East Asian Passiflora Virus Research Articles

First report of Gulupa baciliform virus A associated with passion fruit in China.

Passion fruit (Passiflora edulis) is a commercially important crop known for its nutritional value, high antioxidant content, and use in beverages and desserts. Gulupa baciliform virus A (GBVA), tentatively named Badnavirus in the family Caulimoviridae, is a cryptic circular double-stranded DNA (dsDNA, ≈6,951 bps) virus recently reported in Colombia with asymptomatic infection of passion fruit (Sepúlveda et al. 2022). In July 2024, viral-like symptoms, including vein clearing, mottling, leaf distortion, and yellowing, were observed on passion fruit leaves in Pingtang, Guizhou, China (Supplementary figure S1), with a 30% incidence rate, and 30 samples were collected. Total RNA was extracted from these samples using TRIzol reagent (Invitrogen, CA, USA). The intact RNA from the two pools (each consisting of 14 samples) was subjected to library construction using TruseqTM Small RNA sample prep Kit (Illumina) followed by Hiseq sequencing (Hiseq2000 Truseq SBS Kit v3-HS, Illumina platform) to complete the sRNA sequencing. Approximately 12,923,899 and 10,877,466 raw while 10,135,256 and 4,184,706 clean reads were obtained for the samples in pool A and pool B, respectively. Next, the de novo assembly was carried out using metaSPAdes (Nurk et al., 2017) which resulted in 4,770 virus related trimmed contigs with the maximum length of 883 bp. BLASTn searches of sequence contigs against the NCBI viral genome database confirmed the presence of telosma mosaic virus (TEMV, Hanoi isolate, accession No. NC_009742, >96.0% nucleotide identity), East Asian passiflora virus (EAPV, Taiwan isolate, accession No. KP114137, >97.5% nucleotide identity), and papaya leaf curl Guangdong virus (PaLCuGdV, Fujian isolate, accession No. FJ495184, >98.0% nucleotide identity). Interestingly, more than 70 sequence contigs revealed >98.7% nucleotide identity with the GBVA Colombia isolate (accession No. MW393828). Whereas, the overall similarity of newly identified GBVA Guizhou isolate was calculated to be more than 99% with corresponding sequences in NCBI database. Moreover, out of 4,770 trimmed contigs, the mapping of 241 contigs to the reference genome sequence (accession No. MW393828) using Geneious R9 further confirmed the presence of GBVA. To validate the Hiseq sequencing results, total RNA was extracted from the same samples used for high throughput sequence (HTS) analysis, and reverse-transcription polymerase chain reaction (RT-PCR) was performed using specific primers (GBVA-P2-F1: 5´-ATGAATTGGAAATCAACYGTAG-3´/GBVA-P2-R1: 5´-TTCTTCTCGAGGCGTCTCTT-3´) targeting the p2 protein region of the reference genome (accession No. MW393828) (Sepúlveda et al. 2022). Amplicon of expected size of 408bp was subjected to Sanger sequencing, and the resulted sequence (GBVA, Guizhou isolate) was submitted to GenBank (accession No. PQ240853). Multiple sequence alignment was executed based on the p2 protein sequence of GBVA in MEGA X with the ClustalW program. Subsequently, the phylogenetic tree was constructed employing the maximum likelihood method (Supplementary figure S1) (Kumar et al. 2018). Phylogenetic analysis showed that the newly identified isolate has highest similarity with the corresponding isolates from Colombia, indicating the close origin of Colombian and Chinese isolates. To our knowledge, this is the first report of GBVA associated with passion fruit in China, which indicates that further research into it's exact symptom expression may be warranted for global passion fruit production.

The Generation of Attenuated Mutants of East Asian Passiflora Virus via Deletion and Mutation in the N-Terminal Region of the HC-Pro Gene for Control through Cross-Protection.

