Eggplant Mottled Dwarf Virus Research Articles

A novel strategy for the determination of a rhabdovirus genome and its application to sequencing of Eggplant mottled dwarf virus

A novel strategy employing the rhabdovirus untranslated conserved intergenic regions was developed and applied successfully for the determination of the complete nucleotide sequence of Eggplant mottled dwarf virus (EMDV). The EMDV genome contains seven open reading frames with the same organization as Potato yellow dwarf virus (PYDV), the type species of the genus Nucleorhabdovirus. These two species encode five core genes [nucleocapsid (N), phosphoprotein (P), matrix (M), glycoprotein (G), and the polymerase (L)] like other viruses of the genus and an additional one (X), located between N and P, giving rise to a protein with currently unknown function. Furthermore, both EMDV and PYDV contain a gene (Y), inserted between P and M, which probably encodes the virus movement protein, in concordance with the rest of the plant-infecting rhabdoviruses. Phylogenetic analysis of the polymerase gene confirmed the classification of EMDV within the genus Nucleorhabdovirus and showed a close evolutionary relationship to PYDV. The novel sequencing strategy developed is a useful tool for the genome determination of yet uncharacterized rhabdoviruses.

Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR.

To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus) for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

Short communication. First report of Eggplant mottled dwarf virus in China rose in southern Spain

Eggplant mottled dwarf virus (EMDV, genus Nucleorhabdovirus, family Rhabdoviridae) is transmitted in nature by leafhoppers and its natural host range includes vegetable crops (eggplant, tomato, potato, pepper), ornamentals (pittosporum, honeysuckle, pelargonium) and wild plants (caper, Solanum nigrum). The prevalence of infections is generally very low. EMDV has been demonstrated to be the causal agent of a vein yellowing disease of China rose (Hibiscus rosa-sinensis) in southern Italy. In this work, four locations from Málaga and Granada provinces (southern Spain) were surveyed in 2011 to study the prevalence of EMDV infections in China rose by serological and molecular methods. Overall, EMDV was detected in 77.3% of the samples (33 out of 45 samples tested). Mechanical transmission tests and immunoelectron microscopy confirmed the presence of EMDV. The possible causes of such a high and unexpected prevalence are discussed. The use of molecular hibridization with an EMDV specific riboprobe is proposed for early screening of vegetative propagated China rose plants to avoid dissemination of infected material.

FIRST REPORT OF EGGPLANT MOTTLED DWARF VIRUS IN TOBACCO CROPS IN ALBANIA

In summer 2008 and 2009, tobacco plants of cvs Lovina and Katerini (Samsun) displaying severe stunting, leaf crinkling and vein clearing (VC) (incidence of diseased plants 0.1%) were ob- served in areas of Koritsa and Elbasan (Albania). Leaf extract from five affected plants collected in 2009 was used for mechani- cal inoculations of Nicotiana benthamiana, N. rustica and Gom- phrena globosa. Twenty-thirty days post inoculation, N. benthami- ana developed a systemic VC, while N. rustica reacted with yel- low spots in the inoculated leaves followed by systemic VC. In G. globosa only red local lesions were observed. Leaves from 10 symptomatic and 10 symptomless tobacco plants were collected from different fields and tested serologically by DAS-ELISA us- ing polyclonal antisera to Eggplant mottled dwarf virus (EMDV) (As 0136 antiserum, DSMZ, Braunschweig, Germany). All sam- ples from symptomatic plants tested positive. To confirm the presence of EMDV a one-step RT-PCR as described by Katis et al. (2011) was carried out to the same samples and one of the PCR products was sequenced. BLAST analysis of the obtained sequence revealed 98% nucleotide similarity with the homolo- gous published sequences of the EMDV isolates from tobacco (AM922318), cucumber (AM922317), Pittosporum tobira (AM922320) and 88% with those of virus isolates from eggplant (AM922319) and caper (AM922321), respectively. The obtained sequence was deposited in EMBL-EBI under the accession No. HE601787. EMDV is known since 1969 and is generally consid- ered to be of minor importance. It has been reported to infect to- bacco in Italy and Greece (Chatzivassiliou et al., 2004). To our knowledge this is the first report of EMDV in tobacco in Alba- nia, even though its economic importance is limited.

