained high levels of alkaloids (628.33±10.41 mg/100g), saponins (161.67±7.64 mg/100g), and tannins (233.33±7.64 mg/100g);moderate levels of flavonoids (58.33±5.41 mg/100g), phytates (63.33±2.89), oxalates (90.00±5.00) and oxygen radical absorption capacity(13.23±0.25); while the anti-protease activity and cyanogenic glycosides levels were very low. GCMS analysis of the oil components of G.kola chips showed the presence of molecules such as Trichloroacetic acid, Ar-tumerone, Tumerone, which are of significant importanceto human health. Sensory evaluation showed high preference for the bitter kola chips than the fresh seeds.

Investigation of the Thermo-Physical and Mechanical Properties of Coir and Sugarcane Bagasse for Low Temperature Insulation

This research reports on the suitability of Agricultural bi-products as low temperature thermal insulating materials to replace synthetic insulating materials like polyurethane used in food warmers and ice coolers. Coir and sugarcane bagasse chosen for this research was based on literature review and local availability of materials. Coir was obtained from Badagry, Lagos State and Sugarcane bagasse obtained from Batati, Niger State, the materials were washed, sun dried for three days and cut into smaller pieces before being blended into smaller particles using an electric blender. The blended materials (Coir and Bagasse) were sieved into two different sieve size of 0.5 mm and 1.0 mm respectively. The particles sizes were then combined into blend ratios of 50/50, 60/40, and 70/30 using Gum Arabic as binder. Thermal conductivity test showed that 1.0 mm particle size coir mixed with sugarcane bagasse has the lowest thermal conductivity of 0.01467 W/mK whilst that of 0.5 mm particle size has thermal conductivity of 0.01472 W/mK this is lower compared to the measured thermal conductivity of the polyurethane control sample of 0.01832 W/mK. Sample F (1.0 mm particle size,70% coir and 30% bagasse) with a thermal diffusivity of 5.15 m²/s, water absorption capacity of 410 %, UTS of 0.219 MPa, Compressive strength of 0.583 MPa, Specific heat capacity of 1141.3 J/kgK and thermal resistivity of 68.16 W/m/K is most suitable replacement for polyurethane as low temperature thermal insulator. This is corroborated by the performance evaluation test with carried out between polyurethane lined food warmer and bio-composite lined food warmer. The two test samples have close ice melt rate values and the polyurethane slightly edge the Bio-composite insulating material by 1.2 % in efficiency. The edge in efficiency can be accepted as all materials used in the development of the bio-composite insulating material are completely bio-degradable and environmentally friendly.

Classroom Experiments using Phytochemical Analysis of Weed (Eleusine Indica)

This study aimed to demonstrate simple classroom experiments by evaluating the phytochemical components of the extracts of weed (Eleusine indica). The purpose of this study is also to contribute effective use of natural resources in the locality by transforming traditional knowledge to the scientific way of using the medicinal plant to be used as raw materials in pharmaceutical industries. The weed was air-dried for ten days. It was then pulverized using an electric blender. The mixtures were allowed to stand for seventy-two hours to extract the bioactive components of the weed. The experiment used chloroform (polar) in extracting the secondary metabolites present in the weed. The mixtures were then filtered with a cheese cloth and concentrated in direct heat using a hot plate. The extract was placed in a beaker and was labelled as chloroform extract. The bottle was covered tightly to prevent evaporation of the solvent. The Phytochemical components present in the weed extracts were alkaloids, flavonoids, carbohydrates, diterpenes, and saponins. This study is expected to be one of the teaching model (since the experiments are simple). This study also is expected to identify the phytochemical components of weed, identify the phytochemical components of weed, and contribute to the effective use of natural resources.