East Asian Passiflora virus (EAPV) causes passionfruit woodiness disease, a major threat limiting passionfruit production in eastern Asia, including Taiwan and Vietnam. In this study, an infectious cDNA clone of a Taiwanese severe isolate EAPV-TW was tagged with a green fluorescent protein (GFP) reporter to monitor the virus in plants. Nicotiana benthamiana and yellow passionfruit plants inoculated with the construct showed typical symptoms of EAPV-TW. Based on our previous studies on pathogenicity determinants of potyviral HC-Pros, a deletion of six amino acids (d6) alone and its association with a point mutation (F8I, simplified as I8) were conducted in the N-terminal region of the HC-Pro gene of EAPV-TW to generate mutants of EAPV-d6 and EAPV-d6I8, respectively. The mutant EAPV-d6I8 caused infection without conspicuous symptoms in N. benthamiana and yellow passionfruit plants, while EAPV-d6 still induced slight leaf mottling. EAPV-d6I8 was stable after six passages under greenhouse conditions and displayed a zigzag pattern of virus accumulation, typical of a beneficial protective virus. The cross-protection effectiveness of EAPV-d6I8 was evaluated in both N. benthamiana and yellow passionfruit plants under greenhouse conditions. EAPV-d6I8 conferred complete cross-protection (100%) against the wild-type EAPV-TW-GFP in both N. benthamiana and yellow passionfruit plants, as verified by no severe symptoms, no fluorescent signals, and PCR-negative status for GFP. Furthermore, EAPV-d6I8 also provided complete protection against Vietnam's severe strain EAPV-GL1 in yellow passionfruit plants. Our results indicate that the attenuated mutant EAPV-d6I8 has great potential to control EAPV in Taiwan and Vietnam via cross-protection.

First Report of Passiflora latent virus in Passion fruit (Passiflora edulis) in China.

Passion fruit (Passilora edulis, family Passifloraceae.) is an economically important fruit crop in many tropical and subtropical regions worldwide. It is widely planting in southern China, and in greenhouses throughout the country. In Mar 2022, symptoms of a viral-like infection were observed on the leaves of passion fruit plants in a 3-hectare greenhouse complex in Hohhot, China. Chlorotic lesions were observed on leaves of two vines of passion fruit and symptomatic leaves developed chlorotic spots, followed by systemic leaf chlorosis and necrosis. Dark ringed spots emerged on the surface of matured fruits (Figure 1). To confirm infectivity, mechanical transmission of the virus was performed by grinding leaves from two symptomatic passion fruit vines in 0.1M phosphate buffer pH 7, and the resulting two samples were each used to rub-inoculate carborundum-dusted leaves of three healthy passion fruit seedlings. Newly emerging leaves of inoculated plants developed mild mosaic symptoms 30-days after inoculation. Three samples from each of the two original symptomatic plants and two samples from each inoculated seedling tested positive using a Passiflora latent virus (PLV) ELISA Kit (Creative Diagnostics, USA). To further confirm the virus identity, total RNA from leaf samples from one of the original greenhouse symptomatic plants and one of the inoculated seedlings were extracted using an TaKaRa MiniBEST Viral RNA Extraction Kit (Takara, Japan). The two RNA samples were subjected to reverse transcription-polymerase chain reaction (RT-PCR) tests with virus specific primers PLV-F (5'-ACACAAAACTGCGTGTTGGA-3') and PLV-R (5'-CAAGACCCACCTACCTCAGTGTG-3') (Cho et al., 2020). RT-PCR products of the expected 571 bp were obtained from both the original greenhouse sample and inoculated seedling. Amplicons were cloned into the pGEM-T Easy Vector, and two clones per sample were Sanger sequenced bidirectionally (Sangon Biotech, China), and the sequence of one clone from one of the original symptomatic sample was uploaded to NCBI (GenBank OP320922.1). This accession had 98% nucleotide sequence identity with a PLV isolate from Korea (GenBank: LC556232.1). RNA extracts from two asymptomatic samples tested negative for PLV with both ELISA and RT-PCR tests. We also tested the original symptomatic sample for common occurring passion fruit viruses, including passion fruit woodiness virus (PWV), cucumber mosaic virus (CMV), east asian passiflora virus (EAPV), telosma mosaic virus (TeMV), papaya leaf curl Guangdong virus (PaLCuGdV), and the RT-PCR results were negative for those viruses. However, based on the systemic leaf chlorosis and necrosis symptoms, we cannot preclude a mixed infestation of other viruses. PLV affects fruit quality and has high potential to reduce market value. To our knowledge, this is the first report of PLV in China, which could provide a reference basis to PLV identification, prevention and control. Acknowledgments This research was carried out with the support of Inner Mongolia Normal University High-level Talents Scientific Research Startup Project (Grant no. 2020YJRC010). Supplementary material Figure 1. Mottle, leaf distortion, puckering symptoms on old leaf (A), mild puckering symptom on young leaf (B), and ring-striped spots symptoms on fruit (C) of the PLV infected passion fruit plant in China.