DEVELOPMENT OF AN IC-RT-PCR ASSAY FOR THE DETECTION OF EGGPLANT MOTTLED DWARF VIRUS AND PARTIAL CHARACTERIZATION OF ISOLATES FROM VARIOUS HOSTS IN GREECE

SUMMARY In a 10-year survey several Eggplant mottled dwarf virus (EMDV) isolates were collected from diverse hosts from all over Greece. In this study, an IC-RT-PCR assay was developed for the detection of the virus. Degenerate primers were designed on conserved regions of the glycoprotein (G) gene of various plant nucleorhabdoviruses. Based on the initial genetic information obtained, EMDV-specific primers were subsequently designed. The method successfully amplified a 284 bp product from all (76) virus samples originating from tobacco, cucumber, eggplant, Pittosporum tobira and Capparis spinosa (caper). Sequence analysis and Western blot were done for further characterization of representative isolates. Two isolates from tobacco (EMDV-Tob) and cucumber (EMDV-Cu) were also subjected to electron microscopy and host range studies. Sequence analysis of the partial G gene confirmed the classification of EMDV within nucleorhabdoviruses. Genetic comparisons among the EMDV isolates tested indicated low levels of variation with the caper isolate, which is reported for the first time in Greece, being the most deviating isolate. This is the first molecular assay developed for the detection of EMDV and also the first sequence information obtained of its genome.

First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain.

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5' TATGCGAGAATTGGGAGTGGGTAGT 3') and EMDV-R (5' CATTGTTATCCCGGGAAGTATTT 3') targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2).

VEIN YELLOWING OF HIBISCUS ROSA-SINENSIS CAUSED BY EGGPLANT MOTTLED DWARF VIRUS IN SOUTHERN ITALY

SUMMARY Eggplant mottled dwarf virus (EMDV) was detected for the first time in southern Italy in several Hibiscus rosa-sinensis L. plants with vein yellowing. The virus was identified by the reactions of a herbaceous host range, cytopathology and serology. Virions were observed only in the nuclei of infected cells where they accumulated between the inner and outer lamella of the nuclear envelope. The virus was identified by an antiserum to a potato isolate of EMDV both in immunoelectron microscopy tests and in leaf sap with indirect ELISA. A limited survey revealed that EMDV occurs in naturally infected hibiscus in Campania, Calabria and Sicily (southern Italy). Some aspects of the epidemiology of EMDV are briefly discussed.

Eggplant mottled dwarf virus. [Distribution map

Abstract A new distribution map is provided for Eggplant mottled dwarf virus. Virus: Rhabdoviridae: Nucleorhabdovirus. Hosts: many. Major host is aubergine ( Solanum melongena ). Information is given on the geographical distribution in Europe (Bulgaria, Croatia, Greece, Italy, Mainland Italy, Sicily, Portugal, Slovenia, Spain, Canary Islands, Mainland Spain), Asia (Afghanistan, Iran, Israel, Jordan, Turkey), Africa (Algeria, Libya, Morocco, Tunisia).

Incidence and Distribution of Important Viral Pathogens in Some Iranian Potato Fields

From a total of 8,135 potato leaves collected from 132 fields in 11 provinces of Iran, the incidence and distribution of Alfalfa mosaic virus (AlMV), Eggplant mottled dwarf virus (EMDV), Potato leafroll virus (PLRV), Potato virus A (PVA), Potato virus M (PVM), Potato virus S(PVS), Potato virus X (PVX), Potato virus Y (PVY), and Tomato yellow fruit ring virus (TYFRV) were assessed using serological and biological methods. Based on enzyme-linked immunosorbent assay (ELISA) results, viruses in decreasing order of incidence in potato were PVS (35.9%), PVY (34.4%), PVA (27.0%), PVX (20.8%), PLRV (13.9%), PVM (9.0%), AlMV (7.0%), TYFRV (5.9%), and EMDV (5.1%). All 132 fields surveyed had some degree of virus infection, ranging from 28.8 to 98.6%, with an overall incidence of 75.2%. The highest and lowest incidence of virus infections among the surveyed provinces occurred in Kerman (93.2%) and Ardabil (56.7%), respectively. Overall, 25.0 and 50.2% of the collected potato samples had single or mixed infections, respectively. High levels of mixed infections were found between PVX and PVS (8.6%), and PVX and PVY (7.6%). Moreover, co-infection of samples with PVS and PVY, PVA and PVS, and PVA and PVY, the aphid-vectored virus/virus combinations, occurred at the highest incidence in almost all provinces surveyed, 15.3, 13.8, and 12.8%, respectively. In this study, Beet curly top virus was detected in symptomatic potato samples collected from some fields in the Kermanshah province.

