Early Pod Research Articles

Efficacy testing of <italic>in vitro</italic> diazotrophic activity of <italic>Acinetobacter</italic> on the field growth of soybean

Nitrogenase enzyme activity as a measure of nitrogen fixation by <italic>Acinetobacter</italic> genospecies3 A15 was found to be 49.56 μmoles ethylene/96h at 28°C. Efficacy testing of diazotrophic A15 inoculum for growth promotion at field I showed early germination, podding and flowering, increased post harvest parameters, freedom from weeds and diseases but complete absence of nitrogen fixing root nodules. The control plants were infected with mildew, stem rot and blights causing 36% mortality. The average yield of inoculated soybean was 12% over control. At field II, inoculated plants were poorly nodulated without indication of promotion of growth parameters or yield unlike control.

Genome-Wide Analysis and Expression Profiling of the Phospholipase C Gene Family in Soybean (Glycine max).

Phosphatidylinositol-specific phospholipase C (PI-PLC) hydrolyses phosphatidylinositol-4,5-bisphosphate to produce diacylglycerol and inositol 1,4,5-trisphosphate. It plays an important role in plant development and abiotic stress responses. However, systematic analysis and expression profiling of the phospholipase C (PLC) gene family in soybean have not been reported. In this study, 12 putative PLC genes were identified in the soybean genome. Soybean PLCs were found on chromosomes 2, 11, 14 and 18 and encoded 58.8–70.06 kD proteins. Expression pattern analysis by RT-PCR demonstrated that expression of the GmPLCs was induced by PEG, NaCl and saline-alkali treatments in roots and leaves. GmPLC transcripts accumulated specifically in roots after ABA treatment. Furthermore, GmPLC transcripts were analyzed in various tissues. The results showed that GmPLC7 was highly expressed in most tissues, whereas GmPLC12 was expressed in early pods specifically. In addition, subcellular localization analysis was carried out and confirmed that GmPLC10 was localized in the plasma membrane in Nicotiana benthamiana. Our genomic analysis of the soybean PLC family provides an insight into the regulation of abiotic stress responses and development. It also provides a solid foundation for the functional characterization of the soybean PLC gene family.

Genotypic Variation in the Concentration of β-N-Oxalyl-L-α,β-diaminopropionic Acid (β-ODAP) in Grass Pea (Lathyrus sativus L.) Seeds Is Associated with an Accumulation of Leaf and Pod β-ODAP during Vegetative and Reproductive Stages at Three Levels of Water Stress.

Grass pea (Lathyrus sativus L.) cultivation is limited because of the presence in seeds and tissues of the nonprotein amino acid β-N-oxalyl-L-α,β-diaminopropionic acid (β-ODAP), a neurotoxin that can cause lathyrism in humans. Seven grass pea genotypes differing in seed β-ODAP concentration were grown in pots at three levels of water availability to follow changes in the concentration and amount of β-ODAP in leaves and pods and seeds. The concentration and amount of β-ODAP decreased in leaves in early reproductive development and in pods as they matured, while water stress increased β-ODAP concentration in leaves and pods at these stages. The net amount of β-ODAP in leaves and pods at early podding was positively associated with seed β-ODAP concentration at maturity. We conclude that variation among genotypes in seed β-ODAP concentration results from variation in net accumulation of β-ODAP in leaves and pods during vegetative and early reproductive development.

Heat waves imposed during early pod development in soybean (Glycine max) cause significant yield loss despite a rapid recovery from oxidative stress.

Heat waves already have a large impact on crops and are predicted to become more intense and more frequent in the future. In this study, heat waves were imposed on soybean using infrared heating technology in a fully open-air field experiment. Five separate heat waves were applied to field-grown soybean (Glycine max) in central Illinois, three in 2010 and two in 2011. Thirty years of historical weather data from Illinois were analyzed to determine the length and intensity of a regionally realistic heat wave resulting in experimental heat wave treatments during which day and night canopy temperatures were elevated 6 °C above ambient for 3 days. Heat waves were applied during early or late reproductive stages to determine whether and when heat waves had an impact on carbon metabolism and seed yield. By the third day of each heat wave, net photosynthesis (A), specific leaf weight (SLW), and leaf total nonstructural carbohydrate concentration (TNC) were decreased, while leaf oxidative stress was increased. However, A, SLW, TNC, and measures of oxidative stress were no different than the control ca. 12 h after the heat waves ended, indicating rapid physiological recovery from the high-temperature stress. That end of season seed yield was reduced (~10%) only when heat waves were applied during early pod developmental stages indicates the yield loss had more to do with direct impacts of the heat waves on reproductive process than on photosynthesis. Soybean was unable to mitigate yield loss after heat waves given during late reproductive stages. This study shows that short high-temperature stress events that reduce photosynthesis and increase oxidative stress resulted in significant losses to soybean production in the Midwest, U.S. The study also suggests that to mitigate heat wave-induced yield loss, soybean needs improved reproductive and photosynthetic tolerance to high but increasingly common temperatures.