First Report of Passiflora Latent Virus Infecting Passion Fruit (Passiflora edulis) in South Korea.

Passion fruit (Passiflora edulis) viral diseases caused by papaya leaf curl Guangdong virus, cucumber mosaic virus, East Asian Passiflora virus, and euphorbia leaf curl virus have been reported in South Korea (Joa et al. 2018; Kim et al. 2018). In June 2021, virus-like symptoms, e.g., mosaic pattern, curling, chlorosis, and deformation, were observed on leaves and fruits of greenhouse-grown P. edulis in Iksan, South Korea, with disease incidence greater than 2% (300 plants: 8 symptomatic plants and 292 asymptomatic plants). Total RNA was extracted from a pooled sample of symptomatic leaves of an individual P. edulis plant using the RNeasy Plant Mini Kit (Qiagen, Germany), and a transcriptome library was generated using the TruSeq Stranded Total RNA LT Sample Prep Kit (Illumina, San Diego, CA). Next-Generation Sequencing (NGS) was performed using the Illumina NovaSeq 6000 system (Macrogen Inc., Korea). De novo assembly of the resulting 121,154,740 reads was performed using Trinity (Grabherr et al. 2011). A total of 70,895 contigs was assembled (>200 bp) and annotated against the NCBI viral genome database using BLASTn (ver. 2.12.0). One 827-nt contig was annotated as milk vetch dwarf virus (MVDV), a member of the genus Nanovirus in the family Nanoviridae (Bangladesh isolate, acc. no. LC094159, 96.0% nucleotide identity), and the other 3,639-nt contig corresponded to Passiflora latent virus (PLV), a member of the genus Carlavirus in the family Betaflexiviridae (Israel isolate, acc. no. DQ455582, 90.0% nucleotide identity). For further confirmation, total RNA was isolated from symptomatic leaves of the same P. edulis used for NGS analysis using a viral gene spin DNA/RNA extraction kit (iNtRON Biotechnology, Seongnam, Korea), and reverse transcription polymerase chain reaction (RT-PCR) was performed using specific primers: PLV-F/R (5'-GTGCCCACCGAACATGTTACCTC-3'/5'-CCATGCACTTGGAATGCTTACCC-3') targeting the coat protein region of PLV, MVDV-M-F/R (5'-CTAGTCAGCCATCCAATGGTG-3'/5'-GTGCAGGGTTTGATTGTCTGC-3') targeting the movement protein region, and MVDV-S-F/R (5'-GGATTTTAATACGCGTGGACGATC-3'/5'-AACGGCTATAAGTCACTCCGTAC-3') targeting the coat protein region of MVDV. An expected PCR product of 518 bp corresponding to PLV was amplified, while MVDV was not detected. The amplicon was directly sequenced, and its nucleotide sequence was deposited in GenBank (acc. no. OK274270). A BLASTn analysis showed that the nucleotide sequence of the PCR product shared 93.0% and 96.2% identity with PLV isolates from Israel (MH379331) and Germany (MT723990), respectively. In addition, six passion fruit leaves and two fruit samples with PLV-like symptoms were collected from a total of eight plants grown in the greenhouse in Iksan for RT-PCR analysis, and six samples tested positive for PLV. However, PLV was not detected in one leaf and one fruit among all samples. Mechanical sap inoculation was conducted using extracts of systemic leaves as inoculum on P. edulis and the indicator plants Chenopodium quinoa, Nicotiana benthamiana, N. glutinosa, and N. tabacum. In P. edulis, vein chlorosis and yellowing on systemic leaves were observed 20 days post inoculation (dpi). Necrotic local lesions were observed on inoculated leaves of N. benthamiana and N. glutinosa 15 dpi, and PLV infection was confirmed by RT-PCR assay in symptomatic leaf tissue. This study aimed to determine whether commercially grown passion fruit in the southern part of South Korea could be infected with and potentially spread PLV. Whereas PLV was asymptomatic in persimmon (Diospyros kaki) in South Korea, no pathogenicity testing in passion fruit was reported (Cho et al. 2021). Here, we have shown the natural infection of passion fruit with PLV in South Korea for the first time and associated infection with obvious symptoms. This suggests a need to evaluate potential losses in passion fruit and the selection of healthy propagation material.