First report of Eggplant mottled dwarf virus in potato and tomato in Slovenia

In June 2004, potato plants of cvs Bistra, Desiree, Discovery, KIS94-1/514 and P s ata, showing unusual virus-like symptoms, were observed in a field in central Slovenia. Crops from different parts of the country were planted in this field to compare the frequency of virus infections. The symptoms were observed only on potatoes originating from Raki c an in northeastern Slovenia. Affected plants showed severe dwarfing, leafcurling and reduced leaf size; tubers were very small and few in number. Brown spots were clearly visible in cross-sections of tubers. Sap from plants with symptoms was used for mechanical inoculation of test plants. Local and systemic symptoms were observed on Nicotiana benthamiana , N. clevelandii , N. glutinosa , N. rustica , N. tabacum , but only local lesions occurred on Datura stramonium . No symptoms were observed on Chenopodium quinoa . Electron microscopy of negatively stained crude extracts from N. benthamiana , N. clevelandii and N. tabacum with symptoms revealed numerous rhabdovirus-like particles. During the previous summer, tomato plants cv. Belle, showing unusual symptoms of distinct chlorotic spots, wrinkles on fruits and narrow, necrotic leaves, were observed in northeastern Slovenia, about 16 km from Raki c an. Infected plants also showed size reduction, curling of mature leaves, yellowing and chlorosis along the margins of younger leaves. Electron microscopy of negatively stained crude extracts revealed rhabdovirus-like particles. Three weeks after mechanical inoculation with extracts from leaves from affected plants, systemic yellowing of veins and leaf curling was observed on N . tabacum cv. White Burley, and necrotic spots, starting on the bases of the leaves, on N . clevelandii . These symptoms resembled those of potato isolate. Electron microscopy of crude sap extracts again revealed rhabdovirus-like particles . DAS-ELISA was used for confirmation of rhabdovirus infection of potato, tomato and affected plants of N. rustica inoculated with potato sap and N. tabacum cv. White Burley inoculated with tomato sap. Antisera against Eggplant mottled dwarf virus (EMDV) and Potato yellow dwarf virus (PYDV) were kindly supplied by Dr S. Winter, DSMZ, Braunschweig, Germany, and ELISA results confirmed that tested plants were infected with EMDV. No infections with PYDV were found. Although EMDV is widespread in the Mediterranean region and the Middle East (Brunt et al ., 1996), and has recently been reported in mainland Spain (Aramburu et al ., 2006), this is the first report of EMDV in Slovenia.

First report of Eggplant mottled dwarf virus in mainland Spain

First report of <i>Eggplant mottled dwarf virus</i> in mainland Spain

A survey of tobacco viruses in tobacco crops and native flora in Greece

The most important tobacco producing areas in Greece were surveyed for virus presence, from 1997 to 2000. Tobacco seedlings or plants showing virus-like symptoms were randomly collected from seedbeds or fields, respectively, and tested by ELISA, and/or mechanical inoculation onto indicator plants. Potato virus Y (PVY), Cucumber mosaic virus (CMV) and Tobacco mosaic virus (TMV) were detected in all sampling areas, with TMV mainly found in oriental varieties. Tomato spotted wilt virus (TSWV) consisted a serious endemic virus in Northern Greece (Thrace, Central and Eastern Macedonia), whereas Alfalfa mosaic virus (AMV) was mainly found in regions, where alfalfa was cultivated in the vicinity of tobacco crops. Eggplant mottled dwarf virus (EMDV) was detected in several areas but always in very low incidence (<0.01%). Surveys were also conducted to assess the potential reservoir hosts of PVY, CMV and AMV among weeds collected from highly infected tobacco fields from 1998 to 2000. Among 3450 samples tested for PVY, plants from 17 species in 10 families were found infected. For CMV, 2891 weed samples were tested and 19 species in 12 families were positive. Assays for AMV infection were made on 961 samples and 12 species in 9 families were identified as hosts of this virus.