Plant bugs (Hemiptera: Miridae) on field beans and soybeans in Manitoba, Canada: species composition and seasonal occurrence

AbstractIn Manitoba, Canada, commercial soybeans and two types of field beans, navy and pinto, were sampled for plant bugs. At the centre and margins of 36 fields, sweep net and tap tray samples were taken weekly. In all three crops, Lygus lineolaris (Palisot de Beauvois) (Hemiptera: Miridae) comprised >78% and Adelphocoris lineolatus (Goeze) (Hemiptera: Miridae) <10% of adult mirids. Species composition varied among years but not among crops. For Lygus Hahn, nymphs were 46% of the catch in trays and 23% in sweeps, but total Lygus catch in trays was >2% of that in sweeps. Catch/sample effort was similar at field centres and margins for both Lygus adults and nymphs. Lygus lineolaris reproduced and developed in all three crops. In field beans, Lygus adults were first collected in late vegetative and early pod set stages and late instar nymphs and adults were present from pod elongation until maturity – results consistent with immigration of first summer generation reproductive adults and development of the second generation in the crops. There was evidence of late season immigration of Lygus into all crops. There was no loss of seed quantity attributable to mirids in any of the crops; in field beans there was no evidence that mirids reduced seed quality.

RESPONSE OF SNAP BEAN PLANTS TO SOME AGRICULTURAL TREATMENTS FOR EARLY YIELD PRODUCTION

Two field experiments were carried out during two early summer seasons of 2012 and 2013 years at the Experimental Farm of Kaha Station, Qalubia Governorate to study the response of snap bean plants Poulista c.v to some agricultural treatments for early green pods yield production using (flowering, amcotone, super phosphate solution compounds) as foliar nutrition, (charcoal, agriculture sulphur and charcoal + agriculture sulphur) as soil addition and( Pea, onion and broad bean) as protection plants, in addition using black polyethylene plastic as a soil mulch. The results indicated that spraying the plants with flowering and amcotone compounds followed by super phosphate solution had the highest values of fresh and dry plant weight. While addingcharcoal to the soil before sowing snap bean seeds gave the highest values of no. of leaves/ plant followed by spraying withflowering and amcotone compounds, respectively. The data showed also that spraying the plants with flowering, amcotone compounds, super phosphate solution, adding charcoal + sulphur and soil mulch with black polyethylene plastic exerted the highest values on all parameter of green pods its and yield attributes in both growing seasons. Concerning total sugars in dry pods it's clear that using protection plants with broad bean followed byonion were the best treatments on it. Generally it can recommend using any one of the mentioned treatments in this experiment especially flowering, amcotone compounds, super phosphate solution, charcoal + sulphur, respectively to obtain high green pod yield either early or total with the best quality.

Effects of organic farming practices and salinity on yield and greenhouse gas emissions from a common bean crop

A field experiment was conducted at Agrinio, West Greece, to compare the impacts of organic vs. conventional farming practices on yield, N nutrition and greenhouse gas emissions in common bean (Phaseolus vulgaris cv. ‘contender’). In both farming systems, irrigation water containing 0.5 or 10mM NaCl was used. The conventionally treated plots were fertilized with an inorganic fertilizer, whereas the organically treated plots received organic compost. Conventional farming resulted in significantly higher fresh weight of green bean pods than organic farming (5.50kgm−2vs. 3.67kgm−2, respectively). However, the cropping system had no impact on dry pod biomass, because the dry matter content of the organically produced bean pods was higher than that of pods originating from conventional farming (9.88% vs. 7.20%, respectively). The presence of 10mM NaCl in the irrigation water restricted significantly the total plant biomass and fresh pod yield (−22.8%), without any interaction with the farming system. The decrease in fresh pod yield by organic farming was due to a shortage in soil mineral N (NO3− and NH4+) at the early growth stage, which reduced the tissue N levels. Organic farming increased significantly the number or root nodules at the stage of early pod filling in comparison with conventional farming. However, at both systems the total soil N increased appreciably at this developmental stage, although no N was supplied to the crop, thereby pointing to intensive symbiotic N2-fixation by bean. Organic farming resulted in significantly lower N2O emissions than conventional farming in terms of the overall Global Warming Potential of the treatments (363kgha−1vs. 455kgha−1, respectively). However, the N2O emission intensities did not differ significantly between organic and conventional systems, highlighting the importance of maximizing yield within organic systems in order to reduce their environmental impact.