Occurrence and Distribution of Major Viruses Infecting Passion Fruit in Guizhou Province, China, and Molecular Characterization of Two Potyviruses.

The planting of passion fruit (Passiflora edulis) in the Guizhou Province has gradually increased, and the area under cultivation ranks third in China. However, the cultivation and production of passion fruit is severely affected by viral diseases. In 2021 and 2022, we investigated the occurrence of multiple viral diseases in major cultivation areas and identified the main viruses and conducted field surveys in different growing areas of passion fruit in the Guizhou Province, China. A total of 308 samples were randomly collected from 10 different passion fruit cultivation areas, and seven viral diseases were identified using electron microscopy, small RNA sequencing, and reverse transcription-polymerase chain reaction (RT-PCR). Among them, the infection rate of Telosma mosaic virus (TeMV) was the highest (50%), followed by East Asian Passiflora virus (EAPV) (19%), and Cucumber mosaic virus (CMV) (15%). The detection rates of the other four viruses were lower: Passiflora latent virus (PLV) (1%), Turnip mosaic virus (TuMV) (0.6%), Passiflora virus Y (PaVY) (0.3%), and Euphorbia leaf curl virus (ELCV) (6%). In addition, high rates of mixed TeMV + CMV + EAPV infections were found in the province. Notably, 79% of EAPV-infected plants were also infected with TeMV. Finally, the molecular characteristics of the two highly detected potyviruses, TeMV and EAPV, were analyzed. To our knowledge, this study is the first systematic survey of viral diseases of passion fruit in the Guizhou Province, China.

Generation of Attenuated Mutants of East Asian Passiflora Virus for Disease Management by Cross Protection.

East Asian passiflora virus (EAPV) seriously affects passionfruit production in Taiwan and Vietnam. In this study, an infectious clone of the EAPV Taiwan strain (EAPV-TW) was constructed, and EAPV-TWnss, with an nss tag attached to its helper component-protease (HC-Pro), was generated for monitoring the virus. Four conserved motifs of EAPV-TW HC-Pro were manipulated to create single mutations of F8I (simplified as I8), R181I (I181), F206L (L206), and E397N (N397) and double mutations of I8I181, I8L206, I8N397, I181L206, I181N397, and L206N397. Four mutants, EAPV I8I181, I8N397, I181L206, and I181N397, infected Nicotiana benthamiana and yellow passionfruit plants without conspicuous symptoms. Mutants EAPV I181N397 and I8N397 were stable after six passages in yellow passionfruit plants and expressed a zigzag pattern of accumulation dynamic, typical of beneficial protective viruses. An agroinfiltration assay indicated that the RNA silencing suppression capabilities of the four double mutated HC-Pros are significantly reduced. Mutant EAPV I181N397 accumulated the highest level of the small interfering RNA at 10 days postinoculation (dpi) in N. benthamiana plants, then dropped to background levels after 15 dpi. In both N. benthamiana and yellow passionfruit plants, EAPV I181N397 conferred complete cross protection (100%) against severe EAPV-TWnss, as defined by no severe symptoms and absence of the challenge virus, checked by Western blotting and reverse transcription PCR. Mutant EAPV I8N397 provided high degrees of complete protection against EAPV-TWnss in yellow passionfruit plants (90%) but not in N. benthamiana plants (0%). Both mutants showed complete protection (100%) against the Vietnam severe strain EAPV-GL1 in passionfruit plants. Thus, the mutants EAPV I181N397 and I8N397 have excellent potential for controlling EAPV in Taiwan and Vietnam. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Simultaneous detection and differentiation of four viruses in passion fruit plants by a multiplex RT-PCR