First Report of Tomato mosaic virus on Hibiscus rosa-sinensis in China.

Hibiscus rosa-sinensis Linn., family Malvaceae, is an attractive horticultural plant originating from China. Five viruses infecting H. rosa-sinensis that have been characterized previously are Hibiscus chlorotic ringspot virus (HCRSV, genus Carmovirus), Hibiscus latent ringspot virus (HLRSV, genus Nepovirus), Hibiscus yellow mosaic virus (genus Tobamovirus), Eggplant mottled dwarf virus (EMDV, genus Nucleorhabdovirus), and Okra mosaic virus (OkMV, genus Tymovirus) (2). Recently, two novel tobamoviruses infecting H. rosa-sinensis were characterized in Singapore and Florida (1). In this study, viral symptoms were observed on H. rosa-sinensis in Nanyang City in Henan Province, China. The systemic symptoms included dark and light green mosaic in young leaves, leaf puckering and malformation on older leaves, and significant stunting. Rod-shaped virus particles were isolated from H. rosa-sinensis expressing systemic symptoms. The virus was transmitted mechanically to 10 species from three families. Symptoms expressed on these plants included systemic leaf chlorosis and distortion on Lycopersicum esculentum, systemic mosaic on Capsicum annuum, Nicotiana tabacum, and Physalis floridana, and systemic chlorosis on Glycine max. N. tabacum-Xanthi nc and Datura stramonium were asymptomatic. The virus also produced chlorotic and necrotic local lesions on Chenopodium quinoa, C. amaranticolor, and C. murale. The virus was propagated in L. esculentum, N. tabacum, and P. floridana. Virions purified from systemically infected N. tabacum contained a single-stranded RNA of approximately 6.4 kb and a coat protein (CP) of approximately 17.6 kDa. The double-stranded RNA profile revealed a single band of approximately 6.4 kb. Sap extracted from virus-infected plants reacted positive with an antiserum prepared against Tobacco mosaic virus (TMV) using an antigen-coated plate enzyme-linked immunosorbent assay. The CP gene was amplified by reverse transcription-polymerase chain reaction with primers specific to Tomato mosaic virus (ToMV) and sequence data obtained from the resulting amplification product. The CP gene consisting of 159 amino acids (GenBank Accession No. AY313136) shared 99.37% identity with the ToMV Queensland isolate (GenBank Accession No. AF332868). On the basis of biology, serology, properties of virions, and the sequence of the CP gene, we conclude that the virus isolated from H. rosa-sinensis in China is Tomato mosaic virus(ToMV).

Vector Transmission of Eggplant Mottled Dwarf Virus in Iran

Abstract Eggplant mottled dwarf virus (EMDV) is a plant rhabdovirus whose natural means of transmission has remained unknown. In the present study various arthropods including two mite, one psyllid, one thrips, five aphid, four planthopper and 14 leafhopper species were examined for their competence to vector EMDV. Healthy eggplant seedlings were inoculated by arthropods either from naturally infested EMDV infected plants or after having access to source plants and subsequent incubation on rearing host. Transmission was achieved only by the agallian leafhopper Agallia vorobjevi. Symptoms began to appear 20 days after inoculation. Viruliferous leafhoppers were also captured in the field. Symptomatic plants and vector leafhoppers reacted positively with EMDV antiserum in enzyme linked immunosorbent assay. This is the first report on the identification of EMDV vector in Iran.

First report of Eggplant mottled dwarf virus in cucumber and pepper in Bulgaria

First report of <i>Eggplant mottled dwarf virus</i> in cucumber and pepper in Bulgaria

Occurrence of Eggplant Mottled Dwarf Virus in Jordan

Abstract A virus isolated from stunted eggplant (Solanum melanogena L.) with severe vein yellowing, was identified as a strain of eggplant mottled dwarf rhabdovirus (EMDV‐J) on the basis of host range, transmissibility and serology.The isolate is seemingly a unique strain of eggplant mottled dwarf virus that differs from the reported strains in the host range.The virus was recovered from Withania somnifera, a perennial plant, which suggests the availability of a virus reservoir at times when the Jordan valley is practically free from cultivated eggplants.