MAGNETIC TREATMENT OF IRRIGATION WATER FOR IMPROVING VEGETATIVE GROWTH, FRESH AND DRY YIELD OF BEAN (PHASEOLUS VULGARIS L.) GROWN UNDER PLASTIC HOUSE

Using magnetic water is an important environmental factor for agriculture in irrigation systems specially drip irrigation. However, its impact on plant growth is not well studied under normal conditions. Two field experiments were conducted during 2011/2012 and 2012/2013 seasons in a plastic house at Horticulture Research Institute, Kaha station, Kalyobia governorate, Egypt to study the impact of magnetized water on growth, yield and some chemical constituents of two bean (Phaseolus vulgaris L.) cultivars and Hama. Results showed significant positive effects of magnetic water on quantity and quality of the studied parameters such as germination %, leaf area/ plant, early and total green pods and seeds weight/ plant. Irrigation with magnetic water gave more vigorous plants. Most studied traits of bean such as vegetative growth (plant height, No. of leaves/ plant, fresh & dry weight/ plant and leaf area/ plant), seed yield and NPK contents of leaves showed significant increase when magnetic water was used. The response of the two cultivars to the magnetic water has similar trend. However, Goya cv gave higher values of vegetative growth measurements as well early and total green pod yield/ plant and seed yield (seed weight/ plant and weight of 100 seeds). The enhancement of these studied characters may be due to that the irrigation with magnetized water make plants absorb more nutrients from soil. Increasing of soil nutrients enhancement photosynthesizes property of plants. This experiment was carried out in order to highlight the efficiency use of magnetic water on bean yield and its components.

Variability of root traits in common bean genotypes at different levels of phosphorus supply and ontogenetic stages

Selection of common bean (Phaseolus vulgaris L.) cultivars with enhanced root growth would be a strategy for increasing P uptake and grain yield in tropical soils, but the strong plasticity of root traits may compromise their inclusion in breeding programs. The aim of this study was to evaluate the magnitude of the genotypic variability of root traits in common bean plants at two ontogenetic stages and two soil P levels. Twenty-four common bean genotypes, comprising the four growth habits that exist in the species and two wild genotypes, were grown in 4 kg pots at two levels of applied P (20 and 80 mg kg-1) and harvested at the stages of pod setting and early pod filling. Root area and root length were measured by digital image analysis. Significant genotype × P level and genotype × harvest interactions in analysis of variance indicate that the genotypic variation of root traits depended on soil nutrient availability and the stage at which evaluation was made. Genotypes differed for taproot mass, basal and lateral root mass, root area and root length at both P levels and growth stages; differences in specific root area and length were small. Genotypes with growth habits II (upright indeterminate) and III (prostrate indeterminate) showed better adaptation to limited P supply than genotypes of groups I (determinate) and IV (indeterminate climbing). Between the two harvests, genotypes of groups II and III increased the mass of basal and lateral roots by 40 and 50 %, respectively, whereas genotypes of groups I and IV by only 7 and 19 %. Values of the genotypic coefficient of determination, which estimates the proportion of phenotypic variance resulting from genetic effects, were higher at early pod filling than at pod setting. Correlations between shoot mass and root mass, which could indicate indirect selection of root systems via aboveground biomass, were higher at early pod filling than at pod setting. The results indicate that selection for root traits in common bean genotypes should preferentially be performed at the early pod-filling stage.

First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States.

Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5'TCCGTAGGTGAACCTGCGG) and ITS4 (5'TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be "mainly" associated with legumes is C. epithymum Murr., and C. pentagona is "especially" associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2).