A multiplex reverse transcription polymerase chain reaction (multiplex RT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect passion fruit, citrus-associated rhabdovirus (CiaRV), East Asian Passiflora virus (EAPV), Passiflora latent virus (PLV), and Telosma mosaic virus (TeMV). The optimized parameters included the primer concentration, annealing temperature, extension time, and number of cycles. The established multiplex RT-PCR assay produced the corresponding products with sizes of 597 bp, 529 bp, 320 bp, and 235 bp, which were specific for CiaRV, EAPV, PLV, and TeMV, respectively. The fragments could be distinguished clearly by agarose gel electrophoresis. The detection limit of the assay was 100 pg of total RNA for CiaRV and EAPV, 10 pg of total RNA for PLV, and 1.0 ng of total RNA for TeMV. The multiplex RT-PCR assay was also tested using field samples, and the results showed that the developed assay could detect the viruses in single or multiple infections of passion fruit. The multiplex RT-PCR established here will be quite helpful for the diagnosis of passion fruit infected with various combinations of the four viruses in the field.

East Asian Passiflora virus

This datasheet on East Asian Passiflora virus covers Identity, Overview, Distribution, Dispersal, Hosts/Species Affected, Vectors & Intermediate Hosts, Diagnosis, Biology & Ecology, Environmental Requirements, Seedborne Aspects, Natural Enemies, Impacts, Prevention/Control, Further Information.

Effects of coinfection with East Asian Passiflora virus and East Asian Passiflora distortion virus on Passiflora foetida

East Asian Passiflora virus (EAPV) and East Asian Passiflora distortion virus (EAPDV), members of the potyvirus genus, infect passionfruit (Passiflora edulis × P. edulis f. flavicarpa). We found EAPV and EAPDV coinfecting passionfruit in Okinawa Prefecture, Japan and here investigated the effects of coinfection with those viruses on P. foetida, a wild passionfruit. Coinfection with EAPV and EAPDV resulted in different symptoms and viral titers in P. foetida. Mixed inoculation (EAPV + EAPDV) and inoculation with EAPV and 6 days later with EAPDV (EAPV → EAPDV) caused the most severe leaf symptoms at 28 dpi, whereas inoculation with EAPDV then EAPV (EAPDV → EAPV) induced milder symptoms. Single infection with EAPDV caused the mildest symptoms. Quantitative analysis revealed that the log10 of EAPDV titer in EAPDV → EAPV, EAPV → EAPDV, and D + A, was 1.85-, 1.52-, and 1.56-fold higher, respectively, than after a single infection with EAPDV. EAPV titer was always lower than the EAPDV titer. In short, EAPV induced EAPDV propagation, and P. foetida is a potential reservoir for EAPV and EAPDV.

First Report of Cucurbit Aphid-Borne Yellows Virus in Passion Fruit Plants Exhibiting Mosaic and Mottling in China

First Report of Cucurbit Aphid-Borne Yellows Virus in Passion Fruit Plants Exhibiting Mosaic and Mottling in China

East Asian Passiflora distortion virus: a novel potyvirus species causing deformation of passionfruits in Japan