Eggplant Mottled Dwarf Virus in Potato in Iran

A previously unrecorded disease of potatoes in west-central Iran, characterized by severe stunting, chlorosis, apical necrosis, and wilting, was found to be due to infection by a mechanically transmissible tuber-borne plant rhabdovirus. The virus had bullet-shaped particles measuring 76×190 nm in leaf-dip preparations and was biologically and serologically similar to previously described isolates of eggplant mottled dwarf virus (EMDV). This is the first report of natural occurrence of EMDV in potato

Further Studies on Cynara Rhabdovirus

AbstractCynara rhabdovirus (CyRV) was isolated from symptomless artichoke plants in southern Italy using Nicotiana langsdorffii as susceptible host and immune serum to artichoke latent virus to eliminate this virus from inoculum. CyRV can infect several solanaceous species, has thermal inactivation point of 40‐45°C, dilution end point between 10−2 and 10−5 and longevity in vitro at 4 and 20°C of 4‐5 days and 6‐24 h, respectively. It was purified and used for preparing antisera with homologous titre varying from 1: 16 to 1: 64. In decoration tests, the virus did not react against antisera to eggplant mottled dwarf virus (EMDV) and its antiserum did not decorate ivy vein clearing virus (IVCV). Ultrastructural aspects of CyRV infection in Datura stramonium and Nicotiana glutinosa were very like those described for the same virus in the past except for presence of longer virions which were often encountered in infected cells during this study.

Comparison of Three Plant Rhabdovirus Isolates by Two Different Serological Techniques

AbstractThree different rhabdovirus isolates, eggplant mottled dwarf virus (EMDV), tomato veinyellowing virus (TVYV) and a hitherto undefined isolate from tomato in Portugal (Tom‐P) were compared by two different serological techniques, immunosorbent electron microscopy (ISEM) and electro‐blot‐immunoassay (EBIA). Antisera were prepared either against purified virus or against partially purified virus preparations extracted by a one‐step procedure. Even the partially purified virus preparations yielded antisera that allowed unequivocal identification of two of the five structural virus proteins, G and N, in EBIA and were suitable for specific trapping of complete virus particles on electron microscope grids.With both serological techniques identical results were obtained indicating a close serological relationship between the three isolates tested. Cross‐reactions between the G proteins could be deduced from heterologous trapping of complete virus particles in ISEM. The cross‐reactions for the G proteins were substantiated by the EBIA‐results which indicated in addition cross‐reactions between the remaining three major structural virus proteins, N, M1, and M2, but also revealed significant differences in the molecular weights of the G and M1 proteins between TVYV and the other two isolates. The results obtained indicate that Tom‐P is serologically closely related and in respect of protein molecular weights identical to EMDV, and that TVYV is not a separate virus but rather a strain of EMDV.

Lectins as probes for the assay of rhabdovirus infections in plants

Thirteen different, biotinylated plant lectins were tested for their ability to recognize specifically the glycoproteins of the two different plant rhabdoviruses potato yellow dwarf virus and eggplant mottled dwarf virus. All viruses were propagated on the same plant host species, Nicotiana rustica L. The lectin-binding to the viral proteins was tested after electrophoretic separation and transfer to nitrocellulose membranes. Besides purified virus also partially pure virus preparations were used for the tests, in order to determine the specificity. The lectins had been selected for specificities to either one of the following monosaccharides: mannose, glucose, galactose, N-acetyl- d-galactosamine, N-acetyl- d-glucosamine and fucose. In the test panel of thirteen lectins, seven were found to react with the viral glycoproteins. Among these, four (LCA, VFA, PSA, Con A) belonged to the mannosyl- or glycosyl-specific group. However, these four lectins reacted also with other host proteins when partially pure virus preparations were used as samples. The other three lectins (GSA 2b, STA, WGA) were specific for N-acetyl- d-glucosamine and detected almost exclusively the viral glycoproteins. Two of these lectins, STA and WGA, were extremely suitable for virus-specific assays, since they did not react with glycoproteins in healthy controls that were identical or comparable in their electrophoretic mobility with the rhabdovirus glycoproteins. No binding to viral glycoproteins was observed with galactose-, N-acetyl-galactosamine- and fucose-specific lectins. The assay for rhabdovirus glycoproteins in plants with the lectins was approximately 8–16 times less sensitive than with virus-specific antibodies.