Transcriptome profiling of peanut gynophores revealed global reprogramming of gene expression during early pod development in darkness

BackgroundAfter the zygote divides few times, the development of peanut pre-globular embryo and fruit is arrested under white or red light. Embryo development could be resumed in dark condition after gynophore is buried in soil. It is interesting to study the mechanisms of gynophore development and pod formation in peanut.ResultsIn this study, transcriptome analysis of peanut gynophore was performed using Illumina HiSeq™ 2000 to understand the mechanisms of geocarpy. More than 13 million short sequences were assembled into 72527 unigenes with average size of 394 bp. A large number of genes that were not identified previously in peanut EST projects were identified in this study, including most genes involved in plant circadian rhythm, intra-cellular transportation, plant spliceosome, eukaryotes basal transcription factors, genes encoding ribosomal proteins, brassinosteriod biosynthesis, light-harvesting chlorophyll protein complex, phenylpropanoid biosynthesis and TCA cycle. RNA-seq based gene expression profiling results showed that before and after gynophore soil penetration, the transcriptional level of a large number of genes changed significantly. Genes encoding key enzymes for hormone metabolism, signaling, photosynthesis, light signaling, cell division and growth, carbon and nitrogen metabolism as well as genes involved in stress responses were high lighted.ConclusionsTranscriptome analysis of peanut gynophore generated a large number of unigenes which provide useful information for gene cloning and expression study. Digital gene expression study suggested that gynophores experience global changes and reprogram from light to dark grown condition to resume embryo and fruit development.

Effect of Sulphur Fertilization on Leg-Haemoglobin and Carboxylase Content at Different Growth Stages of Mungbean (Vigna radiata(L.) Wilczek

An investigation was carried out on mungbean at crop research centre of S.V.P. University of Agriculture and Technology Meerut Uttar Pradesh during spring season 2010. Field experiment was conducted consisting 17 treatments combination and laid out in randomized block design (RBD) with 3 replications on mungbean variety SML-668 which showed a significant variations among themselves in the the Leg-haemoglobin content of nodules, which was highest during the 30 DAS, and decreased during 40 DAS, 50 DAS and was minimum at harvest stage in all the treatments. Improved fertilization of sulphur through various treatments increased the Leg – haemoglobin content of nodules significantly over T17 (control) treatment. Variety SML-668 showed significant variations among themselves in the activity of RuBP case at vegetative, early pod setting and active pod filling stage. The magnitude of enzyme activity was in the range of 33.21 to 9.71 mg CO2 dm−2 hr−1 during vegetative stage, in treatment T15 (23.18) as compared to T17 control (9.71). During early pod setting (33.21) and during active pod filling stage (27.42).

Oil, Fatty Acid Profile and Karanjin Content in Developing Pongamia pinnata (L.) Pierre Seeds

AbstractOil content, fatty acid composition and karanjin content were studied in developing pongamia seeds, at intervals of 3 weeks from 30 weeks after flowering up to 42 weeks. Three marked stages in seed development were observed at the early green pod stage, the middle half brown stage and the late dark brown stage. Significant variation in seed biomass, pod and seed characteristics were observed. A significant (P < 0.01) decrease in the moisture content of the seeds was observed during seed development. The oil content gradually increased from 32.06 to 36.53 % as the seed matured. A significant variation in fatty acid composition was detected across all stages of seed development. Palmitic acid (16:0) content marginally decreased from 11.81 to 10.18 %, while stearic acid (18:0) and linolenic acid (18:3) remained constant at all stages of seed maturity. A steady increase in oleic acid (18:1) content from 38.11 to 49.11 % was observed, while the linoleic acid (18:2) content decreased from 30.14 to 18.85 %. The iodine value increased, while the saponification number of oil decreased during seed development. The increase in karanjin content was steady. Seeds harvested after 42 week after flowering yielded the maximum oil with high oleic acid content which could be suitable for biodiesel production.

Developmental effects on ureide levels are mediated by tissue-specific regulation of allantoinase in Phaseolus vulgaris L.

The ureides allantoin and allantoate are key molecules in the transport and storage of nitrogen in ureide legumes. In shoots and leaves from Phaseolus vulgaris plants using symbiotically fixed nitrogen as the sole nitrogen source, ureide levels were roughly equivalent to those of nitrate-supported plants during the whole vegetative stage, but they exhibited a sudden increase at the onset of flowering. This rise in the level of ureides, mainly in the form of allantoate, was accompanied by increases in allantoinase gene expression and enzyme activity, consistent with developmental regulation of ureide levels mainly through the tissue-specific induction of allantoate synthesis catalysed by allantoinase. Moreover, surprisingly high levels of ureides were also found in non-nodulated plants fertilized with nitrate, at both early and late developmental stages. The results suggest that remobilized N from lower leaves is probably involved in the sharp rise in ureides in shoots and leaves during early pod filling in N(2)-fixing plants and in the significant amounts of ureides observed in non-nodulated plants.