Viruses assumed to belong to a new Potyvirus were detected in passionfruit plants with foliar mosaic, leaf curl and fruit malformation that were collected from Akita City, Akita Prefecture in 2013, Nago City, Okinawa Prefecture in 2014, and Satsuma Town and Yoron Island, Kagoshima Prefecture in 2015. The isolates of this virus species were not detected by ELISA and RT-PCR targeting East Asian Passiflora virus (EAPV)-AO (Amami Oshima strain), which induces woodiness disease of passionfruit in Japan. The isolates were designated PV-AK (Akita), PV-OK (Okinawa), PV-YO (Yoron), and PV-SA (Satsuma). In a host-range test of 13 cultivars of French bean, four were systemically infected with the PV isolates and two with EAPV-AO. Cowpea cv. Kurodane sanjaku was systemically infected with PV isolates and induced mosaic symptoms on non-inoculated leaves distant from the inoculated leaves but was immune to EAPV-AO. The complete genomic sequences of the PV isolates consisted of 9973 nucleotides (nt) excluding the poly(A) tail, and encoded 3217 amino acids of polyprotein, flanked by 129–130 nt of the 5′-noncoding region and 193 nt of the 3′-noncoding region. Whole-genome nucleotide and amino acid sequences indicated that they belong to identical species. The potyvirus with the highest whole-genome nucleotide identity to the PV isolates is watermelon mosaic virus, which shares 68.1% identity, versus 65.3% for EAPV-AO. On the basis of ICTV-naming regulations, these PV isolates belong to a new species in the Potyvirus genus, but are distantly related to EAPV. Here, we propose East Asian Passiflora distortion virus as the new species name.

The virus causing passionfruit woodiness disease in Taiwan is reclassified as East Asian passiflora virus

Based on filamentous particles, aphid transmission, and symptoms of distorted, size-reduced, woody fruits, the major potyvirus associated with passionfruit woodiness disease (PWD) in Taiwan has been regarded as Passionfruit woodiness virus (PWV) for decades. In this study, the genomes of four potyvirus isolates, originally collected from orchards with PWD in Taiwan and re-designated as Poty-TW, Poty-0920-6, Poty-dpd and Poty-pt, were sequenced for molecular characterization. Our results revealed that the CP genes of Poty-TW and Poty-0920-6 share nucleotide (nt) identities/amino acid (aa) identities of 97.7/95.9 and 98.5/97.2%, respectively, with that of East Asian passiflora virus (EAPV) isolate AO of Japan, and the CP genes of Poty-dpd and Poty-pt share nt/aa identities of 95.3/96.2 and 94.9/97.6% respectively, with that of EAPV isolate IB of Japan. The genomic sequences of PWD-associate viruses in Taiwan also share high degrees of homology with that of EAPV-AO (TW and 0920-6 isolates > 98%) and EAPV-IB (dpd and pt isolates > 88%). However, the CP genes of four PWD-associated viruses from Taiwan share only 67.6–69.4% nt identities with that of PWV Australia MU isolate, does not satisfy the ICTV criteria (> 76%) to be regarded as a strain of PWV. A field survey with 175 samples from different areas of Taiwan demonstrated that the PWD-associated potyvirus is mainly caused by EAPV. Hence, our results indicate that the major potyvirus causing PWD in Taiwan should be reclassified as EAPV.

Population genetics analysis of East Asian Passiflora virus on Amami Oshima Island

East Asian Passiflora virus (EAPV) is a member of the genus Potyvirus in the family Potyviridae. In this study, we collected 15 isolates of EAPV from two different areas (the Yuwan area of Uken village and the Sumiyo town of Amami city) on Amami Oshima Island, Japan. The sequences of polyproteins from 10 isolates and the NIb and CP regions of five isolates were determined. The nucleotide and amino acid sequence identities of polyproteins within each population were very high, and those between isolates from both areas were also high. However, five characteristic nonsynonymous substitutions were uniformly observed in the P3 and CP regions of Sumiyo isolates. Recombination analysis revealed that there was no evidence of recombination in any of the isolates from Amami Oshima Island. The selection pressure analysis showed that as a whole, the EAPVs of both populations underwent negative selection but the extent of the negative selection varied. These results were supported by a neutrality test. The gene differentiation and gene flow analysis suggested that the Sumiyo and Yuwan populations were differentiated clearly and gene flow occurred only infrequently. These results were supported by phylogenetic analysis. It was concluded that the two populations evolved independently in each respective area.

First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan.

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) 'Tainung No. 1' is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5'TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3'/5'CGCAGTTT CTGGAGGATATTAAG3'/5'TCGCATGCCACTTCCTCAGT3') were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia.

First Report of Passiflora virus Y Infecting Macroptilium atropurpureum in Taiwan.

Macroptilium atropurpureum (siratro plants) is a perennial wild legume plant introduced to Taiwan as a forage crop in 1961 (3) and has become a naturalized weed found all over the island. In 2010, siratro plants with virus-like symptoms of mosaic and leaf deformation were observed on the campus of Da-Yeh University in central Taiwan. Flexuous virus-like particles about 750 × 12 nm were observed in the crude sap extracted from symptomatic leaves with a transmission electron microscope. Crude sap was mechanically inoculated to Chenopodium quinoa and local lesions can be observed on inoculated leaves 4 to 5 days after inoculation. Virus was purified from the leaves of inoculated C. quinoa with modified protocols of Gonsalves and Ishii (2). The virus coat protein (CP) consisted of a single major peptide with relative molecular weight of approximately 33 kDa when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Viral RNA extracted from the purified virus was used as a template and was primed with several primer sets corresponding to potyviruses and carlaviruses in reverse transcription-PCR to amplify possible corresponding cDNA fragments. After several attempts, a cDNA fragment of about 1,300 bp could be amplified with the degenerated primer set of BCMNV-F (5'CCDTGGACDGTWGGVATGAC3') and BCMNV-R (5'CACCAHACCATRAARCCATTCAT3'), which were designed on the basis of the conserved region of the nuclear inclusion b (NIb) and CP genes of some potyviruses including Bean common mosaic necrosis virus, Soybean mosaic virus, Blackeye cowpea mosaic virus, East Asian passiflora virus, and Passion fruit woodiness virus. BLAST analyses showed the amplicon was highly homologous to that of Passiflora virus Y (PaVY). Together with oligo dT, a specific primer (5'GATGACACTCAAATGGCTG3') corresponding to PaVY CP was used to amplify the cDNA fragment of the most 3' region of the viral RNA (about 800 bp). The assembled cDNA fragment of 1,958 bp (Accession No. AB679294) contains a partial NIb gene (877 nt), a complete CP gene (819 nt), and the 3' noncoding region (262 nt). The CP gene shared sequence identities of 89.4 to 98.9% and 92.7 to 98.9% in nucleotide and amino acid, respectively, to that of documented PaVY isolates. PaVY has also been found to be infecting Vigna trilobata, Rhynchosia minima, Clitoria ternatea, and Passiflora foetida in Australia (1). Here we present the first report to our knowledge of PaVY and its infection of siratro (M. atropurpureum) in Taiwan. Additional work is needed to investigate the spread of PaVY and its interaction with other legume plants in Taiwan.

Genetic Structure and Variability of East Asian Passiflora virus Population in Amami‐O‐shima, Japan

AbstractOur previous study showed that the East Asian Passiflora virus (EAPV) population emerging in Amami‐O‐shima, Kagoshima prefecture, Japan, consisted only of isolates of the AO strain by RT‐PCR screening using strain‐specific primers. To evaluate the results and gain insights into the evolutionary mechanisms of EAPV, the coat protein (CP) nucleotide (nt) sequences of 17 isolates collected from four different regions (Tatsugo, Uken, Sumiyo and Setouchi) in Amami‐O‐shima and polyprotein‐encoding sequences of 8 isolates of them were determined. The nt sequence identities of resultant CP‐ and polyprotein‐encoding sequences against the type isolate of the AO strain were >98.5 and >98.8%, respectively, confirming that all the 17 isolates are of the same genetic group. Estimates of nt diversity showed that the EAPV population in Amami‐O‐shima had low diversity through the genome and all the genes were under negative selection, but the genetic constraints were varied between different protein‐encoding regions. Phylogenetic analyses revealed that EAPV isolates showed a star‐like phyl‐ogeny based on their CP‐encoding regions, and it is suggested that the population in Sumiyo has expanded recently.