The Critical Period of Weed Control in Lentil (Lens culinaris) in the Pacific Northwest

The critical period of weed control (CPWC) for ‘Pardina’ and ‘Brewer’ lentil was determined in field experiments near Pullman, WA, in 2008 and 2009. Trial treatments were kept either weed free for periods of 0, 14, 25, 35, 45, 60, 75, or ∼90 d after emergence (DAE), or weeds were allowed to grow before removal for periods of 0, 14, 25, 35, 45, 60, 75, or ∼90 DAE. Averaged across varieties, lentil with season-long weed interference had 29.5 and 32% seed yield reduction compared to weed-free lentils in 2008 and 2009, respectively. When measured at crop maturity, a 1% loss in lentil seed yield resulted from each 5.68 g m−2of dry weed biomass. Based on a 5% yield loss threshold, the CPWC for lentil was estimated to be from 270 to 999 growing degree days (GDD), 22 to 57 DAE, or crop growth stage (CGS) 7 to the early pod stage during 2008. In 2009, the CPWC was 624 to 650 GDD, with no occurrence of a CPWC when estimated using DAE and CGS. Spiny sowthistle emerged and competed with the lentil crop later in the growing season than mayweed chamomile, indicating that mayweed chamomile may be an earlier and stronger competitor than spiny sowthistle.

Mapping QTL for Fusarium wilt Race 2 partial resistance in pea (Pisum sativum)

With 3 figures and 4 tablesAbstractFusarium oxysporum f.sp. pisi (Fop) exists in pea production regions worldwide and causes a vascular wilt resulting in significant crop losses. Four races of Fop have been identified, and resistance to each was reportedly conferred by an individual single dominant gene. Fnw confers resistance to Fop race 2, which can be a serious pathogen for both green and dry pea production in the Pacific Northwest region of the United States. The objectives of this research were to (i) place Fnw on the Pisum genetic map, (ii) detect additional genetic factors associated with resistance to race 2 and (iii) identify closely linked markers for use in pea breeding A recombinant inbred line (RIL) population of 187 F7‐derived lines from the cross ‘Shawnee’/‘Bohatyr’ was developed by single‐seed decent. All 187 RILs, the parents and one set of race 2 pea differential entries were inoculated with Fop race 2 under controlled conditions in three experiments, each with two or three replications per entry. Disease reactions were recorded as percentage diseased plants 10–14 days postinoculation or at regular intervals through flowering or early pod fill. Data for progressive wilting over time, typical of Fop race 2, were used to calculate area under disease progress curve (AUDPC) values. Data for percentage diseased plants placed the putative single gene Fnw on Pisum sativum linkage group IV, with LOD scores ranging from 40.0 to 65.6 and minor loci on LG III (LOD 3.97 and 4.60). AUDPC values allowed for the detection of additional QTL on linkage group III with LOD scores of 3.97 and 4.60. The presence of recombinants in the population indicated that complementary genes were contributed by each parent, both of which showed intermediate reaction to Fop race 2. Results of this research provide a basis for marker‐assisted selection of the major Fnw loci in both green and dry pea breeding programmes, but additional research is necessary to fully characterize the complementary gene action governing resistance of the two minor loci identified.

Irrigated Soybean Can Have a Small Response to Nitrogen Applied During Early Reproductive Growth

Abstract High-yield soybean ( Glycine max L.) has a high rate of N uptake during grain fill which may exceed N available from biological N fixation and mineralization of soil organic N. Other research findings show a low probability of response to N applied at early grain fill for yield 60 bu/acre yield are inconsistent. The effect of applying N and S to the soil at early podfill was determined in Nebraska by conducting 56 irrigated trials, including 44 with mean yield >60 bu/acre. Mean yield increases with 27 lb/acre N applied and >60 bu/acre yield were 2.5 bu/acre in south-central, 1.6 bu/acre in northeast, and not significant in southeast Nebraska. There was no added yield with applying 54 compared with 27 lb/acre N or with the addition of 4.5 lb/acre S. Variations in soil properties and in leaf N and S concentrations were not related to yield or the response to applied N. Depending on the grain to fertilizer price ratio, application of N at early pod fill may be profitable, especially if the cost of application is low such as through fertigation.