Characterization and Distribution of a Potyvirus Associated with Passion Fruit Woodiness Disease in Uganda.

This article describes the incidence and etiology of a viral disease of passion fruit in Uganda. Symptoms, including those characteristic of passion fruit woodiness disease (PWD), were observed on 32% of plants in producing areas. Electron microscopic observations of infected tissues revealed flexuous filaments of ca. 780 nm. Enzymelinked immunosorbent assays indicated a serological relationship with Cowpea aphid-borne mosaic virus (CABMV) and Passion fruit ringspot virus (PFRSV). In host range studies, only species in the families Solanaceae and Chenopodiaceae were susceptible, and neither Vigna unguiculata nor Phaseolus vulgaris became infected. Coat protein (CP) gene sequences of eight isolates exhibited features typical of potyviruses and were highly similar (88 to 100% identity). However, the sequences had limited sequence identity with CP genes of two of the three potyviruses reported to cause PWD: East Asian Passiflora virus and Passion fruit woodiness virus (PWV). Deduced amino acid sequences for the CP of isolates from Uganda had highest identity with Bean common mosaic necrosis virus (BCMNV) (72 to 79%, with evolutionary divergence values between 0.17 and 0.19) and CABMV (73 to 76%, with divergence values between 0.21 and 0.25). Based on these results and in accordance with International Committee for Taxonomy of Viruses criteria for species demarcation in the family Potyviridae, we conclude that a previously unreported virus causes viral diseases on passion fruit in Uganda. The name "Ugandan Passiflora virus" is proposed for this virus.

Molecular characterization and specific detection of two genetically distinguishable strains of East Asian Passiflora virus (EAPV) and their distribution in southern Japan

The Ibusuki (IB) strain of the East Asian Passiflora virus (EAPV) causes mottling of fruit when it infects passionfruit, but not malformation or woodiness, unlike the Amami-O-shima (AO) strain, and the host range for these two strains are different. We determined the complete nucleotide sequence of the IB strain, and a comparison with that of the AO strain revealed the great diversity of the 5'-terminal region of the IB strain's genome (5' UTR and P1 gene). The involvement of these regions in the different symptoms on fruit and host range was suggested. The neighbor-joining tree constructed using the nucleotide sequences of coat protein gene of eight EAPV isolates including those from abroad showed the independent position of the IB strain, and that constructed using the whole ORFs also showed distant relationships between the AO and IB strains. We investigated the distribution of the two strains in southern Japan from 2005 to 2010. The AO strain was detected in the samples from AO at all periods, and its emergence was also observed in the Kagoshima mainland in 2005. In contrast, the IB strain is restricted to the Kagoshima mainland, and the distribution survey revealed that this strain is now extinct even in this region, indicating the uniqueness of the IB strain in terms of sequence properties and geographical distribution.

The potyvirus associated with the dappled fruit of Passiflora edulis in Kagoshima prefecture, Japan is the third strain of the proposed new species East Asian Passiflora virus (EAPV) phylogenetically distinguished from strains of Passion fruit woodiness virus

A potyvirus (isolate IB) causing dappled or faded fruits and foliar mosaic symptoms of purple passionfruit, was found in the botanical garden of Kagoshima University, Japan. This isolate--differed in host range from isolates of Passion fruit woodiness virus (PWV)-AO, previously reported to cause "woodiness" in Japan. Isolates IB and AO had 83% amino acid identity in their coat proteins (CPs). In phylogenetic analysis, East Asian isolates IB, AO, and PWV-Taiwan clustered together, and were distinguishable from Australian PWV and Brazilian Cowpea aphid-borne mosaic virus isolates, which also cause "woodiness" in passionfruit. We propose the name "East Asian Passiflora virus (EAPV)" for the new potyvirus species.

Identification of breakpoints in intergenotypic recombinants of HIV type 1 by bootscanning.

Identification of breakpoints in intergenotypic recombinants of HIV type 1 by bootscanning.