Genomic analysis of phospholipase D family and characterization of GmPLDαs in soybean (Glycine max)

Phospholipase D (PLD) and its product phosphatidic acid play important roles in the regulation of plant growth, development, and stress responses. The genome database analysis has revealed PLD family in Arabidopsis, rice, poplar and grape. In this study, we report a genomic analysis of 18 putative soybean (Glycine max) PLD genes (GmPLDs), which exist in the 14 of 20 chromosomes. GmPLDs were grouped into six types, α(3), β(4), γ, δ(5), ε(2), and ζ(3), based on gene architectures, protein domains, evolutionary relationship, and sequence identity. These GmPLDs contained two HKD domains, PX/PH domains (for GmPLDζs), and C2 domain (for the other GmPLDs). The expression patterns analyzed by quantitative reverse transcription PCR demonstrated that GmPLDs were expressed differentially in various tissues. GmPLDα1, α2, and β2 were highly expressed in most tissues, whereas GmPLDδ5 was only expressed in flowers and GmPLDζ1 was predominantly expressed in flowers and early pods. The expression of GmPLDα1 and α2 was increased and that of GmPLDγ was decreased by salt stress. GmPLDα1 protein expressed in E. coli was active under the reaction conditions for both PLDα and PLDδ, hydrolyzing the common membrane phospholipids phosphatidylcholine, phosphatidylethanolamine, and phosphatidylglycerol. The genomic analysis for soybean PLD family provides valuable data for further identity and characterization of their functions.

Faba bean productivity in saline–drought conditions

The response of faba bean ( Vicia faba L., variety ILB1814) was evaluated in a factorial salinity–drought experiment, combining three levels of salinity in the irrigation water (EC 1.0, 2.3 and 3.6 dS/m) and two levels of plant water status during two successive cropping seasons. The two levels of plant water status were obtained by supplying irrigation when the pre-dawn leaf water potential of the control treatments attained values of −0.3 and −0.6 MPa. The experiment was designed to analyse the effects of soil salinity, the effects of drought (detected by the level of the plant water status), and the combined effect of salinity and drought on the plant–water relationships, nitrogen balance and crop productivity (for both grain and straw). Soil salinity levels equal to or higher than 6.5 dS m −1 affected the plants by reducing the grain number but not the straw weight. Drought at flowering, early podding and grain-filling stages reduced both grain and straw yields. Moreover, yield reductions were associated with increasing soil salinity levels, confirming an interaction between the salinity and drought effects on faba bean productivity. Symbiotic nitrogen fixation, as evaluated by the nitrogen balance, was more affected by drought than by salinity, and it may explain the absence of any observed effects of salinity under drought conditions. The comparison of these results with those obtained in similar experiments on wheat and barley revealed that these cereals and faba bean have contrasting behaviours under saline-drought conditions.

Green manure and phosphate rock effects on phosphorus availability in a northern Great Plains dryland organic cropping system

Maintaining or improving soil phosphorus (P) fertility is challenging for dryland organic producers in the northern Great Plains (NGP) of North America because of the region’s high pH, calcareous soils combined with limited supplies of P-rich organic materials, such as manure. Certain inorganic P sources, such as phosphate rock (PR), are allowed on organic farms yet are sparingly soluble in neutral to alkaline soils. Green manure (GM) crops may improve availability of PR, yet little is known on their ability to dissolve PR in NGP soils. A 2-year cropping sequence study was conducted on a Montana farm that had been managed organically for 20 year. First-year crop treatments included spring pea (Pisum sativum L.), buckwheat (Fagopyrum esculentum L.), yellow mustard (Sinapis alba L.), and tilled fallow, fertilized with 0, 3.1, and 7.7 kg available P ha−1 as PR, and terminated at early pod stage with tillage. Following GM incorporation, winter wheat (Triticum aestivum L.) was sown in the fall and harvested at maturity. Aboveground P uptake of winter wheat was not affected by previous GM crop or PR rate, despite differences in GM P uptake amounts among crops and PR rates. Labile P fractions in the surface soil (0–0.15 m) were also not increased over pre-fertilization levels by PR rate or previous crop. The results suggest GMs have a limited ability to increase P availability of PR for a subsequent crop in this region.